ID: 945008911

View in Genome Browser
Species Human (GRCh38)
Location 2:205440990-205441012
Sequence CAATTGTAAAAGATTTATTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 437
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 403}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945008908_945008911 -6 Left 945008908 2:205440973-205440995 CCTTTCTCCTAAGAGACCAATTG 0: 1
1: 0
2: 1
3: 7
4: 132
Right 945008911 2:205440990-205441012 CAATTGTAAAAGATTTATTCAGG 0: 1
1: 0
2: 2
3: 31
4: 403

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945008911 Original CRISPR CAATTGTAAAAGATTTATTC AGG Intronic
900235342 1:1586806-1586828 AAAAAGTAAAATATTTATTCAGG + Intergenic
901884080 1:12210540-12210562 CAAGTGTAAAATATTGATTCTGG - Intergenic
903729390 1:25480194-25480216 CAATTTTAAAAAATTTATGATGG - Intronic
906421509 1:45672060-45672082 CTTTTTAAAAAGATTTATTCAGG + Intronic
906555491 1:46709202-46709224 CAAAGGTGAAATATTTATTCAGG - Intronic
907029365 1:51155569-51155591 CAATTTTAAAAGATGTAGTCTGG + Intergenic
907344298 1:53761578-53761600 CCATTTTAAAAGATTAATGCTGG + Intergenic
908103178 1:60812148-60812170 GAAGTGTAAGAGATTTATTGAGG + Intergenic
908447683 1:64216464-64216486 CTATGGAAAAAGATTTCTTCTGG + Intronic
910032382 1:82743855-82743877 CAATTGAAAGACATTTATACAGG - Intergenic
910271207 1:85396732-85396754 CGATATTAAAATATTTATTCAGG + Intronic
910472137 1:87565801-87565823 GAATTGTAAAAGATTAACTCAGG - Intergenic
911584227 1:99671943-99671965 CATTTGTAAAAAATTTCTACAGG - Intronic
913336267 1:117711260-117711282 CATTTGGAAAAAATTTAATCTGG - Intergenic
914254480 1:145950225-145950247 CAATTGCAAGAGATTTATCAGGG + Intronic
916795807 1:168166074-168166096 AAATTGTAAAACACTTATTGTGG + Intergenic
917197221 1:172479658-172479680 AAATTGTAAAATATTTTTTATGG + Intergenic
917624037 1:176827860-176827882 AAAATGTAAAGGATTTTTTCTGG + Intronic
917759899 1:178145125-178145147 CATTTGTAAAAAACTCATTCTGG - Intronic
918649651 1:186945428-186945450 ATATTTTTAAAGATTTATTCTGG + Intronic
918946769 1:191076357-191076379 GAACTGTTAAAGATTTATTTTGG - Intergenic
919545779 1:198916609-198916631 GAATTTAAAAAGATTTATTAAGG - Intergenic
920752743 1:208695906-208695928 CATTTGTAAAATATTTATTCTGG - Intergenic
920886514 1:209934149-209934171 GAATTGTAAATGATATATTAAGG - Intergenic
922593012 1:226792809-226792831 GAAAAGTATAAGATTTATTCTGG + Intergenic
923798797 1:237186578-237186600 CAAGATTGAAAGATTTATTCTGG + Intronic
923984630 1:239367479-239367501 CACTTGTGAAGGATTTATCCTGG - Intergenic
924171943 1:241351498-241351520 CATATGTGAAAGATTTATTCAGG + Intronic
924628568 1:245715829-245715851 CAACTGGAAAAGAATAATTCAGG - Intergenic
1062870912 10:903367-903389 AAATTATAAAAGATTGAATCAGG - Intronic
1063761507 10:9083713-9083735 TAATTTAAAAAGATTCATTCTGG - Intergenic
1063837013 10:10026915-10026937 CAATTTCAGAATATTTATTCTGG + Intergenic
1065160898 10:22920352-22920374 CAAATTAAAAAAATTTATTCAGG - Intergenic
1065399700 10:25285140-25285162 CAATATTAAAAGAGTTCTTCAGG - Intronic
1066396596 10:35030224-35030246 CAATTGAAAAAGTTCTATTTAGG + Intronic
1066702442 10:38144461-38144483 CAATTATAAAATATATATTTTGG + Intergenic
1068106754 10:52627568-52627590 CAAGTTTCAAAGATTTATTATGG + Intergenic
1068291851 10:55013295-55013317 CATTTTCAAAAGATTTTTTCAGG - Intronic
1068439611 10:57033959-57033981 AAATTTTAATAAATTTATTCAGG + Intergenic
1068459462 10:57308269-57308291 AAATTGTAAATGATGTATTTTGG + Intergenic
1070501111 10:77073298-77073320 CAATTGTTTAACATTTCTTCTGG + Intronic
1071030964 10:81180911-81180933 TAATTGTGAAAAATATATTCAGG - Intergenic
1071688942 10:87794745-87794767 CAATTTTAAAAGCTTTATTTAGG - Intronic
1074299784 10:112223241-112223263 GATATGTAAAAGATTTATTGGGG - Intergenic
1074744101 10:116514273-116514295 CAATTGTATATGATTTTTTCAGG - Intergenic
1076622090 10:131796550-131796572 CTTTTGTCAAAGATTCATTCAGG + Intergenic
1077775026 11:5261114-5261136 CAATTTTTAAAAATTTATTGAGG - Intronic
1078572308 11:12469730-12469752 CAATTGGAAATGTTTTTTTCAGG - Intronic
1079939548 11:26661434-26661456 CTATTGTAATATGTTTATTCGGG + Exonic
1080730521 11:34947107-34947129 TAATTGTAAAACTTTTCTTCAGG + Intronic
1081341346 11:41931810-41931832 AAATTGCAAAAGATTCACTCAGG + Intergenic
1082047842 11:47745005-47745027 AAATTGTAAAAGTGTTATTTGGG - Intronic
1082736010 11:56856489-56856511 TAAATGTAAAAGTTTGATTCAGG + Intergenic
1085148617 11:74228069-74228091 GAATTGTTCAAGAATTATTCTGG + Intronic
1085187892 11:74591864-74591886 CAATTATTAAAGATTTTTGCGGG + Intronic
1085712589 11:78843324-78843346 TAATTTTAAAAAATTTAGTCAGG + Intronic
1086150003 11:83598708-83598730 TAAATGTAAATGAATTATTCAGG + Intronic
1086599889 11:88620074-88620096 TAATGGCAAAAGATTAATTCTGG - Intronic
1086664116 11:89458210-89458232 CATTTGCAAAAGATTTAATCTGG + Intronic
1086733074 11:90272673-90272695 CTGTTTTAAAAGATTTTTTCTGG + Intergenic
1087449720 11:98304174-98304196 TAATGGTAATAGAATTATTCAGG + Intergenic
1087905807 11:103695648-103695670 CAATTGTACAACACTTACTCTGG - Intergenic
1087934064 11:104011710-104011732 CACTTGTAAAACATTTATAAAGG + Intronic
1088336226 11:108707076-108707098 CAATTGTAGCAGATGTATTCTGG - Intronic
1089396539 11:118139739-118139761 CAATTGTAAAATAATAATTATGG + Intronic
1091195449 11:133727012-133727034 AAATAGTAGAACATTTATTCAGG - Intergenic
1092525724 12:9309101-9309123 CAATATAAAAAGATCTATTCAGG + Intergenic
1092541563 12:9422714-9422736 CAATATAAAAAGATCTATTCAGG - Intergenic
1093261766 12:16947289-16947311 GATTTGTAAATGATTTATTGTGG - Intergenic
1094084121 12:26570591-26570613 CATTTGTAAAAGATATTTTATGG + Intronic
1094511479 12:31099788-31099810 CAATATAAAAAGATCTATTCAGG + Intronic
1095044343 12:37484086-37484108 CAAGTATAAAAGATTTATAGTGG - Intergenic
1097330022 12:58322972-58322994 ACATTGTAAAAGGATTATTCTGG - Intergenic
1098182858 12:67866539-67866561 CAATTGTTATTGATCTATTCAGG + Intergenic
1099246356 12:80197507-80197529 TTATTTAAAAAGATTTATTCTGG - Intergenic
1099767572 12:87007633-87007655 CATTTCTAAAATATGTATTCTGG - Intergenic
1101298040 12:103446448-103446470 CAATTTTAAAAAAGGTATTCAGG + Intronic
1104215650 12:126730402-126730424 CAATTGTTAAAGACTTCTTAAGG + Intergenic
1106743851 13:32678580-32678602 CAAATGTATATGGTTTATTCAGG + Intronic
1107153655 13:37141409-37141431 CAAATGAAAAATATTTATTTGGG - Intergenic
1107280435 13:38727219-38727241 TAATTCTAAAAGAATAATTCTGG + Intronic
1107564061 13:41583837-41583859 CAATTATAAAAGATATTTTTGGG + Intronic
1107701121 13:43048696-43048718 CAGTTGTAAAAGAATTTTTTTGG + Intronic
1108891448 13:55265567-55265589 GAAGTGTAAAATATTTATTGGGG - Intergenic
1109069941 13:57751766-57751788 CAATTATAAAAAAATTATTCTGG + Intergenic
1109627104 13:64989327-64989349 CAATTTTAAAACACTTTTTCAGG - Intergenic
1109649642 13:65309572-65309594 TAATTGTAAAACTTTTTTTCTGG - Intergenic
1109899443 13:68746228-68746250 CAAATGTAAAAGAGGTATACAGG - Intergenic
1110488631 13:76075869-76075891 CAAATGTAAGAGATTTATAGAGG - Intergenic
1110909944 13:80946390-80946412 CAGTTTTAAAATATGTATTCTGG - Intergenic
1110947248 13:81437669-81437691 CAATAGAAAAAGATGTAATCAGG - Intergenic
1111494259 13:89027354-89027376 CATTGGTAAAAGATTTAGTAAGG - Intergenic
1111768657 13:92567962-92567984 AAATTGAAAAAGAAATATTCAGG + Intronic
1112811065 13:103219434-103219456 CAATTATAAAAAATCTATTTAGG + Intergenic
1113147681 13:107226332-107226354 AAAATGTAAAAGATATTTTCTGG - Intronic
1113374700 13:109753695-109753717 TAATTTTAAAACTTTTATTCTGG - Exonic
1115053391 14:29092365-29092387 CAAAGGAAAAAGATTCATTCAGG - Intergenic
1115925048 14:38423686-38423708 CAATTCTAATAGATTTCTTATGG + Intergenic
1116526585 14:45913509-45913531 TATTTGAAAAATATTTATTCAGG + Intergenic
1116754847 14:48934953-48934975 ATGTTTTAAAAGATTTATTCAGG - Intergenic
1117229675 14:53703158-53703180 AAAGTGTAAGAGATTTATTTAGG + Intergenic
1117580367 14:57145421-57145443 CAAGTGTTAAAGAATTATCCTGG + Intergenic
1118016349 14:61664961-61664983 CACTTGTAAAAGATATTTTGGGG - Intergenic
1120361317 14:83506219-83506241 CACTGGTAAAAGAGTTATTAAGG - Intergenic
1120545530 14:85807021-85807043 CAATTTTTAAAAATTTATTGAGG + Intergenic
1121700098 14:95946297-95946319 CAATTTTTAAAGCTTTATTAAGG - Intergenic
1121891042 14:97590958-97590980 CAATTGTAAAACATTAATGGAGG - Intergenic
1122728735 14:103779121-103779143 TAATTTTAAAATATTTATTGTGG - Intronic
1202892641 14_KI270722v1_random:173900-173922 AGATAGTCAAAGATTTATTCAGG - Intergenic
1202942895 14_KI270725v1_random:171770-171792 CAAGTATAAAAGATTTATAGTGG - Intergenic
1124037213 15:26065543-26065565 CAATTCTAAGAGGTTTAATCAGG - Intergenic
1124157602 15:27240554-27240576 ATATTGTAAATGATTTATTTTGG - Intronic
1124225731 15:27893206-27893228 AAATTATAAAAGTATTATTCAGG - Intronic
1126123637 15:45275632-45275654 TAAATGTAAAAGATTCATTTTGG + Exonic
1126949160 15:53860783-53860805 CAATTTTATAAGACTTTTTCAGG - Intergenic
1127117186 15:55740750-55740772 CAACTGTAAAACACATATTCAGG + Intronic
1127792229 15:62408336-62408358 CTGTTTTAAAAAATTTATTCAGG - Intronic
1129954850 15:79626984-79627006 AAATTCAAAATGATTTATTCTGG + Intergenic
1130385694 15:83409625-83409647 CAACACTACAAGATTTATTCTGG + Intergenic
1133645117 16:7756768-7756790 CAATTGGAAAAAAGTTCTTCTGG - Intergenic
1134633616 16:15775695-15775717 CAAATATAAAAGATGCATTCTGG - Intronic
1135192532 16:20366608-20366630 CAGTTGCAAAACATTTATTGAGG - Intronic
1135603032 16:23799539-23799561 CTAATGGAAAAGATTTATTCAGG - Intergenic
1137310958 16:47257958-47257980 CAAATGTAGAAGGTTGATTCAGG + Intronic
1137311299 16:47262198-47262220 CATTTGTTAAAGAATTGTTCTGG - Intronic
1137523614 16:49214386-49214408 CATTTGTAAAAAACTTATTCTGG + Intergenic
1137891167 16:52163266-52163288 CAAATAAAAAACATTTATTCAGG - Intergenic
1139417498 16:66825688-66825710 TAACTGTAACAGATTTATTCAGG + Intronic
1144075727 17:11717614-11717636 CAATTGTATCAGCTTTATTGAGG + Intronic
1144238012 17:13281361-13281383 CACATGAAAAAGATTTTTTCTGG - Intergenic
1144691320 17:17267015-17267037 CAATTTTAAAAAAATGATTCGGG + Intronic
1149108909 17:53002333-53002355 CAATTTCAAAAGTTTTATTGTGG - Intergenic
1149203669 17:54217782-54217804 CAATTTTCAAAGAATTATTGAGG - Intergenic
1152345652 17:79749064-79749086 CAATTTTAATATATTTATGCTGG + Intergenic
1153284111 18:3441850-3441872 TAAATGTAAAAGTTTTATGCTGG - Intronic
1154467516 18:14663284-14663306 CAATTTAAAAATATTTATTAGGG - Intergenic
1154524777 18:15274306-15274328 AAATTTTAAAATATTCATTCAGG - Intergenic
1155755888 18:29495454-29495476 AAATTGTAAAATCTTTATTTAGG + Intergenic
1155855180 18:30825190-30825212 AAAATGTAAAAGGATTATTCTGG + Intergenic
1155891199 18:31271391-31271413 CAGTTGTAAATGATATATTTGGG + Intergenic
1157426602 18:47589749-47589771 CAATGGTAAAAGAATTTTACAGG + Intergenic
1160161559 18:76476378-76476400 CAGTTGTCAATGTTTTATTCTGG + Intronic
1164238275 19:23357662-23357684 AAATTAAAAAAGATTTATTCGGG + Intronic
1166896826 19:46028495-46028517 TAATTGTAACAGATTAAATCAGG - Intergenic
926453140 2:13031036-13031058 AGATTATAGAAGATTTATTCTGG - Intergenic
926556771 2:14366468-14366490 AAAATGTAAAAGATAGATTCTGG + Intergenic
926617815 2:15015889-15015911 CAATTCTAAAAGTTTTTTTTTGG - Intergenic
926893163 2:17656160-17656182 CAATTGTTATAAATTTATTTGGG - Exonic
928263883 2:29793035-29793057 CAATTTTGAAAGATTTACTGTGG - Intronic
928642622 2:33316297-33316319 AAATTGCAAAAGTTTTGTTCTGG + Intronic
928781553 2:34828171-34828193 CATTTATAAAAAATTTATTCTGG - Intergenic
929718923 2:44346020-44346042 CAACTGTAATATATTAATTCTGG - Intronic
930175183 2:48294359-48294381 CATTTGTAAAAGATGTTTTGGGG + Intergenic
930420595 2:51148834-51148856 CAATTATAATAGAATTATTTAGG - Intergenic
930452922 2:51566164-51566186 CAATTGGAAGAGATAAATTCTGG - Intergenic
931449545 2:62356852-62356874 GAATTTTAAAAAACTTATTCAGG - Intergenic
931512136 2:63010603-63010625 CAATTGTAAAACATTTATTTAGG + Intronic
933327860 2:80861896-80861918 AAATTGTAAAGAATTTATTTGGG + Intergenic
934498045 2:94827680-94827702 AAATTTTAAAAGTTATATTCTGG + Intergenic
935977170 2:108590038-108590060 CATTTGGAAAACATTTATTAAGG + Intronic
938368467 2:130754570-130754592 CTAGTGTAAAAGATTTTTCCAGG + Intergenic
939706750 2:145463912-145463934 AAATTGTGAAACATTTTTTCAGG + Intergenic
939726426 2:145726768-145726790 CAATGGAAAAAGAGTAATTCAGG - Intergenic
939783329 2:146476528-146476550 AAATTTTAAAAGGTTTATTATGG + Intergenic
940349577 2:152667092-152667114 CTATTTCAAAAGATTTATTTAGG - Intronic
940884805 2:158979957-158979979 CAATTGTGAAATTCTTATTCAGG + Intronic
941117991 2:161493712-161493734 CAATTTTATAATATTTTTTCAGG + Intronic
941483761 2:166052342-166052364 GAATTTTAAAATATTTATTCAGG - Intronic
941685279 2:168441557-168441579 CAATCAATAAAGATTTATTCTGG - Intergenic
942482001 2:176398514-176398536 TTATTTTAAAACATTTATTCAGG - Intergenic
943875618 2:193063562-193063584 CCATAGTAAAAGATGTATTAAGG + Intergenic
943914824 2:193617208-193617230 TAAATGTAAACAATTTATTCTGG + Intergenic
943949389 2:194111306-194111328 CACTTATAAAAAATATATTCAGG - Intergenic
944794725 2:203171306-203171328 AAATTTTAAGACATTTATTCTGG + Intronic
945008911 2:205440990-205441012 CAATTGTAAAAGATTTATTCAGG + Intronic
945108207 2:206337137-206337159 CTATTGCAAATGATTTATTAAGG + Intergenic
945329975 2:208528220-208528242 CACTTTTAAAAGATATATTTAGG - Intronic
946209239 2:218134110-218134132 TTATTTTAAAAGATGTATTCTGG - Intronic
946579854 2:221116634-221116656 CAATTGAAAAATAATTAATCTGG + Intergenic
947022084 2:225690395-225690417 CAATTTCAAAAGATTTATTGAGG + Intergenic
947253189 2:228132400-228132422 CAATTGAGAAAAATTTATTTGGG - Intronic
947317400 2:228876203-228876225 CAATTTTAAAAGATTATTTTTGG - Intronic
948538788 2:238669946-238669968 AATTTGAAAAAGACTTATTCAGG + Intergenic
1169476959 20:5940245-5940267 GAAGTGTAAGAGATTTATTGAGG - Intronic
1169672373 20:8116745-8116767 TACTTGAAAGAGATTTATTCAGG - Intergenic
1171170202 20:23009495-23009517 AATTTTTAAATGATTTATTCGGG - Intergenic
1171538888 20:25927708-25927730 CAAGTATAAAAGATTTATAGTGG - Intergenic
1171802147 20:29632562-29632584 CAAGTATAAAAGATTTATAGTGG + Intergenic
1171841827 20:30223034-30223056 CAAGTATAAAAGATTTATAGTGG - Intergenic
1174844125 20:53927115-53927137 AAATTTTAAAAGACTCATTCTGG + Intergenic
1175214402 20:57383867-57383889 CTATTGAAAAATATTTTTTCAGG + Intergenic
1176806995 21:13494394-13494416 CAATTTAAAAATATTTATTAGGG + Intergenic
1177145504 21:17403258-17403280 CAATTGAAAAGGATGTATTTTGG - Intergenic
1177225923 21:18255996-18256018 CAATTTTAATAGATTTGTTTCGG + Intronic
1177275491 21:18907825-18907847 CACTTATAAAAGATGTATTTGGG + Intergenic
1179815264 21:43901787-43901809 CATTTCTAGAAGATTTATTTGGG - Intronic
1182581933 22:31319083-31319105 CAGTTGCAACAGATTTATTGGGG - Intergenic
1184801064 22:46759932-46759954 GAATGGTAAAAGATAAATTCAGG - Intergenic
949822576 3:8132114-8132136 TAATTGTAAAAATTTTCTTCTGG - Intergenic
951184027 3:19691110-19691132 CAATTTTTAAAAATTTATTGAGG - Intergenic
951730770 3:25808159-25808181 GGATTTTAAAAGAGTTATTCTGG - Intergenic
951837569 3:27000139-27000161 CAACTTTAAAAAATTTATTCAGG - Intergenic
951844557 3:27071693-27071715 CCATTATAAAAGATTTACTCTGG - Intergenic
951848844 3:27115896-27115918 CAATTGTGAAAGATGAATTGAGG - Intronic
951852186 3:27153567-27153589 CAATTTTTAAACATTTATTGAGG - Intronic
951910381 3:27744015-27744037 AAAATGTAAAATACTTATTCAGG - Intergenic
952044009 3:29295801-29295823 TAATTCTAAAATATATATTCAGG + Intronic
952126599 3:30307960-30307982 CAATACTTACAGATTTATTCAGG + Intergenic
952856379 3:37774021-37774043 AAATTGTAGATGATATATTCTGG - Intronic
955248924 3:57258021-57258043 CAAATGTAAATGACTTTTTCTGG - Intronic
955509728 3:59667371-59667393 AATTTCTAAAATATTTATTCTGG + Intergenic
955556722 3:60146087-60146109 CAATTGTAAGAGATTTGGACTGG - Intronic
955909266 3:63843416-63843438 TAATTTTAAAAGAATTATTGAGG - Intronic
956303751 3:67801992-67802014 CATTTAAAAAAAATTTATTCAGG + Intergenic
956407347 3:68941621-68941643 CAACTCTAAAAGAGATATTCAGG + Intergenic
957772282 3:84709394-84709416 CATTTTTAAAAAATTTATTGAGG - Intergenic
957874391 3:86127114-86127136 TATTTGGAAAAGATCTATTCTGG + Intergenic
958644311 3:96850117-96850139 CTATTGTAAGTGATTTATTTTGG + Intronic
958663890 3:97108692-97108714 CATTTTTAATAGCTTTATTCTGG + Intronic
958706911 3:97667324-97667346 CAAAAGTAACAGATTTAATCTGG - Intronic
958932614 3:100224096-100224118 GAATTTTAAAAAATATATTCTGG - Intergenic
959451612 3:106510565-106510587 TATTTTTAAAACATTTATTCAGG + Intergenic
960032076 3:113064175-113064197 AATTTGTCAAATATTTATTCTGG + Intergenic
960306151 3:116063227-116063249 CTATTGTAAAATATTTAATGAGG - Intronic
962723880 3:138202956-138202978 CTTTTGAAAAAAATTTATTCAGG - Intronic
962816163 3:139003038-139003060 CAATTTTGAAAGTGTTATTCTGG + Intergenic
963405620 3:144860126-144860148 CAATTGTAAAATTTTAATTAAGG + Intergenic
963436643 3:145277060-145277082 CAAATGTATAAGATTATTTCAGG + Intergenic
963653497 3:148014832-148014854 CTATTTTGAATGATTTATTCAGG - Intergenic
963860330 3:150303316-150303338 CTCTTGTCAAAGATTTCTTCAGG - Intergenic
964252983 3:154741656-154741678 CAATTTTTAAAAATTTATTGAGG - Intergenic
964462293 3:156947311-156947333 CAATTGGAAAAGAGTAAATCTGG - Intronic
964999389 3:162933408-162933430 CTATTTAAAAAGATTGATTCAGG - Intergenic
965028411 3:163331401-163331423 TAAATGTAAAACATTGATTCTGG - Intergenic
965974270 3:174602492-174602514 CAATTGTAATAGTTTTCTTGTGG + Intronic
966354641 3:179067210-179067232 CAAATGTAAATGATCTATGCTGG - Intronic
966401949 3:179556770-179556792 CAATTTTAAAATATTTACTTTGG - Intergenic
966497817 3:180600872-180600894 CAACTGTAAAAGATAAATTTGGG - Intergenic
966619626 3:181949945-181949967 CAATTGTAGAGGATGTATTCTGG + Intergenic
966738294 3:183207932-183207954 CAATTCTAAAAGTGCTATTCAGG + Intronic
966805324 3:183803209-183803231 GAATCGTAAGAGCTTTATTCAGG + Intronic
967359312 3:188611507-188611529 CAATTGCAACAGATTTACCCAGG + Intronic
967621548 3:191640442-191640464 CAATTGTAGAAATTTTATTTTGG + Intergenic
970222247 4:13823230-13823252 CCATTAGAAAAGTTTTATTCTGG + Intergenic
970546976 4:17139724-17139746 AAATTATAAAAGTTTTATTTGGG - Intergenic
971553846 4:27987141-27987163 CAATTATAAAAGGCTTATACAGG - Intergenic
972585168 4:40431104-40431126 CAATTGAAAAAGAATTATCCAGG - Intronic
972820434 4:42695534-42695556 CAAACGTAAAAGATTTTCTCCGG - Intergenic
973730023 4:53814326-53814348 CAACTGTAAAGTATTTATTTTGG - Intronic
973974986 4:56254143-56254165 CTATTGTCTAAGATTTAGTCTGG + Intronic
974247870 4:59344812-59344834 CAATTTTTAAACAATTATTCTGG + Intergenic
974280711 4:59787953-59787975 CAAATTTAAAATATTTATTAGGG + Intergenic
974282584 4:59817751-59817773 TAATTGTAAAACATTAATTGAGG + Intergenic
975446152 4:74467924-74467946 CAATGGCCAAAGATTTAATCAGG + Intergenic
975470033 4:74755532-74755554 CAAATGGAAATGAATTATTCTGG - Intronic
975988736 4:80234323-80234345 AAAGTGTATTAGATTTATTCTGG - Intergenic
976520995 4:86026349-86026371 CAATTGTTACAGATCAATTCAGG + Intronic
976797426 4:88950064-88950086 TAATTTTAAAAGTTTTATACTGG + Intronic
977523335 4:98113258-98113280 CAATGGAAAGAGACTTATTCGGG + Intronic
979249362 4:118548458-118548480 CAATTTTTAAATATTTATACAGG + Intergenic
979306940 4:119156588-119156610 GAATTTTAAAAGATCTATTTTGG - Intronic
979752990 4:124302720-124302742 AAATTGTAAATGATCCATTCTGG + Intergenic
979753068 4:124303403-124303425 CACTTTTAGAAGATTTCTTCAGG - Intergenic
980228758 4:130020718-130020740 TAATTGAAAAGGATTTATTATGG + Intergenic
980985158 4:139687892-139687914 CAATTTTAAAAAATGTATTCTGG - Intronic
981409661 4:144414064-144414086 CAATTATCAAAGCTTTCTTCAGG + Intergenic
981535755 4:145797781-145797803 TAAATGGAAATGATTTATTCTGG + Intronic
981551782 4:145948823-145948845 CAGTTATAAAACATTTATTGAGG + Intergenic
981840174 4:149102544-149102566 CAGTTTTAAAACATTTATTCAGG - Intergenic
982563397 4:156959006-156959028 TAATTGTAAAATAATTGTTCTGG - Intronic
983471257 4:168158500-168158522 CAAGTGGCAAAGATTTGTTCTGG + Intronic
984146019 4:176062284-176062306 AAATTGTAAAATATTTAAACAGG - Intergenic
984210548 4:176841837-176841859 CAATTGTAAAAGATTAAGAATGG - Intergenic
984261924 4:177452899-177452921 GCATTTTAAAAGATTTATTATGG + Intergenic
984277952 4:177633278-177633300 CATTTCTAAAGGTTTTATTCTGG + Intergenic
986023724 5:3829846-3829868 AAATTCAAAAAGATTTCTTCTGG + Intergenic
986890905 5:12304153-12304175 CAATTGTAAGAGTTTTCTGCTGG - Intergenic
986896626 5:12378618-12378640 TAATTTTAAAAGATTTATGCAGG + Intergenic
987164687 5:15183811-15183833 AAATTGTAAATGATTTTTCCAGG - Intergenic
987715382 5:21562284-21562306 CAATAGTAATAGATTTGTGCAGG - Intergenic
987912313 5:24163849-24163871 TAACTGTAAAAAAGTTATTCTGG - Intronic
988066438 5:26232357-26232379 CATTTTTAAAAGATTTTTTAGGG + Intergenic
988225428 5:28406124-28406146 CCATTTTAGAAGACTTATTCTGG - Intergenic
988373495 5:30403349-30403371 TATTTGTAAAAGACTTTTTCTGG - Intergenic
988857641 5:35244843-35244865 CAAGTGTAAGTGGTTTATTCAGG + Intergenic
989014133 5:36909745-36909767 ACATTGTTAAAAATTTATTCAGG - Intronic
989080830 5:37618794-37618816 CATTTTTAAAAGAATCATTCTGG + Intronic
989219685 5:38943188-38943210 CAATTTTACAAGAAGTATTCAGG - Intronic
989311963 5:40029928-40029950 AAATTGCAACAGAGTTATTCTGG + Intergenic
989342374 5:40390292-40390314 CAATTAAAAAATATTTATTGTGG - Intergenic
989662456 5:43814341-43814363 CAGTTGAAAAAAATTTCTTCAGG + Intergenic
989714232 5:44441426-44441448 CAATTTTAAAAGCTTTCTTATGG - Intergenic
990540313 5:56766061-56766083 CATTTGTAAAACATTTATTGTGG + Intergenic
990572275 5:57091116-57091138 CAATTTTGAAAGATTTACTGTGG + Intergenic
991581661 5:68161908-68161930 AAATTGTGAAAGATTTATGTTGG + Intergenic
992999530 5:82366672-82366694 TTATTGTAAAATATTTATTGAGG + Intronic
993326287 5:86542011-86542033 CAAGTTTAAAAGTTTTATGCTGG + Intergenic
993765730 5:91855335-91855357 CAATATTAAAATATTTATTGTGG - Intergenic
994264478 5:97699217-97699239 CTATTTTAAATGATTTATTGGGG + Intergenic
994397326 5:99235533-99235555 CAAATGTAGAAGATTGAATCTGG + Intergenic
994919886 5:106030604-106030626 CAACTGAAAAGGTTTTATTCTGG - Intergenic
995046139 5:107650705-107650727 AAATTCTAAAACTTTTATTCAGG + Intronic
995287101 5:110402297-110402319 AAGATGTAAAAGATTTATTCAGG - Intronic
995382699 5:111552312-111552334 CCATTGTAAATGATTTTTCCTGG - Intergenic
995437111 5:112149076-112149098 CAATAGAAAAAGAATTGTTCTGG + Intronic
995597259 5:113761125-113761147 CAACTTTGAATGATTTATTCTGG - Intergenic
996280012 5:121718839-121718861 CAAATGTAAAATATATAATCTGG - Intergenic
996643288 5:125784683-125784705 CAATTTTAAAAGAGGTATTATGG - Intergenic
996708283 5:126519070-126519092 ATATTTGAAAAGATTTATTCTGG - Intergenic
997009236 5:129857339-129857361 CAATTGTAAGTAATTTATTTGGG - Intergenic
998802431 5:145883468-145883490 TTATTGTAAAAGATATATTTTGG + Intergenic
999007065 5:147993971-147993993 CAATTTTAAAAGCTTCATTGAGG + Intergenic
999519519 5:152336613-152336635 CAATTATAAAACATTTATGATGG - Intergenic
999553544 5:152716748-152716770 CTTTTTGAAAAGATTTATTCTGG - Intergenic
999864013 5:155680581-155680603 CAATTGCAGTAGATTTATCCAGG + Intergenic
1003314034 6:4995330-4995352 GCATTTTAAAAAATTTATTCAGG + Intronic
1004267113 6:14158422-14158444 CAAGTGTAAAAAGTTTATTGAGG + Intergenic
1005195700 6:23281217-23281239 GAATTGTAAAGCATTTCTTCTGG - Intergenic
1005263899 6:24091151-24091173 CAATTTTAAAAGACTTTTTGGGG + Intergenic
1005679411 6:28191068-28191090 AATTTGTTAGAGATTTATTCAGG + Intergenic
1007022993 6:38541436-38541458 CAATTATAAAATTTTCATTCTGG + Intronic
1008000413 6:46354032-46354054 AAATTGTACAAAATATATTCTGG - Intronic
1008762364 6:54867711-54867733 GAACTGTAAAAAATTCATTCTGG - Intronic
1008852919 6:56046662-56046684 CAAGTTGAATAGATTTATTCAGG + Intergenic
1009001340 6:57719762-57719784 CAATAGTAATAGATTTGTGCAGG + Intergenic
1009426966 6:63525187-63525209 CAATTGTAAATAAGTTATCCTGG + Intronic
1009653775 6:66512535-66512557 CTTTTGTAAAGTATTTATTCAGG - Intergenic
1009713244 6:67352447-67352469 CAATTTTAAAATATTTATTAGGG - Intergenic
1009741434 6:67752116-67752138 TAGTTGTAAAAGATTTAGTTTGG - Intergenic
1010529830 6:76954065-76954087 CAATTATAAAAAATTGATTGAGG - Intergenic
1010637526 6:78279745-78279767 CCATTTTAAAAAATTTATTGAGG + Intergenic
1010850912 6:80775786-80775808 ATATTGTAAATGATTTTTTCAGG + Intergenic
1011124934 6:83996976-83996998 AAATTGTAATAGCTTTATTGAGG - Intergenic
1012771800 6:103447126-103447148 CATTTGTAAAATATTAATTTAGG - Intergenic
1012970911 6:105729456-105729478 AAATGGTAAAAAATTTATTAGGG - Intergenic
1013246467 6:108291851-108291873 CAATGTTAAAAAATTTTTTCAGG + Intergenic
1013507771 6:110816286-110816308 GAATTGTAAAGGATTTTTTATGG + Intronic
1014187275 6:118449385-118449407 AAATTGTAAAATTATTATTCAGG - Intergenic
1014931448 6:127341522-127341544 CAATTTTATAAGCTTTCTTCGGG + Intronic
1015079996 6:129212093-129212115 TATTTTTAAAAGATTTTTTCTGG + Intronic
1016821173 6:148347892-148347914 CAGGTGTAAAAGACTTACTCAGG + Intronic
1018166752 6:161104910-161104932 AAATTCTAAAAGATTTATAATGG - Intronic
1020580370 7:9991342-9991364 CATTTTTAAAAAATTTATTATGG + Intergenic
1020814366 7:12887152-12887174 CAATTAAAAAAAATTAATTCTGG - Intergenic
1021195656 7:17671728-17671750 CAATTGAAAAAGATTTACAATGG + Intergenic
1022089783 7:27100228-27100250 CAATTTTAATACATTTATTAAGG - Intergenic
1022191700 7:28022320-28022342 AAATTTGAAAAGATTTTTTCTGG - Intronic
1022339354 7:29453795-29453817 CCATTTTAAAAGATTCACTCGGG + Intronic
1022558030 7:31319556-31319578 CCATGGTAAAAGGTATATTCTGG - Intergenic
1023325131 7:39046145-39046167 CTATTGTAATGGATTTATTGTGG + Intronic
1025290267 7:57713632-57713654 CAAGTATAAAAGATTTATAGTGG - Intergenic
1026091367 7:67303068-67303090 ATGTTTTAAAAGATTTATTCAGG + Intergenic
1026134444 7:67647058-67647080 CATTTATCAAATATTTATTCTGG - Intergenic
1026404519 7:70051288-70051310 AAACTGTTACAGATTTATTCAGG - Intronic
1026745056 7:73005404-73005426 ATGTTTTAAAAGATTTATTCAGG - Intergenic
1027031168 7:74890099-74890121 ATGTTTTAAAAGATTTATTCAGG - Intergenic
1027098684 7:75359676-75359698 ATGTTTTAAAAGATTTATTCAGG + Intergenic
1027739857 7:81987704-81987726 CAATGGAAATAGATTTAATCTGG + Intronic
1028593719 7:92526221-92526243 TAATTTTAAAAAATTTATTCAGG - Intronic
1029399782 7:100336488-100336510 ATGTTTTAAAAGATTTATTCAGG + Intronic
1030345822 7:108431861-108431883 TAGTTTTAAAAGATTTATTCAGG + Intronic
1030367727 7:108664814-108664836 CAATAGTAAAAGATAAATTATGG - Intergenic
1030497680 7:110320110-110320132 AAATTATAAAAGCTTTATTTGGG - Intergenic
1031129709 7:117817714-117817736 AAATTGTTACAGAATTATTCTGG - Intronic
1031299712 7:120049637-120049659 AAATAGTCAAAGATTTATTGGGG + Intergenic
1032242079 7:130170507-130170529 CAAATGAAAAAGATTCAATCTGG + Intronic
1033578623 7:142711243-142711265 AAATTTTAAAAGATGTATTTTGG + Intergenic
1033883760 7:145918834-145918856 AAATTGTAGAAAATTTTTTCAGG + Intergenic
1036453428 8:8889405-8889427 CAATTACAAAAGATTTTCTCTGG + Intronic
1036985302 8:13522209-13522231 CCATTGTAAAAGCTCTTTTCTGG - Intergenic
1038812403 8:30862819-30862841 AAATTGGTTAAGATTTATTCTGG - Intronic
1039018328 8:33178192-33178214 CAATTGTAAAATTTTTCTTTAGG - Intergenic
1039517188 8:38143994-38144016 TAATTGTAAAACTTTTTTTCTGG - Exonic
1040702235 8:50080135-50080157 GAATTATAAAAGTTTTATTGTGG + Intronic
1041096641 8:54356768-54356790 AAATATTAAAAAATTTATTCTGG - Intergenic
1042121553 8:65493839-65493861 CATTTGTAAAAGTTGTATTGTGG + Intergenic
1043310617 8:78854613-78854635 AAATTTTAAAACATGTATTCTGG + Intergenic
1043418641 8:80076830-80076852 CAAAAGTAAAAGAATTAATCGGG - Intronic
1043658526 8:82704921-82704943 CACTTGAAAAAGAATTTTTCTGG - Intergenic
1044181147 8:89196628-89196650 CCATTCTAAAAGATTTATAGTGG - Intergenic
1044751160 8:95416903-95416925 CAATTGTAGCAAAATTATTCAGG + Intergenic
1044908591 8:97031911-97031933 CAATTTCAAAGGACTTATTCTGG + Intronic
1045069164 8:98482706-98482728 CAATTCTAGAAGATTTAATGAGG + Intronic
1045321989 8:101089181-101089203 GAAATGCAAAAGATTTATTGGGG + Intergenic
1046259092 8:111742488-111742510 CAATTATTAAAGATGTATTAGGG - Intergenic
1046601560 8:116322907-116322929 CAATTAAAAAAAATCTATTCAGG - Intergenic
1046855789 8:119030183-119030205 CAATTGTAAAAGACTTTTATAGG + Intronic
1048510868 8:135061014-135061036 AAATTGTTAAAGATTTATTTAGG - Intergenic
1048630067 8:136233084-136233106 AACTTGTAATTGATTTATTCAGG + Intergenic
1048766174 8:137846823-137846845 CGATTCTAACATATTTATTCAGG - Intergenic
1051138355 9:13950231-13950253 AAATAGTAAAAAGTTTATTCAGG + Intergenic
1052239768 9:26257205-26257227 CAAGTGTAAAAAAATCATTCTGG + Intergenic
1052579396 9:30334678-30334700 TAATGGTAAAGGATTTATTTGGG - Intergenic
1054166159 9:61731740-61731762 CAAGTATAAAAGATTTATAGTGG + Intergenic
1055033882 9:71797260-71797282 CATTTCTAAAAGATTTATAAAGG + Intronic
1055613581 9:78048256-78048278 ATATTTTAAAAAATTTATTCGGG - Intergenic
1056067201 9:82948800-82948822 CAATGCTAAAAGAGTTATCCTGG - Intergenic
1056919842 9:90777447-90777469 GAACTATAAAAGATATATTCTGG - Intergenic
1056936871 9:90921701-90921723 CATTTTAAAAAGATTTATTTTGG - Intergenic
1056982938 9:91333408-91333430 CAAGTTTAAAAGTTTTCTTCTGG + Intronic
1057964581 9:99490602-99490624 TAATTGTAATAAATTTATTTTGG + Intergenic
1058127959 9:101217786-101217808 CAATTGTTTAAGAATTATTGAGG - Intronic
1058137968 9:101328228-101328250 CAATTATAAAAGTATTATTTTGG + Intergenic
1058236809 9:102500170-102500192 CAAGAGTGAAAGATGTATTCTGG - Intergenic
1058938882 9:109794788-109794810 CAATTTGAAAATATTTATTAAGG - Intronic
1059523217 9:114963445-114963467 AAATTATAAAAGTATTATTCAGG + Intergenic
1059649557 9:116303099-116303121 CATTTGTAAAAGATTAGATCTGG + Intronic
1060049900 9:120371080-120371102 CAATTCTCAAAGATTTTTTTTGG + Intergenic
1060135487 9:121149273-121149295 TAAGTGAAAAAGATTTACTCAGG - Intronic
1060458715 9:123827063-123827085 CAATGGAAAAATATTTTTTCAGG - Intronic
1062246137 9:135567341-135567363 GGATTGTAAAAAATATATTCTGG - Intergenic
1062486589 9:136779680-136779702 AAATTGTAAAAGTATTATTTGGG + Intergenic
1185913269 X:4005929-4005951 CATTTGGAAAATATTTATTGGGG + Intergenic
1186307016 X:8272668-8272690 TTATTGTTATAGATTTATTCGGG - Intergenic
1187631547 X:21178376-21178398 CATTTCTAAATTATTTATTCTGG + Intergenic
1188040292 X:25363971-25363993 CAATTTTTAAATATTTATTGAGG + Intergenic
1188405616 X:29805513-29805535 CAATGGTAAGAGACTCATTCAGG - Intronic
1188486915 X:30692222-30692244 GAATAGAAAATGATTTATTCAGG - Intronic
1189277903 X:39800085-39800107 ACATTGAAAAAGATTTATTCAGG - Intergenic
1190221452 X:48514908-48514930 CAATTGTAAAAAAATTAGCCAGG + Intronic
1191906058 X:66091643-66091665 CAATTTTTAAAAATTTATTGAGG + Intergenic
1192307701 X:69980511-69980533 TAAATGTAAAAGTATTATTCTGG - Intronic
1192584896 X:72311851-72311873 TAGTTGTAAAAAATTTATTATGG - Intergenic
1193154902 X:78161644-78161666 CAATTTTTAAAAATTTATTGAGG - Intergenic
1193214491 X:78847299-78847321 CATTTTTAACAGATTTATTAAGG - Intergenic
1193858247 X:86632707-86632729 CAATTTTAAACAATTTATTGAGG - Intronic
1193932956 X:87579822-87579844 AAATGCTAAAAGAGTTATTCAGG + Intronic
1194484354 X:94469705-94469727 CACTTAAAAAAGGTTTATTCAGG - Intergenic
1194710251 X:97227554-97227576 TGATTGCAAAAGATTTAATCAGG + Intronic
1195011813 X:100739675-100739697 CTATTTTCAAAGATTTATTCTGG + Intergenic
1195171604 X:102273983-102274005 CAGATGTAAAAAATTGATTCAGG - Intergenic
1195187256 X:102413116-102413138 CAGATGTAAAAAATTGATTCAGG + Intronic
1195620643 X:106951123-106951145 CAAATGAATAAGATTGATTCAGG - Intronic
1195873670 X:109514955-109514977 CAATTTCAAAAGTTTGATTCTGG - Intergenic
1197256637 X:124270321-124270343 CCTTTGAAAAAGATGTATTCTGG - Intronic
1198832873 X:140769671-140769693 AAACTGTAAAAGATTTGTTGAGG - Intergenic
1199504965 X:148551580-148551602 CAACTTTAAAAGTTTTGTTCTGG + Intronic