ID: 945009046

View in Genome Browser
Species Human (GRCh38)
Location 2:205442233-205442255
Sequence CTAGAATTCCCCATATGTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 103}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945009046_945009051 6 Left 945009046 2:205442233-205442255 CCAATACATATGGGGAATTCTAG 0: 1
1: 0
2: 0
3: 5
4: 103
Right 945009051 2:205442262-205442284 TAGGGTAAGCCACAAGGAACAGG 0: 1
1: 0
2: 0
3: 6
4: 118
945009046_945009050 0 Left 945009046 2:205442233-205442255 CCAATACATATGGGGAATTCTAG 0: 1
1: 0
2: 0
3: 5
4: 103
Right 945009050 2:205442256-205442278 GAATTCTAGGGTAAGCCACAAGG 0: 1
1: 0
2: 0
3: 9
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945009046 Original CRISPR CTAGAATTCCCCATATGTAT TGG (reversed) Intronic
902367024 1:15982564-15982586 TTAGAATCCCACATATGGATGGG + Intergenic
905668603 1:39777145-39777167 CAAGAATTCCAAAGATGTATTGG + Intronic
908649034 1:66311960-66311982 GTATAAATCCCCAAATGTATAGG + Intronic
909136801 1:71811380-71811402 CTGGAATTCTTCATTTGTATAGG + Intronic
909871657 1:80747598-80747620 CCAAATTTCCCCATATCTATTGG - Intergenic
917168938 1:172147343-172147365 CTTGAATACCCAAAATGTATTGG + Intronic
917821314 1:178767181-178767203 ATAGAATTCAGAATATGTATAGG - Intronic
917895831 1:179485704-179485726 ATAGAATTCAGAATATGTATAGG + Intronic
921201855 1:212814600-212814622 CAAGAATTGCCAACATGTATTGG - Intronic
922162166 1:223086116-223086138 GGAGACTTCCCCATATGCATAGG - Intergenic
924561962 1:245164586-245164608 CTTCAGTTCCCCATATGTAGGGG - Intronic
1065921524 10:30397579-30397601 CTGGAATACTCCATGTGTATTGG + Intergenic
1069203601 10:65654059-65654081 GTAGAATTCACAATATGGATAGG + Intergenic
1070098756 10:73365254-73365276 TTAGGATTCCACATATGAATAGG - Intergenic
1071415930 10:85441414-85441436 TAATAATTGCCCATATGTATGGG + Intergenic
1071934171 10:90508561-90508583 CTAGAATTCAGAGTATGTATGGG - Intergenic
1073664570 10:105516292-105516314 CTAAGATCCCCCAAATGTATTGG + Intergenic
1077803579 11:5567353-5567375 CTAGAATATCCCAAATGTTTTGG + Intronic
1078048439 11:7940042-7940064 CTTGGGTTCCCCATCTGTATGGG + Intergenic
1080207845 11:29751605-29751627 CTACAATTCCCTATATGTCTTGG - Intergenic
1085924803 11:81004666-81004688 CTAATATTCTCCATATGTAGAGG - Intergenic
1089082175 11:115785862-115785884 CTTGAATACCCATTATGTATTGG + Intergenic
1092767630 12:11867865-11867887 GTAGAAATCCCCATTTTTATGGG + Intronic
1094563516 12:31578489-31578511 ATAGATTTCCCATTATGTATGGG + Intronic
1094791754 12:33923126-33923148 ATAGAATTCACAATATGGATAGG - Intergenic
1100648317 12:96556015-96556037 CTAGAATACCTCATATTCATTGG + Intronic
1107326845 13:39253352-39253374 CTACAATCCCCTTTATGTATAGG + Intergenic
1110903668 13:80857881-80857903 ATAGAATTTCCCATATCTGTTGG + Intergenic
1111033507 13:82638526-82638548 CTAAAATTCCTCACATGTATTGG - Intergenic
1111811458 13:93097036-93097058 CTATTATTCCCCATATGGTTGGG - Intergenic
1112901939 13:104367480-104367502 TTAGGATTCCCCTTATGTAATGG - Intergenic
1113344533 13:109463373-109463395 CTTGAATTCCCATTATGTGTAGG + Intergenic
1116806671 14:49500688-49500710 ATTGAATTCCCCATGTGTAATGG - Intergenic
1117068030 14:52030168-52030190 CTAAAATTCCCAATTTTTATAGG + Intronic
1118704020 14:68463101-68463123 TTAGAACTCCCCAGATTTATGGG + Intronic
1119760169 14:77144925-77144947 CTATAATGCCCCAAATGTTTTGG + Intronic
1123186790 14:106525847-106525869 CTATAATTCCCCAATTTTATTGG + Intergenic
1127474603 15:59321658-59321680 CTAGTAGTCCCCATGTCTATTGG - Intronic
1130235093 15:82126018-82126040 GGATAATTCCCCATATGTAAGGG - Intergenic
1130681441 15:86000506-86000528 CTAGGAATCCCCAAATTTATAGG - Intergenic
1131080357 15:89529336-89529358 CTAGAATTCCCCAAACTTTTTGG - Intergenic
1131160207 15:90100817-90100839 CTAGAAGTCCCCATGTGGGTTGG - Intronic
1131409374 15:92193679-92193701 CTAGCATTGCCCATATGGAATGG + Intergenic
1135199419 16:20424084-20424106 CAACAATACCCCATATGTGTTGG + Intronic
1140910028 16:79442847-79442869 CTAGATTTCCCCAGATCTGTTGG - Intergenic
1144084330 17:11795137-11795159 ATATCATTCCCCAAATGTATTGG + Intronic
1144461546 17:15462548-15462570 ACAGAATTGCCCATATATATGGG + Intronic
1153424480 18:4946706-4946728 ATAGAATTCAGCATATGGATAGG + Intergenic
1154433459 18:14326213-14326235 CTACAATTCCACATGAGTATTGG - Intergenic
1166942956 19:46378288-46378310 CTAGAAGTCCCCAAATATTTGGG - Intronic
931036386 2:58248773-58248795 CTTGAATTCTCCATATTTTTTGG + Intergenic
943960849 2:194261869-194261891 GTAGAATGCCCAATATGTAAGGG - Intergenic
944102584 2:196044632-196044654 CTATAATTTCCCAGATGTACAGG + Intronic
945009046 2:205442233-205442255 CTAGAATTCCCCATATGTATTGG - Intronic
946814530 2:223563190-223563212 CTAGAATTCCCCAATTTTATTGG - Intergenic
947263427 2:228251041-228251063 ATAGAATTCACAATATGGATAGG - Intergenic
1171883397 20:30633958-30633980 CTACAATTCCACATGAGTATTGG + Intergenic
1173017791 20:39242093-39242115 ATAGAATTCCGCATATATAGGGG + Intergenic
1177762460 21:25417820-25417842 CCAGAAATACCAATATGTATGGG + Intergenic
949214061 3:1543933-1543955 CAAGAAATCCCATTATGTATTGG - Intergenic
952081575 3:29764763-29764785 CTACAAATCCCCAAATGTCTGGG + Intronic
953273475 3:41469982-41470004 CTTGAATTCCTCTTATGCATAGG - Intronic
954051034 3:47977831-47977853 CCAGGATTCCCCAAATGTGTAGG - Intronic
954329851 3:49884087-49884109 CTAAGATTCCCCTTATGTCTCGG - Intergenic
954801621 3:53190276-53190298 TCAGGATTCCCCATATGTATTGG - Intronic
965866130 3:173206048-173206070 CTAGCATTCCAAATTTGTATTGG - Intergenic
973367054 4:49216275-49216297 CTACAATTCCACATGAGTATTGG + Intergenic
974422475 4:61695605-61695627 CTTAAATTCCCCAACTGTATTGG + Intronic
977519030 4:98057226-98057248 CTAGAATTCAGAATATGGATAGG + Intronic
978485135 4:109244860-109244882 CTAGAGATCCACATATTTATTGG - Intronic
980231802 4:130054834-130054856 CTAAATTATCCCATATGTATTGG + Intergenic
980238468 4:130139635-130139657 ATAGAATTCTACATATGTAATGG + Intergenic
986575583 5:9209157-9209179 CTACAATTCTCCATATCTTTAGG + Intronic
987805469 5:22759906-22759928 GTAGAATTCCCCTTATCTAGAGG + Intronic
987914962 5:24200700-24200722 ATAGAATTCAGAATATGTATAGG + Intergenic
988095057 5:26596178-26596200 CTTGAATTACCCCTATTTATGGG + Intergenic
992642850 5:78783561-78783583 CTAGAAGTATCCATTTGTATTGG - Intronic
994227741 5:97273487-97273509 ATAGAATTCAGAATATGTATAGG - Intergenic
1001932066 5:175680270-175680292 GTAAAATTCCCAATATGTACTGG - Intronic
1009929436 6:70159521-70159543 CTAGAATTCCTCATAAGTCTTGG - Intronic
1010684164 6:78832254-78832276 CTAGAATGCCCCATCTGAAAAGG - Intergenic
1014283842 6:119472968-119472990 CTAGAACACCCCAAATGTTTTGG + Intergenic
1014362011 6:120489901-120489923 CTATAATCCCCCAAATGTAGTGG + Intergenic
1016550936 6:145279177-145279199 ATAGAATTGCCCATCTCTATGGG + Intergenic
1017074206 6:150602120-150602142 CAAGCATTTCCCATATTTATGGG - Intronic
1017867582 6:158457304-158457326 CTAGAATTCCACATAGCTCTTGG + Intronic
1018087982 6:160321412-160321434 CAACAATTGCCCATATGAATGGG + Intergenic
1029052447 7:97702941-97702963 ATAGAATTCACAATATGGATAGG + Intergenic
1031642111 7:124178101-124178123 TTAGAATTCAACATATGAATTGG - Intergenic
1032760071 7:134932349-134932371 CTAGAATTCCTGATCTGGATTGG - Intronic
1033230863 7:139596457-139596479 CTCAAGTTCCCCAAATGTATAGG + Intronic
1033591793 7:142814737-142814759 TTTGAATACACCATATGTATAGG + Intergenic
1036574200 8:10010456-10010478 CTAGGATGCCCCATCTGTCTTGG + Intergenic
1040698423 8:50031693-50031715 GTATAATTCCCTTTATGTATTGG + Intronic
1043143049 8:76615214-76615236 TTTGACTTCCCTATATGTATGGG + Intergenic
1060021602 9:120135914-120135936 TTAGCATTCCCCAAATGTGTGGG + Intergenic
1187607683 X:20904756-20904778 ATAGAATTCAGCATATGGATAGG - Intergenic
1189287650 X:39863230-39863252 CTATAATTGCCCCCATGTATGGG + Intergenic
1189700462 X:43713496-43713518 CTAGTATTCCACATCTATATGGG - Intronic
1191935706 X:66424971-66424993 CTAAAATGCTTCATATGTATTGG + Intergenic
1192082806 X:68064368-68064390 CTTGAATTCCCTATTTGGATTGG - Intronic
1194235127 X:91373275-91373297 CTAGAATACACAATATGGATAGG + Intergenic
1194283081 X:91976715-91976737 ATAGAATGTCTCATATGTATCGG - Intronic
1196601223 X:117603721-117603743 ATAGAATTCAAAATATGTATAGG + Intergenic
1196626940 X:117887414-117887436 CTGAGATTCCCCATATGAATGGG + Intergenic
1198579754 X:138050018-138050040 ATAGAATTCAGCATCTGTATAGG + Intergenic
1199967396 X:152831433-152831455 CTAGACTGACCCAGATGTATAGG + Intronic
1200600661 Y:5201249-5201271 ATAGAATGTCTCATATGTATCGG - Intronic
1200865391 Y:8038015-8038037 CCACAATGCCCCATATGTGTAGG - Intergenic