ID: 945014055

View in Genome Browser
Species Human (GRCh38)
Location 2:205496289-205496311
Sequence AAGAGCTACAAATCAGAAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 382
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 358}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945014055 Original CRISPR AAGAGCTACAAATCAGAAAT TGG Intronic
900782044 1:4624696-4624718 GAGAACTACAAGTGAGAAATTGG + Intergenic
900898717 1:5502573-5502595 AAGGGCTACAAATCAGTGTTTGG + Intergenic
901273954 1:7975979-7976001 AAGAGCTATAAATCAGGACTTGG + Intronic
903736925 1:25535749-25535771 AAACAGTACAAATCAGAAATTGG + Intergenic
904321490 1:29700550-29700572 AGAAGGCACAAATCAGAAATGGG - Intergenic
905397071 1:37673747-37673769 AAGAGCTTGAAATCAGAGCTGGG - Intergenic
905570671 1:39002025-39002047 AAGAGATCTGAATCAGAAATAGG + Intronic
906329632 1:44874432-44874454 AAGAGATTCAACTCAGAAAAAGG - Intronic
906986127 1:50685477-50685499 AAGCACTACAAATCATAAAATGG + Intronic
907080754 1:51619367-51619389 AAGGGCAACAAAGCAGAAAAAGG - Intronic
907711064 1:56881911-56881933 CAGAGCCACAACTTAGAAATAGG - Intronic
908233506 1:62128737-62128759 AATAGCCACAAATGGGAAATAGG + Intronic
908415890 1:63912916-63912938 AAGCGCTTCAGATAAGAAATGGG + Intronic
908494234 1:64678712-64678734 TATAGCTACAAATCAGTATTTGG + Intronic
909702842 1:78546811-78546833 ATGTGCCACAAATCAGAAAAAGG - Intergenic
910193541 1:84618957-84618979 ACAAGCTTCAAATCAGAACTTGG + Intergenic
910230413 1:84981019-84981041 AAGACATACAAATCACAAACAGG + Intronic
910391032 1:86744739-86744761 AAGAGCTCCTAATAAGAACTTGG + Intronic
910569850 1:88687367-88687389 ATGAGATAAAAATTAGAAATTGG - Intronic
911447140 1:98011248-98011270 AAGAGCTTAAAATCAGCCATTGG - Intergenic
911538891 1:99134471-99134493 AAGAGCTACAGATCAGTGCTAGG - Intergenic
911564721 1:99450319-99450341 AAGACCTACAAATGACAAACAGG + Intergenic
911877146 1:103181328-103181350 AAGAGCTACAAATAAAACAATGG - Intergenic
913477596 1:119253227-119253249 TAGAGCAAGAAATCAGAGATGGG - Intergenic
916364767 1:164013152-164013174 AAGACATACAAATGACAAATAGG + Intergenic
916397571 1:164408396-164408418 AAGATCTACAAATAACCAATGGG - Intergenic
917214265 1:172661713-172661735 AAGAGATGCAAATTAAAAATAGG + Intronic
917869995 1:179232837-179232859 AAGGGATACATCTCAGAAATAGG - Intergenic
919575963 1:199310257-199310279 AAGAGCTACAGGTCAAAAAGGGG + Intergenic
923100886 1:230815930-230815952 AGCAGCTATAAAACAGAAATGGG + Intergenic
924390202 1:243546394-243546416 AAGAACTAAAAGTGAGAAATAGG + Intronic
1062782851 10:232166-232188 AAAAGCTACAACTAAGAAAGAGG - Intronic
1063607726 10:7537483-7537505 TGGAGCTACAAATAGGAAATAGG - Intergenic
1063820547 10:9830181-9830203 AAGAGCTACAAAAAAATAATTGG + Intergenic
1064402251 10:15031200-15031222 AATAGCTACAAAGGTGAAATTGG - Intergenic
1065386530 10:25139117-25139139 AAGATCTCCATCTCAGAAATAGG - Intergenic
1068000252 10:51325154-51325176 AAGAGCTACAAATGGCAAACAGG - Intronic
1068478500 10:57559533-57559555 AAGACATACAAATGACAAATAGG - Intergenic
1068784729 10:60959122-60959144 AAGAGATACAAATAAGCAACTGG + Intronic
1068899698 10:62253998-62254020 AAGAGCTACTAATTGGAAACTGG + Intronic
1069903812 10:71720639-71720661 AACAGCTAAAAACCAGAAACTGG - Intronic
1070365329 10:75731340-75731362 AAGTGCTAAAAAACAGAGATGGG - Intronic
1071048839 10:81420537-81420559 AAGAGCTACATTTCAGAGAAAGG + Intergenic
1071752785 10:88499839-88499861 AAGAAGTACATATAAGAAATAGG + Intronic
1072187757 10:93058769-93058791 AAAAGCTAAAAGTCAGAAAATGG - Exonic
1072472815 10:95729921-95729943 ACTTGCTACAAATCAGGAATCGG - Intronic
1072784987 10:98273342-98273364 AGGAGTTACATATGAGAAATGGG - Intergenic
1074327361 10:112464616-112464638 AGAAGCTACAAACAAGAAATGGG + Exonic
1075372834 10:121952388-121952410 GAGAGCTGCAAATGAGAGATGGG - Intergenic
1075964219 10:126596915-126596937 AAGACATACAAATGACAAATAGG + Intronic
1076281944 10:129253877-129253899 AAGAACAACAAAGCAGAAAGAGG + Intergenic
1077933390 11:6756990-6757012 AAGAATTACATAGCAGAAATAGG + Intergenic
1078124093 11:8542335-8542357 AACATGTACAAATCTGAAATAGG + Intronic
1078993790 11:16675507-16675529 AAGAGTTACAAACCAAAAATAGG + Intronic
1079478878 11:20860062-20860084 AAGAACTCAAAATCAGAAAAAGG - Intronic
1079931394 11:26566732-26566754 AAGTGCCACAATTCATAAATAGG + Intronic
1080018467 11:27532877-27532899 AAGAGCTAGAAAGGAGCAATGGG - Intergenic
1080796659 11:35570294-35570316 AAGACCTACAAATGGTAAATAGG + Intergenic
1082317541 11:50748291-50748313 AAAAGCTACAATTGACAAATGGG + Intergenic
1083795999 11:65017080-65017102 AAGAGCAAGAAGGCAGAAATGGG + Intronic
1089501239 11:118932614-118932636 AAAAACTAAAAACCAGAAATGGG - Intronic
1092593193 12:9970305-9970327 AAGAGCTACTAAAAATAAATAGG - Intronic
1092821630 12:12358319-12358341 AGGAGCTGTAATTCAGAAATAGG + Intronic
1093320588 12:17708424-17708446 GAGAGTTACAAATAAGAAAAGGG + Intergenic
1093937250 12:25014328-25014350 AAGAGCAGAAACTCAGAAATGGG + Intergenic
1095334149 12:41006643-41006665 AGGAGCTACAATTCAGTAAAAGG + Intronic
1095338081 12:41052805-41052827 AAGAACTACAAAACATGAATCGG + Intronic
1096573152 12:52535776-52535798 AAGCACTACAAATCAGAGCTTGG + Intergenic
1097117832 12:56711189-56711211 AAGGGCTACAATTTAGAAATGGG - Intergenic
1097232363 12:57520578-57520600 AAAACCTACCAATCAGAAAGTGG + Intergenic
1098003630 12:65971466-65971488 AAGTGAAACAACTCAGAAATAGG - Intergenic
1100142585 12:91636093-91636115 AAGAGATAAAAATAAGAATTAGG - Intergenic
1101627404 12:106458792-106458814 AAGAGATACAAAGCAAAAATGGG + Intronic
1106153325 13:27127289-27127311 AAAGGCTTAAAATCAGAAATCGG + Intronic
1106489658 13:30208198-30208220 AAAAACTGCAAATGAGAAATAGG + Exonic
1106964293 13:35040768-35040790 AAGAGCTACAAATAAGTGAAAGG - Intronic
1108960670 13:56224348-56224370 AAGAGATACGAATCAAAATTTGG + Intergenic
1109481477 13:62961154-62961176 GAGAGCTACAAGTAAAAAATGGG + Intergenic
1110248554 13:73355682-73355704 AAGTGATAAAAATCAGAAAGTGG - Intergenic
1110942905 13:81373302-81373324 AAGAGCTACAGTTCATAAAGTGG - Intergenic
1111541695 13:89675883-89675905 GAGACCTACAAATGAGAATTGGG + Intergenic
1112336409 13:98520765-98520787 AAGGCCTGCAAACCAGAAATGGG - Intronic
1112522987 13:100114646-100114668 AAGACATACAAATCACAAACAGG + Intronic
1114062381 14:19030119-19030141 AAGACCTACAAATGGCAAATAGG - Intergenic
1114878184 14:26750164-26750186 AAGAGCTACAAAACAGATGCAGG - Intergenic
1115417497 14:33153445-33153467 AAGCTCTCCAAATGAGAAATTGG - Intronic
1115766551 14:36628885-36628907 AAGAGCTACAAAGCTGAAAAGGG + Intergenic
1116076859 14:40121766-40121788 AAAAGCTACAAACTATAAATAGG + Intergenic
1116082917 14:40199185-40199207 AAGAACTACAAACAAGAAAGTGG - Intergenic
1116279003 14:42877331-42877353 AAGACCTACAAATGATGAATAGG + Intergenic
1116374265 14:44177776-44177798 AAAATTTAAAAATCAGAAATAGG - Intergenic
1116429379 14:44828367-44828389 AAGAGATACAGACTAGAAATTGG + Intergenic
1117166317 14:53037747-53037769 AATTGCAACAAAACAGAAATTGG - Intronic
1117224923 14:53646741-53646763 AAGAGCTACACCCCAGAAATAGG - Intergenic
1117576257 14:57101495-57101517 AAAAGCTAAAATTGAGAAATGGG - Intergenic
1118259292 14:64232774-64232796 AAGGGCTGCGAATCAGAAAGGGG - Intronic
1118661382 14:68017133-68017155 TAGAGCTATAAATTAGAATTTGG - Intronic
1120119699 14:80664162-80664184 AATACCTAAAAATCAGAAATAGG + Intronic
1120525902 14:85576702-85576724 GAGAGCTGCAAATCTGAAATGGG - Intronic
1120558085 14:85955317-85955339 CAGAGAAACTAATCAGAAATAGG + Intergenic
1120822329 14:88923690-88923712 AAGACATACAAATCGCAAATAGG - Intergenic
1126057646 15:44746440-44746462 AAGAGTTACAAACCAAAAATAGG - Intronic
1126414365 15:48402772-48402794 AAAATATACAAATCAGAAACAGG - Intergenic
1129583041 15:76832155-76832177 AAGACCTACAACTCAGAATCTGG + Intronic
1130237549 15:82150665-82150687 AAGAGAGAAAAATCAGGAATAGG + Intronic
1130449418 15:84035790-84035812 AAGGACTACAACTAAGAAATGGG + Intronic
1131309808 15:91279651-91279673 CAGAGCCATAAATCATAAATGGG - Intronic
1132264608 15:100458231-100458253 TAGAGCTACTAAGCAGACATAGG - Intronic
1132689832 16:1177524-1177546 ACGAGCTCCAAGTGAGAAATGGG + Intronic
1133832340 16:9334710-9334732 AAAAACTATAAATAAGAAATTGG - Intergenic
1134873236 16:17671428-17671450 AAGAGAAACAAATAACAAATAGG - Intergenic
1135868256 16:26125122-26125144 AAGAGCTACCAACCAGAAAGAGG - Intronic
1136461808 16:30415969-30415991 TAGAGATAAAAATCAGAAAAAGG - Intronic
1136651678 16:31678211-31678233 AATAGCTACTATTCAGAAACTGG + Intergenic
1141328890 16:83089734-83089756 AAGGGCTACACGTCGGAAATGGG + Intronic
1144118018 17:12119975-12119997 AAGAGCAACAAAACAGACACTGG + Intronic
1145748943 17:27341559-27341581 AGGAACTCCGAATCAGAAATGGG - Intergenic
1146239935 17:31210617-31210639 AAGAGAAGCAAATCAGAAACAGG - Intronic
1146757694 17:35448182-35448204 AAGAGTTAAAAAGCAGAATTAGG - Intronic
1150531441 17:65987421-65987443 AAGAGCTACAAAAGTGAAAATGG + Intronic
1151918346 17:77135417-77135439 AAGTGCTAGAAATGAGAAATAGG - Intronic
1152023071 17:77791467-77791489 AATAGCTACAACACAGACATTGG + Intergenic
1152507086 17:80756936-80756958 AAGAAGAACAAAGCAGAAATAGG + Intronic
1153107515 18:1544470-1544492 GAGAGCTACAAGTGAGAAATTGG + Intergenic
1154263471 18:12858593-12858615 AAGAGCTACAAATGAGTATGTGG + Intronic
1155257606 18:24012620-24012642 AAGAGCAAAATATCAGACATAGG - Intronic
1156554305 18:38049703-38049725 TAGAGCTACAAGTCAGTAACTGG - Intergenic
1157581906 18:48778593-48778615 CAGGGGTAGAAATCAGAAATGGG - Intronic
1158037704 18:53053518-53053540 AAAATCTACTAATAAGAAATGGG + Intronic
1158732952 18:60045742-60045764 AAGAGATACTGATCAGAATTCGG - Intergenic
1159559556 18:69978968-69978990 AAGAGATACAAATATGGAATGGG + Intergenic
1159632779 18:70768145-70768167 AAAAGCTACAATTGACAAATGGG + Intergenic
1159730942 18:72026837-72026859 AAGATGTACAAATGACAAATGGG - Intergenic
1161841665 19:6685217-6685239 AAGAGGTTCAAATCAGAGCTGGG + Intronic
1164780447 19:30887259-30887281 GAGAGCGGCAAATCAGAAACAGG + Intergenic
1168669132 19:58228239-58228261 AATAGGTACAAAACAGAACTTGG + Intergenic
925425177 2:3743568-3743590 CAAAGCTAGAAATCAGTAATAGG + Intronic
928025834 2:27737940-27737962 AAGAGATACAAAAAAAAAATGGG - Intergenic
929404993 2:41631340-41631362 AAAAAATCCAAATCAGAAATGGG - Intergenic
929800625 2:45097856-45097878 AAGAGCTACAGATAAAAAAGAGG + Intergenic
929964423 2:46523246-46523268 AAGAGCCAAAATTCACAAATGGG - Intronic
930738585 2:54805227-54805249 AAGAGCCAGAAATCGGAAATAGG - Intronic
931399105 2:61914242-61914264 AATATCTACAAATTGGAAATGGG + Intronic
931686044 2:64794822-64794844 AAGAAATGCAAATCAAAAATAGG - Intergenic
932386505 2:71338430-71338452 AAGAAATACAAATAGGAAATAGG - Intronic
932897578 2:75656921-75656943 AAGAGCTAAAAAACAGAGACTGG - Exonic
932920643 2:75910316-75910338 AAGACATACAAATGACAAATAGG - Intergenic
933256869 2:80091241-80091263 AAGAGCTACAATTTATCAATAGG + Intronic
933817906 2:86083191-86083213 AAGTGCAATAAATCAGAAACAGG + Intronic
934730634 2:96654464-96654486 ATGAGATACAAAGCAGAGATCGG + Intergenic
935506528 2:103911482-103911504 AAAAGCTACAATTAACAAATGGG - Intergenic
936959101 2:118054960-118054982 AAGTGCAACAAACAAGAAATAGG + Intergenic
937627574 2:124060605-124060627 AAGAGCAAGAAATCTGACATTGG + Intronic
939082285 2:137676646-137676668 GAGAGCTACAAAAGAGAAAGCGG - Exonic
939212564 2:139195571-139195593 AAGAGCAAGAAGTTAGAAATAGG - Intergenic
940189406 2:151024084-151024106 AATAGCTAGAAAGGAGAAATAGG + Intronic
940382734 2:153034190-153034212 AAGGCATACAAATCAGAAAGAGG + Intergenic
940502262 2:154507508-154507530 TAGAAATAGAAATCAGAAATGGG - Intergenic
941191870 2:162394211-162394233 GAGAGCTATCAATCAGAAACTGG + Intronic
942376382 2:175342394-175342416 AAGAGCTAGATATCATAAAAAGG - Intergenic
942531565 2:176915596-176915618 AAAAGCTACCAATGAGAGATTGG - Intergenic
942975262 2:182009406-182009428 AAGAGATACAAATGGCAAATAGG - Intronic
943212989 2:184991722-184991744 AAGACATACAAATCGCAAATGGG + Intergenic
943692712 2:190884698-190884720 AAGAGATACATAACAGAAATTGG + Intronic
944026718 2:195179355-195179377 AAGAGGTAGACATCATAAATTGG + Intergenic
945014055 2:205496289-205496311 AAGAGCTACAAATCAGAAATTGG + Intronic
945418912 2:209610080-209610102 AAGAGCTATAAAGAAGACATTGG + Intronic
945527788 2:210910213-210910235 AAGACCTACAAATGATAAACAGG + Intergenic
945815393 2:214599516-214599538 TAGAGCGACAAATGAGAAGTTGG - Intergenic
945850163 2:214996123-214996145 CAGAGCTACCAAACAGAAACTGG + Intronic
947523986 2:230867450-230867472 CAGAGCTACAGCTGAGAAATGGG - Intronic
948114327 2:235482956-235482978 AAGACCTAGAAGTCAGAATTGGG - Intergenic
1170777426 20:19390066-19390088 AAGAGCTAGAAACCATAAAAAGG - Intronic
1173291076 20:41715759-41715781 GAGAACTACAGATAAGAAATGGG + Intergenic
1174164277 20:48573769-48573791 GTGAGCTAAAAATCAGAAACTGG - Intergenic
1174932477 20:54830892-54830914 CAGAGCTAGAAGTCAGAAAAAGG - Intergenic
1176900545 21:14436615-14436637 AAGAGCTAAAGAGCAGACATAGG + Intergenic
1176956741 21:15114037-15114059 AAGAGCTAAAATGCAGAATTTGG - Intergenic
1177127355 21:17212052-17212074 AAGAGAAACAAATCAGATAATGG + Intergenic
1177417593 21:20814545-20814567 CAGAGCTAGAAAACAGCAATGGG + Intergenic
1177740184 21:25145078-25145100 AAGACATACAAATGAGAAACAGG - Intergenic
1177850260 21:26338103-26338125 AAGATCAACAAAACAGAAAATGG + Intergenic
1178616671 21:34140294-34140316 AAATGCTACAAATCAAAATTTGG - Intronic
1180480873 22:15752746-15752768 AAGACCTACAAATGGCAAATAGG - Intergenic
1182187293 22:28418946-28418968 AAGAGCTTAAAATCAGAATCTGG + Intronic
1183081700 22:35460881-35460903 AAGAGCTGAAAAGGAGAAATTGG + Intergenic
949590303 3:5487383-5487405 AAGAGGCACAAATTAAAAATCGG - Intergenic
952743275 3:36755214-36755236 AAAACCTACAAATTACAAATGGG - Intergenic
953274873 3:41484974-41484996 TAAAGCTAAAAATCAGACATTGG + Intronic
955215642 3:56983088-56983110 TTGAGGTACAAGTCAGAAATGGG + Intronic
956673457 3:71713290-71713312 AAGAGCAGGAAATCACAAATGGG - Intronic
956680726 3:71777190-71777212 AAGACTTACAAGACAGAAATAGG - Intronic
957003809 3:74919502-74919524 AAGAGCAACAATTGACAAATGGG - Intergenic
957449166 3:80354389-80354411 AAAACATACAAATCAGAATTTGG - Intergenic
957889582 3:86339102-86339124 ATAAACTAGAAATCAGAAATAGG + Intergenic
957948139 3:87090112-87090134 AAATGCTACAAATCAGGATTTGG - Intergenic
958649528 3:96920575-96920597 AAGAGCTACATATCAATAAAAGG - Intronic
959568530 3:107857595-107857617 AAGAGCTCCAATAGAGAAATAGG + Intergenic
959684079 3:109125817-109125839 GACAGCTTCAATTCAGAAATTGG - Intergenic
959813449 3:110646817-110646839 AAGACTGACAAATCAGAAAGAGG + Intergenic
960366410 3:116777811-116777833 AACAGCAACAGATCAGAATTTGG + Intronic
960391308 3:117080652-117080674 AAGAGCTATAGATCTGAGATGGG - Intronic
960637614 3:119799203-119799225 AATGGCTACAAATCAAAAAGAGG - Intronic
962974696 3:140435845-140435867 AAGACCTACAAATGGGAAACAGG - Intronic
963153707 3:142074105-142074127 AAAATCAAGAAATCAGAAATAGG + Intronic
963820390 3:149885506-149885528 AAGACATACAAATGGGAAATAGG - Intronic
963949215 3:151180218-151180240 AATTTCTAAAAATCAGAAATTGG + Intronic
964828896 3:160861043-160861065 AAGAGCTTCAAAGTAGAAAGAGG + Intronic
965147173 3:164921768-164921790 AAAAGCCAAAATTCAGAAATGGG + Intergenic
965587618 3:170332906-170332928 AAGAGCCACAATTGACAAATGGG - Intergenic
965609999 3:170533546-170533568 AAGAAGTACAAATCAGAATGTGG - Intronic
966344267 3:178961169-178961191 TGGAGCCAGAAATCAGAAATAGG + Intergenic
967290042 3:187910731-187910753 AAGAGGGACTAATCAGAATTTGG + Intergenic
968784708 4:2611618-2611640 AAGAGATACAAATGGAAAATAGG - Intronic
970133607 4:12897664-12897686 AAGATATGCCAATCAGAAATGGG - Intergenic
970179588 4:13376618-13376640 AAGACCTACATAACAAAAATGGG + Exonic
971741219 4:30524415-30524437 AAGATTTACAAATCACCAATAGG - Intergenic
971755067 4:30696944-30696966 AAGAAAAACAAATGAGAAATAGG + Intergenic
971893296 4:32554812-32554834 AAAACCAACAAATTAGAAATTGG - Intergenic
972022307 4:34331006-34331028 AAGATCTACAAATGACAAACAGG + Intergenic
972270279 4:37503727-37503749 AAGACATACAAATGAGAAACAGG - Intronic
972663803 4:41144524-41144546 CAGGAATACAAATCAGAAATGGG + Intronic
972928202 4:44038901-44038923 AAGATGTACAACTCAGGAATAGG + Intergenic
972944052 4:44231243-44231265 AAGACCTGAAAATCAGAGATAGG - Intronic
973161218 4:47019282-47019304 AAGAGCGACAAAGAAGAAACAGG - Intronic
974870245 4:67633952-67633974 AAGGGCTACAAATAATAAAAGGG - Intronic
975263613 4:72334895-72334917 AAGATCTACAAAATAGAAAGAGG + Intronic
975304120 4:72828674-72828696 AAGAGATACAAGAGAGAAATTGG - Intergenic
975695600 4:77009734-77009756 AAAAGCTAAAAATCAGACACAGG + Intronic
975735027 4:77372685-77372707 CAGAGCTACAACTCACAAGTGGG - Intronic
975946477 4:79711413-79711435 AAGAGCTGGAAATAAGAAGTAGG + Intergenic
976017338 4:80573247-80573269 AAGATATACAAATGACAAATAGG - Intronic
976421575 4:84850817-84850839 AAAAACTAGAAAACAGAAATGGG + Intronic
976481775 4:85555100-85555122 AAGAAATACAAATCAGAATATGG - Intronic
977657951 4:99544765-99544787 AAGAGATACAAAATAGAAATAGG - Intergenic
977822299 4:101487999-101488021 AAGAGCACCAAATAAGAAATAGG - Intronic
977971187 4:103216167-103216189 CAGAACTACAAGTAAGAAATGGG + Intergenic
978488610 4:109285820-109285842 AAATGCTACAAATCAGAGTTGGG + Intronic
979004537 4:115275550-115275572 AAGAGAAAGAAATGAGAAATAGG + Intergenic
979479250 4:121196441-121196463 AAGAGCTAAAATTCTGGAATTGG + Intronic
981929947 4:150178880-150178902 AAATGCAACAAATCAGAAGTTGG + Intronic
981992882 4:150944247-150944269 TACAGTTACAAATCAGTAATTGG + Intronic
982681025 4:158430873-158430895 AAGATCTACAAATGATAAACAGG + Intronic
982732877 4:158975309-158975331 AAAAGCCACAATTCACAAATGGG - Intronic
983133225 4:164047895-164047917 TGGAGCTACAAATCAAAATTGGG - Intronic
985178554 4:187230086-187230108 AAGAGAAACAAATCATAAATTGG + Intergenic
986189367 5:5480174-5480196 AAGGGCTATAATGCAGAAATTGG - Intronic
986283322 5:6341298-6341320 AAGAGCTTAAAAATAGAAATGGG + Intergenic
986886847 5:12248875-12248897 AAGACATAACAATCAGAAATGGG - Intergenic
988300401 5:29417959-29417981 AAGAACTACAAGTGAGAAAAGGG + Intergenic
988318938 5:29668341-29668363 GTGAGCTAAAAATGAGAAATAGG - Intergenic
989683040 5:44051829-44051851 AAGAACTATAAATCTGATATTGG + Intergenic
989829840 5:45902175-45902197 AAGAGCAATAAAACAGGAATTGG + Intergenic
990467555 5:56084181-56084203 AAGAACTACACATAAAAAATAGG - Intergenic
990569387 5:57062706-57062728 AAGAACTAGAAATAAGAAAAGGG + Intergenic
991029877 5:62071702-62071724 AAGAACTAAAAATAACAAATTGG - Intergenic
991234925 5:64382721-64382743 AAGATCTACATATCATAATTAGG - Intergenic
991706724 5:69365617-69365639 AAGAGTTATAAATCAGATGTTGG - Exonic
991963756 5:72071021-72071043 AAGATCTACAATTCTGAGATGGG + Intergenic
993639829 5:90389102-90389124 AAAAGCTACGTATCAGAAATAGG + Intergenic
993876212 5:93310456-93310478 AAGAACAAAAAATGAGAAATGGG + Intergenic
994175680 5:96708402-96708424 AAAAGCCCCAAATCAAAAATAGG - Intronic
994671671 5:102769125-102769147 AAGACATACAAATGACAAATAGG - Intronic
994888122 5:105593132-105593154 GAGAACTACAAATGAGAAATGGG - Intergenic
995595166 5:113740138-113740160 AAGAACTAAAAATTAGAAAACGG - Intergenic
997280667 5:132642552-132642574 AAGAGCAGCAAATCAGAAACAGG - Exonic
998190211 5:140017452-140017474 AAGAGCTAAAAAACAGAGAATGG + Intronic
998294996 5:140960755-140960777 AAGAGTTACAGAGGAGAAATAGG + Intronic
998494584 5:142576611-142576633 AATAGCTACAAATCAGGGAGAGG - Intergenic
998910020 5:146949367-146949389 AAGACATACAAATGACAAATAGG + Intronic
999503029 5:152165697-152165719 GAGAGTTATAAATCAGAGATGGG - Intergenic
1000373431 5:160558466-160558488 AATAGCCACAAATCTGAAAAAGG + Intergenic
1000455288 5:161441319-161441341 AAGACATACAAATCACAAACAGG + Intronic
1000500759 5:162046484-162046506 AAGAGCAACATCTCAGAAGTTGG + Intergenic
1000625658 5:163535253-163535275 AAGAGTTACATCTCTGAAATTGG + Intergenic
1001438146 5:171716468-171716490 AACAGGTGCAAATCAGAACTCGG + Intergenic
1004195840 6:13504532-13504554 AATAGCTATAAATAAGAGATTGG - Intergenic
1004306581 6:14506777-14506799 AAGGGCTACAGAAGAGAAATGGG - Intergenic
1004460460 6:15830355-15830377 AAAAGATCAAAATCAGAAATGGG - Intergenic
1004588617 6:17027517-17027539 ATGAGGTAGAAATTAGAAATGGG - Intergenic
1008191756 6:48467352-48467374 AAGAGATACAAATGACAAACAGG + Intergenic
1009737445 6:67694781-67694803 AAAATTTACAAATAAGAAATAGG + Intergenic
1010804711 6:80221879-80221901 AATAGCCACAATTCAGAATTGGG + Intronic
1010845202 6:80698512-80698534 AATAGCATCAAATCAGAAATGGG - Intergenic
1011410475 6:87060963-87060985 ACGAGCTACAAAATACAAATTGG + Intergenic
1012712468 6:102625068-102625090 AAGACATACAAATGAGAAACAGG - Intergenic
1013985526 6:116187982-116188004 AAGACCTATAAATCAGTAACAGG + Intronic
1014269907 6:119325244-119325266 AAGAGCGGGAAATCAGAATTAGG + Intronic
1014390999 6:120864213-120864235 AAGACATACAAATGGGAAATAGG + Intergenic
1014418794 6:121215491-121215513 AAGAGCAAAAATTCACAAATGGG + Intronic
1014801557 6:125784082-125784104 AACATTTTCAAATCAGAAATTGG - Intronic
1015824543 6:137297764-137297786 AAGAGCTATTTATCACAAATTGG - Intergenic
1016120119 6:140334190-140334212 AACAGGTACAAGTCTGAAATTGG + Intergenic
1016647554 6:146427287-146427309 AAGAGCTAAAGGTCAAAAATGGG - Intronic
1017075571 6:150614599-150614621 AAGGGCTACCAAGCAGAAGTTGG + Intronic
1018187250 6:161276531-161276553 AGGAGACACAAATCATAAATTGG + Intergenic
1018286909 6:162250216-162250238 AATAGCCACAACTTAGAAATGGG + Intronic
1019211698 6:170411068-170411090 AAGAGATAGAAATTACAAATAGG + Intergenic
1020643997 7:10791536-10791558 AAGAGAAAGAAATCACAAATAGG - Intergenic
1021003909 7:15369626-15369648 AAGAGCAATAAAACAGAAAATGG - Intronic
1022542309 7:31148859-31148881 AAAAGCTAAAATTCACAAATGGG + Intergenic
1025764162 7:64426936-64426958 AAGAGAAACAAATAAGAAAGGGG + Intergenic
1027415171 7:77966780-77966802 AAGAGCTACATTTTAGAGATGGG - Intergenic
1027969668 7:85062540-85062562 AATAGATAAAAATCAGAAAATGG + Intronic
1028660480 7:93266923-93266945 AAAATCTATAAATCAAAAATTGG - Intronic
1029004098 7:97189258-97189280 AAGAACTACAAGTGAGAAAGTGG - Intergenic
1030808247 7:113943894-113943916 AAGATATACAGATGAGAAATTGG - Intronic
1031089843 7:117341014-117341036 AACAGCTACAAATGAAAAACTGG - Intergenic
1031527801 7:122842388-122842410 CACAGCTGCAAACCAGAAATTGG - Intronic
1031616614 7:123889134-123889156 AAGAGAAACAAAGCAGAAATCGG + Intergenic
1031967222 7:128035278-128035300 CAGAGCTACATATCTGAGATGGG - Intronic
1032768362 7:135022671-135022693 AAAAGCTAAAATTGAGAAATGGG - Intronic
1032808659 7:135385007-135385029 AAGAACTATGAATTAGAAATTGG - Intronic
1033035795 7:137874836-137874858 AAGAGCCTCAAACCAGCAATTGG - Intergenic
1033180718 7:139175048-139175070 AAGACATACAAATGACAAATGGG + Intronic
1033183905 7:139207855-139207877 AAGACATACAAATGACAAATGGG + Intergenic
1033401582 7:141030668-141030690 AAGAAGTACAGATGAGAAATAGG + Intergenic
1033520083 7:142151697-142151719 AAGTGCTATAAATCAAGAATGGG + Intronic
1035126681 7:156612916-156612938 AATATCTCCAAATCAGATATAGG - Intergenic
1035738728 8:1909182-1909204 AAGAGTTACAATTCAGCAGTGGG + Intronic
1036403650 8:8433329-8433351 TAGAGCTAGAAATTGGAAATTGG + Intergenic
1037352017 8:17970087-17970109 AAGAGCTAGGAATCAAAAAAAGG - Intronic
1038470306 8:27811163-27811185 AGGAGCTACAAATCACGAAAAGG + Exonic
1039851844 8:41374935-41374957 AAGAGCTAAGAATCACAAAAAGG + Intergenic
1040460727 8:47645304-47645326 AACAGCTAAAAATCAGATGTGGG + Intronic
1040839438 8:51769540-51769562 AAGAATGACAAATCAGAAACTGG - Intronic
1042427838 8:68669778-68669800 AAGAGCTACAAACAGAAAATTGG + Intronic
1043037909 8:75220998-75221020 AAATGCTAGAAATTAGAAATTGG + Intergenic
1043093795 8:75938688-75938710 TATAGCTAAAAATCAGATATGGG - Intergenic
1043477323 8:80618051-80618073 AAGACCTACAAATGGTAAATGGG - Intergenic
1045032144 8:98147409-98147431 AGGAGCTAGGAATCAGGAATGGG + Intronic
1045502973 8:102757487-102757509 AAGTGCTACAAAGCAGAACCTGG + Intergenic
1046106893 8:109677076-109677098 AAGAGCTAGAAATCTGTAGTTGG + Intronic
1046174777 8:110561069-110561091 AAAAGCTAAAAATGACAAATGGG - Intergenic
1046389704 8:113554235-113554257 AAGAGCTCTAAATCCAAAATGGG - Intergenic
1046841797 8:118866848-118866870 AAAAGCCTCAACTCAGAAATGGG - Intergenic
1047487901 8:125349187-125349209 AGGAGAAACAAATCAGGAATTGG + Intronic
1047664318 8:127073906-127073928 AAGAGGCAGAAATTAGAAATAGG + Intergenic
1048151141 8:131895865-131895887 AAAAGATAGAAATAAGAAATTGG - Intergenic
1049267063 8:141673669-141673691 AAGAGCTAGAAAAAAAAAATTGG + Intergenic
1050037270 9:1450414-1450436 AAGTGCTACTATTCAGACATAGG - Intergenic
1051632346 9:19151876-19151898 AAGAGCTACACATCACGACTGGG - Intergenic
1051833001 9:21301647-21301669 AAAGCCTACAAATCAGAAAAAGG + Intergenic
1055861535 9:80755893-80755915 AAGAGCTACCAATCAGGATAAGG + Intergenic
1057122598 9:92589741-92589763 AAGAGCTCTAAATAAAAAATAGG - Intronic
1057336843 9:94162311-94162333 AGTAGCTAGAAATCAGAAAGCGG + Intergenic
1057974086 9:99585536-99585558 AAGAGATAAAAATTATAAATAGG + Intergenic
1058239192 9:102534989-102535011 AAGAGATAAATATCAGGAATTGG - Intergenic
1058393796 9:104526139-104526161 AGGAGCTACAATTCAAGAATTGG + Intergenic
1059522073 9:114952107-114952129 AAGTGGTACAAATAAGGAATAGG + Intergenic
1060247891 9:121961720-121961742 AAGAGTTATAAATGAGAAAGGGG + Intronic
1060601059 9:124877874-124877896 AAGAACTAAACGTCAGAAATGGG + Intergenic
1186281888 X:8002134-8002156 AAGACCTAAAAATCAGGAAATGG + Intergenic
1186535616 X:10344168-10344190 AAGAGATACAAATGACAAAAAGG - Intergenic
1187300169 X:18040925-18040947 AAGAACTTCAAATCAGACATTGG - Intergenic
1187755933 X:22526418-22526440 AAAAGCTAGAAAACTGAAATTGG + Intergenic
1187886409 X:23892905-23892927 AGGAGGTAAAAATCTGAAATGGG + Intronic
1188087354 X:25916108-25916130 AAGAGGAACAAATGGGAAATAGG + Intergenic
1188716878 X:33469482-33469504 ATGAGCTAAAAAAAAGAAATAGG - Intergenic
1188742657 X:33805241-33805263 AAGACATACAAATGACAAATGGG - Intergenic
1189081927 X:37982220-37982242 AAGAGATAGAAATCATAAAAAGG + Intronic
1189097220 X:38153365-38153387 AAGTGGTACAAATCAAACATGGG + Intronic
1189553576 X:42118275-42118297 AAGACCTAAAAAACAGAAACAGG - Intergenic
1190481975 X:50886262-50886284 AAGATCCAAAAACCAGAAATTGG - Intergenic
1191732137 X:64348293-64348315 AAGAGCTTCAACTTAGACATTGG - Intronic
1192400576 X:70830677-70830699 AAGACATACAAATCAGCAACAGG + Intronic
1192579034 X:72265565-72265587 AAACACTACAAATCAGAACTTGG + Intronic
1192583095 X:72300946-72300968 TAGAGATACAGATCAGAACTAGG - Intronic
1192802700 X:74482292-74482314 AAGCTCTACAAATAACAAATAGG - Intronic
1194270638 X:91810333-91810355 AATGGCTACAAATCAAGAATAGG - Intronic
1194557938 X:95385502-95385524 AAGACATACAAATGAGAAACAGG - Intergenic
1194845527 X:98802877-98802899 ATAAACTACAAATCAAAAATAGG + Intergenic
1195417847 X:104640339-104640361 AAGAGATACATATCATAAAAAGG - Intronic
1195452153 X:105027542-105027564 AAGACATACAAATGAGAAACAGG + Intronic
1195555861 X:106222463-106222485 AAGATCTAAAAATCCTAAATGGG + Intergenic
1195558290 X:106252613-106252635 AAGACATACAAATGAGAAACAGG - Intergenic
1196395493 X:115257105-115257127 AAGACCTTCAAGTCAGAAAGAGG + Intergenic
1197010494 X:121556289-121556311 AAGACATACAAATGACAAATGGG + Intergenic
1197362573 X:125524176-125524198 ACGAGATACAAATCAAACATTGG + Intergenic
1197377018 X:125693013-125693035 AAGAGCTTCAAAATACAAATTGG - Intergenic
1199506409 X:148566820-148566842 AAGAGCTACAAAGGAGATTTTGG - Intronic
1200807436 Y:7446939-7446961 AGTAGCTGCAAATCAGAAACAGG + Intergenic