ID: 945015167

View in Genome Browser
Species Human (GRCh38)
Location 2:205507580-205507602
Sequence CCTTATTTATGGAGTCTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 93}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945015167_945015177 27 Left 945015167 2:205507580-205507602 CCACCCAGACTCCATAAATAAGG 0: 1
1: 0
2: 0
3: 5
4: 93
Right 945015177 2:205507630-205507652 AAATCAAGGTGCTGTTAACAGGG 0: 1
1: 0
2: 5
3: 33
4: 270
945015167_945015174 13 Left 945015167 2:205507580-205507602 CCACCCAGACTCCATAAATAAGG 0: 1
1: 0
2: 0
3: 5
4: 93
Right 945015174 2:205507616-205507638 GAGTCCTCAAAGGAAAATCAAGG 0: 1
1: 0
2: 6
3: 40
4: 274
945015167_945015173 3 Left 945015167 2:205507580-205507602 CCACCCAGACTCCATAAATAAGG 0: 1
1: 0
2: 0
3: 5
4: 93
Right 945015173 2:205507606-205507628 GGTGAAGAGAGAGTCCTCAAAGG 0: 1
1: 0
2: 0
3: 23
4: 226
945015167_945015176 26 Left 945015167 2:205507580-205507602 CCACCCAGACTCCATAAATAAGG 0: 1
1: 0
2: 0
3: 5
4: 93
Right 945015176 2:205507629-205507651 AAAATCAAGGTGCTGTTAACAGG 0: 1
1: 1
2: 4
3: 24
4: 272

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945015167 Original CRISPR CCTTATTTATGGAGTCTGGG TGG (reversed) Intronic
901895006 1:12304340-12304362 TCTTGTTTATGGGATCTGGGAGG + Intronic
902697523 1:18150339-18150361 CCTTCCTTACGGAGGCTGGGAGG + Intronic
903795221 1:25923330-25923352 CCCAATTTTTGGAGCCTGGGAGG + Intergenic
904290946 1:29485584-29485606 CCTGAGTTTTGGAGTCTGGCTGG - Intergenic
906245435 1:44270208-44270230 ACTTATCTATTGAGTCTGAGAGG - Intronic
912766574 1:112417816-112417838 TTTTATTTATGGAGTTTTGGGGG + Intronic
915732673 1:158065388-158065410 CCTTAATTATGGAGCCTGTAGGG + Intronic
915738524 1:158100010-158100032 ATTTATTTTTGGGGTCTGGGTGG - Intronic
917314277 1:173708506-173708528 CCATAGTTCTGGAGGCTGGGAGG - Intergenic
923095399 1:230771441-230771463 CCTTATTTCAGGTGTCTGTGAGG - Intronic
924083118 1:240420184-240420206 CATTCTTTATGGCCTCTGGGTGG + Intronic
924214142 1:241802716-241802738 CATTAATTATGGAATCTAGGTGG + Intergenic
1073151579 10:101315170-101315192 CCATATATCTGGAGTCTGGTAGG + Intergenic
1074152985 10:110774950-110774972 CCTTATTTATGGTATTTTGGTGG - Intronic
1078583814 11:12562315-12562337 CCTTATTTATAAAGTCAAGGTGG + Intergenic
1083170474 11:60921418-60921440 TCTTTTTTAGGGGGTCTGGGTGG - Intronic
1086739743 11:90352498-90352520 ACTTATTTATGGAGGAGGGGTGG + Intergenic
1089917275 11:122170225-122170247 TCCTATTTCTGGAGGCTGGGAGG - Intergenic
1090539371 11:127683762-127683784 CCTTATTTAATGATTCTGTGTGG - Intergenic
1097637346 12:62138947-62138969 CCTTATTTCTGATCTCTGGGTGG - Intronic
1100137750 12:91574683-91574705 TCTTATTAAGGGAGTCAGGGAGG - Intergenic
1103019561 12:117523044-117523066 CCTGATTTAAGGAGGCTTGGAGG + Intronic
1103482180 12:121257875-121257897 CCTGATTTATGGTGCTTGGGTGG - Intronic
1104665054 12:130641929-130641951 GCTTATCTATAGAGTCAGGGTGG - Intronic
1106160784 13:27199545-27199567 CTTGATTTATGGAGGCTGAGAGG - Intergenic
1110396369 13:75034133-75034155 CCCTATTGATAGAGTGTGGGTGG + Intergenic
1110735448 13:78930365-78930387 CCTTATTTATGGTGTACTGGGGG + Intergenic
1112589042 13:100747185-100747207 CCATATTTATAGAGTCTAGAAGG - Intergenic
1126286465 15:47018543-47018565 CATCCTTCATGGAGTCTGGGAGG + Intergenic
1137236423 16:46622142-46622164 GCTTCTTCATGGAGTCTGGCTGG - Intergenic
1140452296 16:75080654-75080676 CCTTTTTTATGGAGTGTGTGTGG - Intronic
1146827109 17:36032484-36032506 CCCTATATATGGACTTTGGGTGG - Intergenic
1153157930 18:2169961-2169983 CCTTAATGATGGAATGTGGGTGG + Intergenic
1163844349 19:19629940-19629962 CCTTATTTAAGGTGCCAGGGTGG + Exonic
1164139943 19:22450558-22450580 CCTTATTTACAGATTCTAGGTGG - Intronic
929594943 2:43170055-43170077 CCTTTTCTTTGGAGGCTGGGAGG - Intergenic
930356143 2:50323270-50323292 CCTGATTTATGAGGTCTGGGTGG + Intronic
933429929 2:82163226-82163248 ACTTATTTTGGGAGTCTGAGAGG + Intergenic
934667786 2:96185411-96185433 CCTTTTTTCTGGAGTCTTGAGGG - Exonic
935802730 2:106714863-106714885 CATGCTTTATGGAGCCTGGGGGG - Intergenic
937371823 2:121303695-121303717 CCCTAATTATGGTTTCTGGGAGG + Intergenic
937939651 2:127275108-127275130 CCTTTCTTATGAAGGCTGGGAGG + Intronic
945015167 2:205507580-205507602 CCTTATTTATGGAGTCTGGGTGG - Intronic
945634317 2:212328426-212328448 CCTTAATTATAGAATCTAGGAGG - Intronic
1169922984 20:10755279-10755301 CATTGTCTATGGAGTCTGGGTGG + Intergenic
1170231375 20:14050362-14050384 CCTTATTTTGGCAGTCTTGGGGG + Intronic
1173049692 20:39547218-39547240 CCTTATAGATGGAGTCTGGCTGG - Intergenic
1173187489 20:40851880-40851902 CCTAATTTTAGCAGTCTGGGAGG - Intergenic
1177492387 21:21844538-21844560 CTTTATTAATGGATTATGGGAGG - Intergenic
1184932498 22:47691692-47691714 CATTATTCCTGGTGTCTGGGAGG + Intergenic
951987755 3:28639939-28639961 CAATATTTATGGAGTGTGTGGGG - Intergenic
952512652 3:34072651-34072673 CCTTATTTGTGGATCTTGGGAGG - Intergenic
955013179 3:55040018-55040040 CCACATTTTTGGAGGCTGGGAGG + Intronic
956407507 3:68943483-68943505 CCTTGTTTATCAAGACTGGGTGG - Intergenic
961148537 3:124616247-124616269 GCTTAATTATAGAGGCTGGGGGG - Intronic
963572888 3:147019970-147019992 CCTTCTTTTTTGAGTTTGGGGGG - Intergenic
963806090 3:149724485-149724507 TTTTTTTTAAGGAGTCTGGGGGG - Intronic
966193815 3:177294620-177294642 CCATATTTATGCATTCTGGATGG + Intergenic
967896689 3:194401204-194401226 CCTTTTTTATGGTGTCTTGAAGG - Intergenic
969583414 4:8078442-8078464 GCTCATTTATGGAGACTCGGAGG - Intronic
971248884 4:24955147-24955169 CCTTGGTTCTGGAGACTGGGAGG + Intronic
972556430 4:40186135-40186157 CCTTGTTTTTGGAGTCTGTCTGG + Intergenic
978593386 4:110350996-110351018 CTTTATTTAAGCAGTTTGGGAGG + Intergenic
984339034 4:178430073-178430095 TCTTATTACTGGAGTCAGGGAGG - Intergenic
987921708 5:24291897-24291919 CCTTATTTCTGCAGTTGGGGTGG + Intergenic
993081464 5:83306715-83306737 TCTTATTGCTGGAGTCAGGGAGG - Intronic
994491142 5:100445209-100445231 CAGTAATTATGGAATCTGGGAGG + Intergenic
994910161 5:105894640-105894662 CCTTATGTAAAGAGTCTGAGGGG - Intergenic
995566687 5:113438184-113438206 CCTTATTTTTGGGTTGTGGGGGG + Intronic
996364595 5:122687693-122687715 CCGTTTTTATGGAGTCTTTGGGG - Intergenic
1001084268 5:168689135-168689157 TCTGATTCAGGGAGTCTGGGTGG + Intronic
1002059933 5:176620223-176620245 CTTTATTCATGGACTCTCGGGGG + Exonic
1010940626 6:81912588-81912610 CATGATTTGTGGAGTCAGGGTGG + Intergenic
1011627607 6:89296336-89296358 TCTTATTTATGGACTCATGGAGG + Intronic
1013594215 6:111646270-111646292 CCTTATTCAGTAAGTCTGGGAGG + Intergenic
1018526171 6:164712031-164712053 CCTTATTTAAGAAGTCTGTAGGG + Intergenic
1019139195 6:169932896-169932918 CATTATCTATGGAGTCTGAGAGG - Intergenic
1020694880 7:11401304-11401326 CCTTATTTATGAAGGGTGGCAGG + Intronic
1026627293 7:72006853-72006875 AGTTATTTTAGGAGTCTGGGAGG - Intronic
1027442106 7:78230636-78230658 CCTTATTTATTGAGACTTTGAGG + Intronic
1030963357 7:115955264-115955286 CCTTATTTATTTAATGTGGGAGG - Intronic
1041485093 8:58367383-58367405 ACTTACTTTTGGAGTGTGGGAGG - Intergenic
1044160725 8:88911625-88911647 CCTTGTTTAAGGACTCTTGGTGG + Intergenic
1051804554 9:20977509-20977531 CTTTATTTTTGGAGTTAGGGTGG - Intronic
1055107512 9:72527969-72527991 CCTAAATTCTGGAGTCGGGGAGG - Intronic
1055225905 9:73994898-73994920 CCTTTTTTTTGGAGGGTGGGGGG + Intergenic
1055884143 9:81039407-81039429 ACTTATATGTGGAGTCTAGGGGG - Intergenic
1057522167 9:95768740-95768762 CCAAAGTTCTGGAGTCTGGGAGG - Intergenic
1057691157 9:97287649-97287671 TCATATTTCAGGAGTCTGGGTGG + Intergenic
1059618901 9:115981612-115981634 CCTTATTTCTGAAGTCAGGAGGG + Intergenic
1060713014 9:125889692-125889714 CATTAATTATGCAGTCAGGGCGG + Intronic
1061734576 9:132645219-132645241 CGTTTGTTATGGAGTCGGGGTGG - Intronic
1061907466 9:133705988-133706010 CCACATTTCTGGAGACTGGGAGG - Intronic
1061945773 9:133907619-133907641 ACTGATTTATGGACTCTGGAGGG + Intronic
1189712297 X:43826182-43826204 CTTTATTTGTGGAATTTGGGTGG + Intronic
1193350636 X:80460452-80460474 CGTTATTTATGTGGTCTGTGAGG + Intergenic
1193350691 X:80461564-80461586 CGTTATTTATGTGGTCTGTGAGG - Intergenic
1196027588 X:111057346-111057368 CCTTAATTATTGAATCTAGGTGG - Intronic
1196923986 X:120613776-120613798 CATTATTTAAGGAGTCTAGTGGG - Intronic