ID: 945015177

View in Genome Browser
Species Human (GRCh38)
Location 2:205507630-205507652
Sequence AAATCAAGGTGCTGTTAACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 309
Summary {0: 1, 1: 0, 2: 5, 3: 33, 4: 270}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945015172_945015177 16 Left 945015172 2:205507591-205507613 CCATAAATAAGGATAGGTGAAGA 0: 1
1: 0
2: 2
3: 15
4: 134
Right 945015177 2:205507630-205507652 AAATCAAGGTGCTGTTAACAGGG 0: 1
1: 0
2: 5
3: 33
4: 270
945015169_945015177 24 Left 945015169 2:205507583-205507605 CCCAGACTCCATAAATAAGGATA 0: 1
1: 0
2: 1
3: 12
4: 209
Right 945015177 2:205507630-205507652 AAATCAAGGTGCTGTTAACAGGG 0: 1
1: 0
2: 5
3: 33
4: 270
945015170_945015177 23 Left 945015170 2:205507584-205507606 CCAGACTCCATAAATAAGGATAG 0: 1
1: 0
2: 0
3: 15
4: 131
Right 945015177 2:205507630-205507652 AAATCAAGGTGCTGTTAACAGGG 0: 1
1: 0
2: 5
3: 33
4: 270
945015167_945015177 27 Left 945015167 2:205507580-205507602 CCACCCAGACTCCATAAATAAGG 0: 1
1: 0
2: 0
3: 5
4: 93
Right 945015177 2:205507630-205507652 AAATCAAGGTGCTGTTAACAGGG 0: 1
1: 0
2: 5
3: 33
4: 270

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945015177 Original CRISPR AAATCAAGGTGCTGTTAACA GGG Intronic
900801536 1:4740065-4740087 AAATAACGCTGCTGTGAACATGG - Intronic
901276355 1:7994181-7994203 GAATAATGCTGCTGTTAACATGG + Intergenic
903315765 1:22504662-22504684 AAATGAAGGTGCTGTTCATAGGG - Intronic
903413030 1:23162309-23162331 AGATCTAGGTGCTGCTTACATGG + Intronic
903572371 1:24315718-24315740 AAATCAAGATGATTTTAATAGGG + Intergenic
904554790 1:31352828-31352850 AAATAATGCTGCTGTGAACATGG + Intronic
905501477 1:38442898-38442920 AAATCAGGGCTCTGTTAATAAGG - Intergenic
908010452 1:59770886-59770908 AAATCATGGTTCTGTTAAAAAGG + Intergenic
908232555 1:62120240-62120262 AAATCTAGGTGCTATTTATATGG + Intronic
908339317 1:63160400-63160422 ATTTCGAGGTGCTTTTAACATGG + Intergenic
908512690 1:64861883-64861905 AATTCAAGATGCTCTGAACAAGG + Intronic
909429871 1:75574991-75575013 AAATCAAGGTCCAGTGAAGAGGG + Intronic
910774318 1:90860097-90860119 AAATTAAGTTTCTGTTTACAAGG + Intergenic
913148762 1:116019012-116019034 AAATACAGGTGCTATGAACATGG + Intronic
915084958 1:153380150-153380172 AAATCAAAGATCTGGTAACAGGG + Intergenic
916662209 1:166933116-166933138 AAATCACGGTTCTGTTAGCAAGG - Intronic
917461350 1:175233166-175233188 AAATCAAGGTTCTGTTATCAAGG - Intergenic
917514649 1:175697581-175697603 AAATCAAAGTGCAGTAAAGAAGG - Intronic
920286994 1:204887440-204887462 AAATCATGTTGCTATGAACATGG + Intronic
920808288 1:209255818-209255840 AAATAAAGCTGCTGTGAACATGG + Intergenic
1063787279 10:9400151-9400173 AATTCAAGGTTATCTTAACAAGG + Intergenic
1065345785 10:24746959-24746981 AAATCATGCTGGTGTGAACATGG - Intergenic
1065451862 10:25867599-25867621 AAATGAAGGTGCCATTGACAGGG + Intergenic
1066663763 10:37762146-37762168 AAATCAAGGTTCTGCTGGCATGG + Intergenic
1067365402 10:45623318-45623340 GAATAATGGTGCTGTGAACATGG - Intronic
1067997260 10:51287492-51287514 AGATGAAGGTCCTGTTCACATGG + Intronic
1070234864 10:74613117-74613139 AAAGAAAGGTGCTTTTAAGAAGG - Intronic
1070528916 10:77319173-77319195 AAAACAAGATGCTGTATACATGG - Intronic
1070568884 10:77625789-77625811 AAATAATGCTGCTGTGAACATGG + Intronic
1071381329 10:85063451-85063473 AAATCAAGGTGGTCTTCCCAAGG + Intergenic
1072745808 10:97938390-97938412 ATATGAGGGTGCTTTTAACAAGG - Intronic
1073415636 10:103379431-103379453 AAATCAGGGTTCTGTTAGTAAGG + Intronic
1074339927 10:112618565-112618587 ATATCAACGGGCTGTTAAGAAGG + Intronic
1074982835 10:118633480-118633502 AAATCAAGGAACTGTTAAAAAGG + Intergenic
1076946041 10:133651233-133651255 CAGTTAAGGTGCTGTTACCATGG - Intergenic
1078776826 11:14401590-14401612 AAATCAAGATTCTGTTAAAATGG + Intergenic
1078828208 11:14951927-14951949 TAATCAAAGTGCTGTAAACCTGG + Intronic
1083020312 11:59500101-59500123 TAAACAATGTGCTGTTTACATGG + Intergenic
1085870671 11:80346101-80346123 AAATAAATGTGTTGTTAATAAGG - Intergenic
1085929602 11:81065469-81065491 AAATCAAGATCCTGTTGGCAAGG - Intergenic
1086384534 11:86293574-86293596 AAATTGGGGTTCTGTTAACAAGG + Intergenic
1089274267 11:117323536-117323558 AAATAATGCTGCAGTTAACATGG + Intronic
1089741164 11:120585245-120585267 GAATAATGGTGCTGTGAACATGG + Intronic
1090587960 11:128234664-128234686 AAATCAAGGTGCCAGTGACATGG + Intergenic
1091275833 11:134349381-134349403 AAATAAAGCTGCTGTGAGCATGG + Intronic
1093749696 12:22783988-22784010 CAACCAAGGTGCTGTTAACAAGG + Intergenic
1095132288 12:38558254-38558276 TCATAAAGTTGCTGTTAACAAGG - Intergenic
1095390827 12:41704459-41704481 AAATGAAGGTGATGTTAGGATGG - Intergenic
1096129625 12:49147452-49147474 AAATCAGGGTTCTGTTACTAAGG - Intergenic
1096424076 12:51486251-51486273 CAATGAAAGTGCTGTTAACGAGG - Intronic
1098977046 12:76913527-76913549 AAATCAAGGTGCTGGGATCCGGG + Intergenic
1100573201 12:95862305-95862327 AAATAATGCTGCTGTGAACATGG + Intronic
1101344033 12:103868623-103868645 ATCTCAAGGGACTGTTAACATGG - Intergenic
1103352373 12:120293512-120293534 AAATCAGGGTTCTGTTCACTTGG + Intergenic
1103599005 12:122042253-122042275 AAATCAAGGTGGAGTGTACAGGG - Intronic
1104285933 12:127424717-127424739 AGATCAAGATGCTGTCAAGATGG - Intergenic
1104326074 12:127799983-127800005 TAAACAAGGTGATGTTAATAAGG + Intergenic
1104552775 12:129772660-129772682 ACATCTAGATGCTGTTATCAGGG - Intronic
1107361884 13:39627061-39627083 AAATAAATGTGCTATGAACATGG + Intergenic
1109369568 13:61404559-61404581 AAATCATTGTGCTGTACACAGGG - Intergenic
1109713662 13:66191658-66191680 AAATAATGGTGCAGTGAACATGG - Intergenic
1110032015 13:70627825-70627847 AATTCATGGTGGTGGTAACAAGG - Intergenic
1111618796 13:90696649-90696671 AAATCAGGGTTCTGTTACTAAGG + Intergenic
1115329640 14:32182258-32182280 AGATCAAGGTGCTGTCAAGGAGG - Intergenic
1115808412 14:37078485-37078507 AAATCAAGGTTTTGTGGACATGG + Intronic
1116386088 14:44331742-44331764 AATTCAAGATGATGTTTACATGG + Intergenic
1118811774 14:69280485-69280507 AAATAATGGTGCTGCAAACATGG + Intronic
1118834064 14:69463542-69463564 TAATCTAGGTGCTGGTTACAGGG + Intergenic
1118961159 14:70534409-70534431 AAATAATGCTGCAGTTAACATGG - Intronic
1120324021 14:83002930-83002952 AAATGCAGGTGCTGTAGACAGGG - Intergenic
1120463915 14:84831644-84831666 TAATCCAGCTGCTGTTATCATGG + Intergenic
1120470555 14:84918421-84918443 AAAACATGGTGATGTTAAAAAGG - Intergenic
1121367659 14:93329498-93329520 GAATAAAGCTGCTGTGAACATGG - Intronic
1121383049 14:93491030-93491052 AAATCAAGGTGCTGGTAGATTGG + Intronic
1121900585 14:97690090-97690112 AGATCAAGGTGTTGTCAGCAGGG + Intergenic
1202920144 14_KI270723v1_random:23828-23850 TAGTTAAGGTGCTGTTACCATGG - Intergenic
1123811140 15:23927272-23927294 ATATTTAGGTGCTGTTAAAATGG + Intergenic
1124351215 15:28957013-28957035 GAATCATGCTGCTGTGAACATGG + Intronic
1124885393 15:33680756-33680778 AAAGCAGGGTTCTGTTAAGAAGG + Intronic
1127212231 15:56785012-56785034 AAATCAAAATTCTGTTAAAATGG + Intronic
1127496733 15:59519851-59519873 AAATAATGGTGCAGTGAACAGGG + Intronic
1128413371 15:67421369-67421391 AAATCAGCGTGCTGTCGACAGGG + Exonic
1128439236 15:67688465-67688487 AAACCAATGTGATGTTTACAAGG - Intronic
1129183961 15:73894462-73894484 AAAACAAGATGCAGTAAACATGG - Intergenic
1130656870 15:85797886-85797908 AAGTCAGGGTTCTGTTAACAAGG + Intergenic
1132944135 16:2523216-2523238 CAATTAAAGTACTGTTAACAGGG - Intronic
1133174019 16:4000102-4000124 AACTCAAAATGATGTTAACATGG + Intronic
1133603650 16:7364878-7364900 ATATCAAGATGCTGTTAGGAAGG + Intronic
1134632330 16:15765773-15765795 GAATGAAGCTGCTGTTGACAGGG + Intronic
1135120506 16:19762206-19762228 CAATCAAGTTTCTGTTAATAAGG + Intronic
1135870703 16:26147307-26147329 AAAGCAGGGTTCTTTTAACAAGG - Intergenic
1135948432 16:26887542-26887564 AAATAAAGCTGCTGTGAACGTGG - Intergenic
1136585747 16:31183564-31183586 ATATTACAGTGCTGTTAACAGGG + Intronic
1136848894 16:33598341-33598363 AAATAATGTTGCTATTAACACGG + Intergenic
1137470720 16:48755162-48755184 AAATAATGGTGCTATGAACATGG + Intergenic
1137954514 16:52815415-52815437 AAAATTAGGTGCTGTTACCAGGG - Intergenic
1138228047 16:55315775-55315797 ACATGAAGGTGTTGTTAGCAAGG + Intergenic
1138801290 16:60033247-60033269 AAATAAAGGAGAAGTTAACAAGG + Intergenic
1139030970 16:62879741-62879763 AAATCTGGGTCCTGTTAATAAGG - Intergenic
1140493175 16:75358210-75358232 AATACAAGCTGCTGTTAAAATGG + Intronic
1141747757 16:85937448-85937470 AAATCAGGGTTCTGTGAACAAGG + Intergenic
1203110601 16_KI270728v1_random:1446991-1447013 AAATAATGTTGCTATTAACACGG + Intergenic
1143339559 17:6200073-6200095 AATTCTAGGTGATGTTATCAAGG - Intergenic
1143817882 17:9533837-9533859 AAATTGAGGTTCTGATAACAAGG - Intronic
1144286576 17:13780906-13780928 AAATCAATGTACTGTAAATAAGG + Intergenic
1147564713 17:41529032-41529054 CAAGCAAGGGGCTCTTAACAGGG - Intergenic
1148346944 17:46909654-46909676 AAATAAAGGTGCTGTTGCCATGG - Intergenic
1150427605 17:65088963-65088985 GAATCATGGTGCTATGAACATGG + Intergenic
1153002755 18:470771-470793 ACATCCAGATGCTTTTAACAAGG + Intronic
1153505421 18:5791618-5791640 AATTCAAAGGGCTGTTAACATGG + Intergenic
1153946229 18:10020159-10020181 AAATCAGGGTTCTGTTAGCAAGG + Intergenic
1155553580 18:26993379-26993401 AAATGAAGGTGGTTTTAAAATGG + Intronic
1155750505 18:29417211-29417233 AAATTAATGTGCTGTTTAGAGGG + Intergenic
1155788264 18:29929989-29930011 TAATCATGGTGCTCTTCACATGG - Intergenic
1158374691 18:56849594-56849616 AAATCAAAGTGATGTCAACTAGG - Intronic
1159479320 18:68967054-68967076 AACTCTAGGAGGTGTTAACAGGG - Intronic
1159499084 18:69245540-69245562 AAATCCCGGTACTGTTAGCAAGG + Intergenic
1160721946 19:601581-601603 CAATCAAGCTGGTGTGAACACGG + Intronic
1161749863 19:6087745-6087767 AAATCAAAGGGCTGATATCATGG + Intronic
1163260729 19:16188329-16188351 GAATGAAGGTGCTGTTTACTGGG + Intronic
1164832092 19:31330661-31330683 ACATCAATGTGCTTTTAACAAGG + Intronic
1166770629 19:45279979-45280001 AAATCAATGTGCTGTTGGGAAGG + Intronic
1167304692 19:48700943-48700965 AAATTAGGGTGGTGTTACCAAGG + Intronic
1167305302 19:48704896-48704918 AAATTAGGGTGGTGTTACCAAGG + Exonic
1167530908 19:50015804-50015826 AAATGAAGGAGATGTTAACATGG + Intronic
1167645169 19:50701895-50701917 AAATGGTGGTGCTGTTATCAGGG - Intronic
925431860 2:3801692-3801714 AAGCCAAGGAGCAGTTAACAGGG - Intronic
926681141 2:15665127-15665149 ACATCAAGGTTCAGTTAAAAGGG - Intergenic
928664167 2:33533921-33533943 AAATAAAGGAGCAGTTAACTAGG - Intronic
930045290 2:47165553-47165575 AAATCAAAGTACTGTTACGAAGG - Intronic
933677161 2:85067054-85067076 AAATCAAATAGATGTTAACAAGG - Intergenic
936408365 2:112229476-112229498 AAGTAAATGTGCTGTAAACAGGG + Intronic
937371337 2:121299608-121299630 AAATCAGGGTTTTGTTAACAAGG - Intergenic
938306913 2:130262801-130262823 AAATCAGGGAGCTGCCAACAGGG - Intergenic
938398935 2:130972131-130972153 TAATAAATGTCCTGTTAACAAGG + Intronic
938977147 2:136490821-136490843 AAATGAAAGTGCTGATACCAGGG - Intergenic
939316255 2:140553686-140553708 GAATCAAGGGACTCTTAACAAGG + Intronic
939686157 2:145203316-145203338 AAATGAAGATGCTTTTAACAAGG + Intergenic
940050386 2:149456345-149456367 TAATCAGGGTGCTGCTTACATGG - Intronic
940642105 2:156355927-156355949 ACATCAACATACTGTTAACAAGG - Intergenic
940945880 2:159616591-159616613 AATGAAAGTTGCTGTTAACAAGG + Exonic
941650327 2:168085489-168085511 AAATCAAGGAGCTGTGCCCATGG + Intronic
942979519 2:182062939-182062961 AAATCAACATGCTATTAAAATGG + Intronic
943157571 2:184203736-184203758 AAAGCAAGCTGCTTTTAAAAGGG - Intergenic
944065287 2:195613114-195613136 AAATCAAAGTTCTGTTCATAGGG + Intronic
945015177 2:205507630-205507652 AAATCAAGGTGCTGTTAACAGGG + Intronic
945635863 2:212349864-212349886 AAATCAAGGTTCTGTTAATAAGG + Intronic
948422596 2:237869701-237869723 GAATCAGGCTGCTGTGAACATGG + Intronic
1169000880 20:2167200-2167222 AAATCAGGGTACTGTTAGGAAGG + Intronic
1169410061 20:5360995-5361017 AAATCAAGGAGCATTTAATAAGG + Intergenic
1170221871 20:13949903-13949925 AAATAATGCTGCTATTAACATGG - Intronic
1170241181 20:14168498-14168520 AATGCAAGGTGCTAATAACATGG - Intronic
1170291082 20:14768882-14768904 AATTCAAGGTGCTCTTTAGAAGG - Intronic
1170432797 20:16292447-16292469 AAATAAAGATGCAGTTTACACGG + Intronic
1170650236 20:18232916-18232938 GAATAATGGTGCTGTGAACAGGG + Intergenic
1173171567 20:40729077-40729099 TAATCAAGCTGCTTTTCACATGG - Intergenic
1173797515 20:45872678-45872700 AAAACAAGGTGATGAAAACAAGG + Intronic
1174418425 20:50383325-50383347 AAGTCAGGGTTCTGTCAACAAGG + Intergenic
1175405994 20:58728993-58729015 AAATAAAGCTGCTATGAACATGG - Intergenic
1177357500 21:20028490-20028512 AAATAAAGGATCTGTTAACATGG - Intergenic
1177799527 21:25814401-25814423 AAATGATGCTGCTGTGAACATGG - Intergenic
1178669907 21:34581231-34581253 AAATCAAGATGCTGTTTCTAGGG + Intronic
1178896536 21:36563442-36563464 AAGTCAATGTGCTGTAAACATGG + Intronic
1179320082 21:40282719-40282741 AAAACAATGTGTTGTTGACATGG - Intronic
1180884270 22:19229138-19229160 GAATAATGCTGCTGTTAACATGG - Intronic
1181483345 22:23215268-23215290 AAAGCATGCTGCTGTGAACACGG + Intronic
949719624 3:6973813-6973835 CAGTCAAGGTGCAGTTCACATGG + Intronic
950296259 3:11834304-11834326 AAATCAAAATCCTCTTAACAAGG + Intronic
951445180 3:22771074-22771096 AAATCATGGTGGTATGAACAGGG + Intergenic
951786750 3:26428896-26428918 AAATCAAGGAGCTGGCAGCAAGG - Intergenic
952568559 3:34685606-34685628 AAACCAAGCTGCTGCTGACAAGG + Intergenic
953176441 3:40557756-40557778 AAATCAACGTGCTCTCTACAGGG - Intronic
955651452 3:61198480-61198502 AAATAAAGATGCTGTTAGGAAGG + Intronic
956089764 3:65653458-65653480 AAGTCATGGTCCTGATAACACGG - Intronic
956876577 3:73469773-73469795 AAAACAAAGTGCTATTTACATGG + Intronic
957081445 3:75639236-75639258 TAGTTAAGGTGCTGTTACCATGG + Intergenic
959149017 3:102585996-102586018 AAATCTAGGTGTTGTTATGAAGG - Intergenic
959486884 3:106936832-106936854 ACATCAAGGAGATGTTACCAAGG - Intergenic
959532908 3:107453953-107453975 AAATCAAGGAGCTGTGAGCAGGG + Intergenic
960160445 3:114344429-114344451 AGAACAAGGAGTTGTTAACAAGG - Intronic
960601424 3:119462932-119462954 AAATCATGATTCTGTCAACATGG + Intronic
961160455 3:124719650-124719672 AAATCAAGGGGCTTTTCAGAAGG + Intronic
961577790 3:127852238-127852260 AACCGAAGGTGCTGGTAACATGG + Intergenic
962303194 3:134261820-134261842 AGATCAAGGTGCTGCCAAGATGG + Intergenic
963471739 3:145749756-145749778 AAATCAATGTGCTTATAGCAAGG + Intergenic
963828047 3:149976784-149976806 AATTCAAGATTCTGTTAGCAAGG - Intronic
964396714 3:156253589-156253611 AAATCAGTGTTCTGTTAGCAAGG - Intronic
965077522 3:163998024-163998046 CAATCAAGGACATGTTAACATGG - Intergenic
965371853 3:167872529-167872551 AAATCAATGGGCTGCTTACAGGG + Intergenic
966812264 3:183857301-183857323 CAATCCAGGTGCTGGTTACATGG + Intronic
967408119 3:189139786-189139808 CAATCAAGCTTCTGTTAACATGG + Intronic
968737766 4:2306381-2306403 AAATCTGGGTGCTATTCACATGG - Intronic
969054769 4:4394676-4394698 ATATCAAGGAGCTCTTACCATGG - Intronic
971368811 4:25998973-25998995 AAACCAAGATGCTAGTAACAGGG - Intergenic
971919490 4:32918499-32918521 AAATCAAGGGGCAATTAACAAGG - Intergenic
972742174 4:41897917-41897939 AAATCAAGGTGTGGTTGGCAAGG + Intergenic
976158459 4:82173134-82173156 AAACCAATGTGTTGTTAACTGGG + Intergenic
976421495 4:84849791-84849813 AACTCAATGTGCTGAGAACAAGG + Intronic
977189960 4:93987137-93987159 AGACCAAGGTGGGGTTAACAAGG + Intergenic
977551714 4:98449882-98449904 AAATCGGGGTTCTGTTAATAAGG - Intergenic
978713938 4:111819269-111819291 AAATAATGCTGCTGTAAACATGG - Intergenic
979059419 4:116038127-116038149 AAATAATGCTGCTGTGAACATGG - Intergenic
980971757 4:139573726-139573748 AAATCATGGTGCTATTATCATGG + Intronic
981214633 4:142149882-142149904 AGAGCAAGGTGCAGATAACAAGG + Intronic
981417184 4:144506860-144506882 GAATCAAGGTGTTATTAACATGG - Intergenic
982639527 4:157940693-157940715 AAATAATGCTGCTGTGAACATGG - Intergenic
983278455 4:165649073-165649095 AAAAGAAGATGTTGTTAACATGG + Intergenic
983601703 4:169536786-169536808 AATTCCAGCTGCTATTAACATGG + Intronic
983603992 4:169564394-169564416 AAATATAGCTGCTGTTAAAATGG - Intronic
984129937 4:175862240-175862262 TAATCTGGGTGCTGTTTACATGG - Intronic
985449451 4:190051886-190051908 CAGTTAAGGTGCTGTTACCATGG - Intergenic
986129773 5:4918351-4918373 GAATGACGGTGCTGTGAACATGG - Intergenic
987695285 5:21320664-21320686 AATTCAAGGTTCTGTTTAAATGG - Intergenic
988260271 5:28877259-28877281 CAATAAAGGAGCTGTTAAAAAGG - Intergenic
988393214 5:30662761-30662783 AATTCAAGGGGCTGTTATCTTGG - Intergenic
989487632 5:42010637-42010659 AAATAATGGTGCTATGAACAAGG + Intergenic
990101103 5:52188351-52188373 AAATCAAGGTGCTGTCAGACAGG - Intergenic
990685629 5:58297569-58297591 AAATCAAGGTGCAGACATCAGGG - Intergenic
991194025 5:63910788-63910810 AATTCAAGGTGTTTTTAAGAGGG + Intergenic
995513379 5:112930019-112930041 AAATCAAGGTGCTGTCAGCAGGG + Intergenic
995651347 5:114372001-114372023 AAATCAAGATGCTATTTAAAAGG - Intronic
996605768 5:125319708-125319730 AGATCAAGGTGTTGGTTACATGG - Intergenic
998301308 5:141023594-141023616 GAATAATGCTGCTGTTAACATGG - Intergenic
998533256 5:142904582-142904604 AATGCCAGGTGCTGCTAACATGG + Intronic
999873682 5:155778533-155778555 AAATAAACGTATTGTTAACACGG + Intergenic
1000806670 5:165803230-165803252 AAATCAAATTGCTGTGACCAAGG + Intergenic
1001217656 5:169870954-169870976 AAATCAAAGTGCTGTTAGTTGGG + Intronic
1001254651 5:170174349-170174371 GGATCAAGATGCTGTTTACAGGG - Intergenic
1001677915 5:173533882-173533904 AAATCAGGGTGCTGTCAGCAAGG - Intergenic
1003408781 6:5845183-5845205 AAATCAGGGTTCTATTAACAAGG + Intergenic
1004213889 6:13682953-13682975 AAATCTAGGTGGTGTGTACAAGG + Intronic
1005918713 6:30378871-30378893 AAATTAAGGTGAGGTTAAAAAGG - Intergenic
1008552149 6:52643560-52643582 GAATCATGGTGCTGTGAATAAGG - Intergenic
1008617422 6:53239999-53240021 AAATCCAGGTTCTGGCAACAAGG - Intergenic
1010336512 6:74690918-74690940 AGATCATGGTGGTGTGAACATGG + Intergenic
1010480410 6:76345340-76345362 AAATGATGGTGCAGTGAACATGG + Intergenic
1011241340 6:85274534-85274556 AAAACAATGTGCTGATCACAGGG + Intergenic
1012597883 6:101061400-101061422 AAATGATGATGCTGTTAATATGG + Intergenic
1013096659 6:106951678-106951700 AAATAATGCTGCTGTTAACATGG - Intergenic
1015606630 6:134963156-134963178 AATTCAGGGTGCTGTTAGGAAGG - Exonic
1015666122 6:135631076-135631098 AAAGCAAAGTTCTGTTCACAGGG - Intergenic
1015806203 6:137111442-137111464 AAATCATGCTGCTATGAACATGG - Intergenic
1015916695 6:138224664-138224686 CCAGCAAGGTGCTGTAAACATGG + Intronic
1016073382 6:139768096-139768118 AAAACAAGATGCTGTTACAAAGG - Intergenic
1016169275 6:140989490-140989512 AAATAAATGTGCTTTTAACAAGG - Intergenic
1016172414 6:141035571-141035593 AAATCAAAGTTCAGTTAAAAAGG + Intergenic
1018753650 6:166829686-166829708 GAGTCAAGCTGCTGTGAACATGG - Intronic
1020534430 7:9377346-9377368 AACTCATGGTGCTGCAAACAGGG - Intergenic
1021117159 7:16756911-16756933 AAATCAATGTGCTTTTATGAAGG + Intronic
1021683505 7:23158347-23158369 AAGTCAAGCTGAGGTTAACAGGG + Intronic
1022219245 7:28295878-28295900 AAATAATGGTGCTATGAACATGG - Intergenic
1023307917 7:38850290-38850312 AAATCAAGGGTCTTTTCACATGG + Intronic
1023412283 7:39900152-39900174 AAATCTGGGTGCTGTTAGGAAGG - Intergenic
1023551993 7:41380102-41380124 AAATCATGGTGCTCTTCATAGGG + Intergenic
1025252554 7:57361541-57361563 AAGTCAGGGTTCTGTCAACAAGG - Intergenic
1027147417 7:75705770-75705792 AAATAATGCTGCTGTGAACATGG + Intronic
1027615962 7:80424451-80424473 ACATCAAGGTTCTGGTAAAAAGG + Intronic
1028586250 7:92454850-92454872 ACATCAAGGTGCTGGCAACACGG + Intronic
1030777728 7:113555641-113555663 CAATAAAAGTGCTGTAAACATGG - Intergenic
1031587257 7:123547147-123547169 AAATCAAGATGGTGTTGTCAGGG - Intronic
1031656860 7:124366876-124366898 CAGGCAATGTGCTGTTAACATGG - Intergenic
1035652758 8:1281358-1281380 AAATCAAGGTCATGATGACAGGG - Intergenic
1036038901 8:5052397-5052419 AAATCAAAGTTCTGTTAAAAAGG - Intergenic
1036552064 8:9824673-9824695 AAATCACGCTGCTGTGAACATGG - Intergenic
1037139761 8:15505995-15506017 ACACCAGGGTGCTGTGAACAGGG - Intronic
1037222709 8:16544670-16544692 GAATAAAGCTGCTGTGAACATGG - Intronic
1039010549 8:33088795-33088817 AAATCTAGGTGCTTTTGAGAGGG + Intergenic
1039052942 8:33511527-33511549 AAATAAGGGTGCTGTAACCACGG - Intronic
1040511942 8:48103881-48103903 AAAGCAAGGTGCTGTTCTTAAGG - Intergenic
1041000734 8:53448910-53448932 AAATAATGCTGCTGTGAACATGG - Intergenic
1041509674 8:58642031-58642053 AAAGCAAGGTGCTGTGTTCAGGG + Intronic
1042376622 8:68059690-68059712 AAATCAAGGTGCTGGCCAGACGG + Intronic
1042614778 8:70636044-70636066 GAATAAAGTTGCTGTGAACATGG + Intronic
1042957392 8:74266171-74266193 AAATAATGGTGCTATGAACATGG - Intronic
1043420109 8:80089040-80089062 AGATCAAGGTGCTGGTGGCAGGG - Intronic
1043996904 8:86829103-86829125 AAATCAAGGTGCTGTCAGGTTGG + Intergenic
1044665808 8:94633422-94633444 AAGTCAAGGTGGGGTTGACAAGG - Intergenic
1045030585 8:98131543-98131565 AAATAATGCTGCTGTGAACATGG + Intronic
1045102943 8:98863764-98863786 AAATCAAGGTGTGGTTAATAAGG - Intronic
1045685884 8:104711850-104711872 AATCCAGGGTGCTGTTCACATGG + Intronic
1045742506 8:105377875-105377897 AAATCAAATTGTTGTTAAGAGGG - Intronic
1045774238 8:105783097-105783119 AAATGAAGTTGCTGCTAAGAAGG - Intronic
1047517120 8:125564625-125564647 AAATCAAGATTGTGTTAATAAGG + Intergenic
1048396673 8:134020574-134020596 AAATGAATGTGCTAATAACAGGG - Intergenic
1048878961 8:138857695-138857717 GAATCAATGTTCTGATAACACGG + Intronic
1050086324 9:1969986-1970008 AAATCTGGGTGCTGTTAACAAGG - Intergenic
1050658684 9:7858584-7858606 AAATCAGGGTGCTATTATAAAGG + Intronic
1050803077 9:9640044-9640066 AAATCAAGGTTCAGTTACCAAGG - Intronic
1050969499 9:11851521-11851543 AATTAAAGGTGCTGTTAGTATGG - Intergenic
1051084862 9:13336910-13336932 AAATAAAGGTGCTGTCATCAAGG + Intergenic
1051130545 9:13855608-13855630 AAATCAAGCTGCAATGAACATGG - Intergenic
1051392369 9:16579782-16579804 AACTGAAAATGCTGTTAACAAGG + Intronic
1053021539 9:34698122-34698144 AAATCAAGTTTCTGTTTACAAGG - Intergenic
1055377868 9:75669810-75669832 ATTGCAAGCTGCTGTTAACAAGG + Intergenic
1058159119 9:101548750-101548772 AAATCAAGGTGCTGTAATGTAGG + Intronic
1058939886 9:109803361-109803383 TAATCAAAATGCTGTTAACCAGG + Intronic
1060119516 9:120975108-120975130 CAATAAAGATGCTGTTAGCAGGG + Intronic
1062182639 9:135198840-135198862 AAATCCAAGTGCTGTATACACGG - Intergenic
1186366148 X:8895754-8895776 AGATCAAGGTGTTGTCAGCAGGG - Intergenic
1187112705 X:16317892-16317914 ATATCAAGGTGCTATTTATATGG + Intergenic
1188299856 X:28495343-28495365 TCATCAAGATGGTGTTAACAGGG - Intergenic
1188916846 X:35921806-35921828 AAAACAAGGTGCTGTGGAAAGGG + Intronic
1192058200 X:67794849-67794871 AAATCATGGTTCTGTTTAGAAGG + Intergenic
1196910254 X:120477599-120477621 TAATCAAGGTTCTGTTACTAAGG - Intergenic
1197171643 X:123441443-123441465 AGATCAAGGTGCTCTGGACATGG + Intronic
1197179940 X:123523442-123523464 GAATAATGGTGCTATTAACATGG + Intergenic
1197273464 X:124450680-124450702 AAATCAGAGTTCTGTTAGCAAGG - Intronic
1198640275 X:138748488-138748510 AAATCAAGGTACTGTTAGGTTGG - Intronic
1202038026 Y:20655042-20655064 TAAACAAGGTGCTGTTAATGGGG + Intergenic