ID: 945017325

View in Genome Browser
Species Human (GRCh38)
Location 2:205532976-205532998
Sequence TGTGTTCTGCTTTTGCCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 288
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 264}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945017325 Original CRISPR TGTGTTCTGCTTTTGCCAGG AGG Intronic
900858643 1:5207074-5207096 TGTGTTCTTCTCTTGTCAAGAGG + Intergenic
900905133 1:5551802-5551824 TGTGCTCTGCACGTGCCAGGAGG + Intergenic
902439488 1:16420185-16420207 TGTCTTCTGCTGTTGCGAGGTGG + Intronic
902832296 1:19024233-19024255 TATATTCTGCTTTTGTTAGGTGG - Intergenic
903387779 1:22939794-22939816 TGTGTTCTGCTATTGTTGGGTGG - Intergenic
906585557 1:46974394-46974416 TATGTTCTGTTTTTGTTAGGTGG + Intergenic
906620173 1:47270407-47270429 TGGGTTCTGCTTTTTCAAGAAGG + Intronic
907522070 1:55030435-55030457 GGTGTTCTGATTTAGCCATGTGG - Intergenic
907799777 1:57753086-57753108 TGTGTTCTGCCTGAGTCAGGAGG + Intronic
907973057 1:59403600-59403622 TATGCTGTCCTTTTGCCAGGTGG - Intronic
908326649 1:63029847-63029869 TGTCTCCTGCTTCTGCTAGGAGG - Intergenic
908471543 1:64448890-64448912 TACGTTCTGCTTTGGCCAGCGGG + Intergenic
909671636 1:78195763-78195785 TGTTTTCTGCTGTTGCTGGGTGG + Intergenic
912618847 1:111135057-111135079 TGTGATCTCCCTTTGCCAGGAGG + Intronic
915735128 1:158079629-158079651 TGTTTTTTGTTTTTGCAAGGAGG + Intronic
916980578 1:170131988-170132010 TGTGTTCTGCTTTGGGCACTGGG - Intergenic
920685251 1:208104219-208104241 AGTGTTCTGCCTCTGGCAGGGGG + Intronic
921393343 1:214639822-214639844 TTTGTTTGGATTTTGCCAGGGGG + Intronic
922742381 1:228021329-228021351 TGTGCTCTGCTTTTGGCAAAAGG - Intronic
922990352 1:229903540-229903562 TGTATTCTGCTATTGTCAGAAGG - Intergenic
1062865633 10:850643-850665 TGTGTTTTGCTGTTGCTATGGGG - Intronic
1063864128 10:10345468-10345490 TTTGTTCTCCTTTGGCCAAGTGG - Intergenic
1065508261 10:26451516-26451538 TGCGTTCTGCTTTTGCCATTTGG + Intronic
1068377978 10:56210130-56210152 TGTATTCTGTTTTTGTTAGGTGG + Intergenic
1069398404 10:68015535-68015557 TTTCTTTTGTTTTTGCCAGGTGG + Intronic
1071956461 10:90765985-90766007 TATATTCTGCTGCTGCCAGGTGG + Intronic
1073467919 10:103704977-103704999 TGTGTCCTGCTTGTAGCAGGGGG + Intronic
1075486397 10:122825091-122825113 TGTGTTCTGCTGTTGCTGGATGG + Intergenic
1076977669 11:187394-187416 AGTGTTCTGCTATTGCCCAGAGG + Intronic
1079171476 11:18100222-18100244 TGTGTTCTGCTGTTGCTGGGTGG - Intronic
1080479442 11:32631261-32631283 TGTGTTCTGCTGTTGGTTGGTGG - Intronic
1080479552 11:32632192-32632214 TGTGTTCTGCTGTTGGTTGGTGG + Intronic
1081556453 11:44166922-44166944 TTTTTTCTTCTTTTGGCAGGAGG - Intronic
1084649239 11:70478981-70479003 TGTGATATGCTTTTGCCAAAAGG + Intronic
1085499772 11:77009270-77009292 TTGCTTCTGCTTTTGCCATGTGG - Intronic
1087056433 11:93941098-93941120 TGGTTTCTGCTTTGGCCATGGGG + Intergenic
1088808189 11:113370596-113370618 TGTGGTCTGATTTTGCCCTGGGG + Intronic
1088924186 11:114284143-114284165 GGTTTTCAGCTTTTGCCAGCAGG + Intronic
1089131845 11:116218549-116218571 TGTGTTCTGCTGATGCCTTGTGG - Intergenic
1090870411 11:130740303-130740325 TGTGTTCTGCTATTGCTGGATGG + Intergenic
1090879947 11:130824665-130824687 TGTGATCTGCTTAAACCAGGTGG - Intergenic
1091106809 11:132928645-132928667 TGTTTTCTGCCTTTGCTGGGTGG - Intronic
1092967099 12:13654722-13654744 TGTGTTTTGCTCTTCTCAGGTGG + Intronic
1093796372 12:23317251-23317273 TATGTTCTGCTGTTGTTAGGTGG - Intergenic
1095147207 12:38745189-38745211 AGAGTTCTGCTTTGGCCATGTGG - Intronic
1096616908 12:52838439-52838461 TGTGCTCAGCTTGTGCCTGGGGG - Intronic
1098232746 12:68389767-68389789 TCTGTGCTGCTTTTGCCTGGGGG + Intergenic
1098288375 12:68932511-68932533 TGTTTTCTGCTTTTGTTGGGAGG - Intronic
1098597696 12:72293777-72293799 TGAGTTTTGCTTGTGCCAGCTGG + Intronic
1101467775 12:104965459-104965481 TTTGTTAGGTTTTTGCCAGGAGG + Intergenic
1102741603 12:115212206-115212228 TGTGAACTGCTTTTACCAGTTGG + Intergenic
1103264984 12:119621850-119621872 TGTGTTTTGCTTTGGCTAGCTGG - Intronic
1103457542 12:121077814-121077836 TGTGTCTTGCTATTGCCAGATGG - Intergenic
1103504294 12:121431075-121431097 TGAATTCTGCTTTTGCTAGAAGG - Intronic
1103993521 12:124814787-124814809 TGGGTTCTGAGTTTCCCAGGTGG - Intronic
1105685482 13:22776954-22776976 TGAGTTCTGCTTTTGTGAAGTGG + Intergenic
1106350408 13:28924142-28924164 TGCTTTCTGCTTTTGGGAGGGGG + Intronic
1107048540 13:36021924-36021946 TGTATTCTGCTTTTGTTGGGTGG - Intronic
1107383759 13:39885669-39885691 TGTATTCTGCTGTTGTTAGGTGG - Intergenic
1108356570 13:49633763-49633785 TGGGTTCAGCTTTTGCAGGGTGG + Exonic
1111013966 13:82352200-82352222 TGTATTCTACTGTTGTCAGGTGG + Intergenic
1113357624 13:109597748-109597770 TGTCTTCTGCTTTTAACATGAGG + Intergenic
1113415015 13:110122174-110122196 TGTTTTCTGCTTTTACCAAAAGG - Intergenic
1114057733 14:18988354-18988376 GGTGTTCTGCTTTTCCTTGGTGG - Exonic
1114104814 14:19413399-19413421 GGTGTTCTGCTTTTCCTTGGTGG + Exonic
1115817869 14:37182227-37182249 TGTATTCTGCTGTTGATAGGTGG + Intergenic
1116646531 14:47535994-47536016 TGGGTTCTGCCATTGCCATGAGG - Intronic
1118006780 14:61570359-61570381 TTTGTTGTGGTTTTCCCAGGGGG - Intronic
1118683919 14:68271927-68271949 TTTGTTCTCCTTTCTCCAGGGGG + Intronic
1121292991 14:92792991-92793013 TATGATCTTCTTTTGGCAGGGGG - Intergenic
1122070929 14:99204901-99204923 TGTGTTTTGCTTTGCCCATGTGG - Intronic
1122679644 14:103448291-103448313 TGTAATCTGCTTTGGCCAGTGGG - Intronic
1124552552 15:30695052-30695074 TGTGTTCTTCTGCTGCCGGGTGG - Intronic
1124623041 15:31289460-31289482 TGTGCTCTGCTATTGTCAGATGG + Intergenic
1124634681 15:31357515-31357537 AGTGTTCTGCTCCTGCCTGGGGG + Intronic
1124678689 15:31710614-31710636 TGTGTTCTTCTGCTGCCGGGTGG + Intronic
1125887753 15:43241249-43241271 TGAGCTCTGCTTACGCCAGGAGG + Intronic
1127182798 15:56441348-56441370 TGTGTTCTGCTGTTGTTGGGTGG + Intronic
1128481531 15:68044258-68044280 TGTGTATTGCTTTTGCACGGTGG + Intergenic
1130413560 15:83668968-83668990 TGTGAGCTGCTTTGGCCAGTGGG - Intronic
1131545040 15:93308814-93308836 TCTGTCCTGCCTTTACCAGGAGG - Intergenic
1131740662 15:95387406-95387428 TGTGTTCTGCTGTTTTTAGGTGG - Intergenic
1132066403 15:98734677-98734699 TGTGTTTTAATGTTGCCAGGAGG + Intronic
1133054348 16:3138129-3138151 GGGGTTCTGCCTTTGGCAGGAGG + Intronic
1133973393 16:10582607-10582629 TGTCTTCTACTTTTGGCAGATGG - Intergenic
1135130752 16:19851912-19851934 TGTGTTCTGCTAAGACCAGGAGG + Intronic
1135301933 16:21337116-21337138 TGTGTTCTGTTTTTGTTGGGTGG + Intergenic
1138160517 16:54748920-54748942 TCTGATCTGCTTTTGCCACTTGG - Intergenic
1138197685 16:55063983-55064005 TGTGTTCTGCTGTTGTTGGGTGG - Intergenic
1140317915 16:73917350-73917372 GTTTTTCTTCTTTTGCCAGGAGG + Intergenic
1141296735 16:82776731-82776753 TCAGTTCTGCTTTTCCAAGGTGG - Intronic
1142442659 16:90109931-90109953 AGTGTTCTGCTATTGCCCAGAGG - Intergenic
1142465088 17:131859-131881 AGTGTTCTGCTATTGCCCAGAGG + Intergenic
1143738254 17:8930114-8930136 TGTATTCTGCTGTTGTTAGGTGG - Intronic
1144110084 17:12021884-12021906 TGTGTATGGCTTTTGACAGGGGG + Intronic
1144383901 17:14730789-14730811 CTTGTTCTGCTTTGGCCAGGGGG - Intergenic
1146058161 17:29591354-29591376 CGTGTTCTTTTTTTGCCAGGCGG - Intronic
1146353302 17:32113799-32113821 TGTGATCTGCTCTAGCCTGGGGG + Intergenic
1146711862 17:35048903-35048925 TGTTTTCTGCTCCTGCCAGGAGG + Intronic
1146925858 17:36744340-36744362 TGTATTCTGCTGTTGCTGGGTGG - Intergenic
1148177096 17:45576190-45576212 TGTATTCTGCTCTTGTCGGGTGG - Intergenic
1149344759 17:55723452-55723474 TGTTTACTGCTTTTGCAAGGAGG + Intronic
1151987391 17:77552766-77552788 TGTTTTCTGCTGTTCTCAGGTGG + Intergenic
1152548426 17:81015333-81015355 TGTATTCTGCTGTTGCTGGGTGG - Intergenic
1152747104 17:82046108-82046130 TGTGTTCTGCTGCTGTCGGGAGG + Intergenic
1152916892 17:83043198-83043220 TGTGTTCTGCTGCTGTCAAGTGG - Intronic
1155239054 18:23847942-23847964 TGTGTTCTGTGTGTGCCATGAGG + Intronic
1155705625 18:28807375-28807397 TGTATTCTGCTTTTGAGATGAGG + Intergenic
1156267417 18:35501186-35501208 TGAATTCTGTTTTTGCCATGCGG - Intergenic
1156639890 18:39080395-39080417 TATATTCTGCTTTTGCTGGGTGG - Intergenic
1156907567 18:42372082-42372104 AGTGCTCTACTTTTGCCAGAAGG + Intergenic
1158637990 18:59178194-59178216 CGTTTCCAGCTTTTGCCAGGTGG + Intergenic
1160042884 18:75361243-75361265 TTTATTCTGCTTATGCCTGGAGG - Intergenic
1160410266 18:78670983-78671005 TGTGTTCTCCTCTTGGAAGGCGG + Intergenic
1161621463 19:5299476-5299498 TGGGTGCTGCTTGAGCCAGGTGG - Intronic
1163008931 19:14412824-14412846 GGCGTTCTGCTTTGACCAGGCGG - Intronic
1164675161 19:30095805-30095827 TGTGCTCTGCTGTTCCCTGGAGG - Intergenic
1165679311 19:37760387-37760409 TGTCTTCTGCTTTGGCCATTGGG - Intronic
925214546 2:2083417-2083439 TGTCTTCACCTTTTTCCAGGTGG + Intronic
925638977 2:5969311-5969333 TGTGTTTTGTTTTTTCCAGAGGG + Intergenic
927833686 2:26373565-26373587 TGTGTTATACTTTTCCCAGTGGG - Exonic
928515274 2:32039198-32039220 TGGGATCTGCTTTTACTAGGTGG - Intronic
929840448 2:45456055-45456077 TTTCTTTTGCATTTGCCAGGAGG - Intronic
930205098 2:48579680-48579702 TGTGTTCTGCTGCTGTTAGGTGG + Intronic
930596404 2:53393999-53394021 TGTTTTCTGCTTTTGTTGGGTGG - Intergenic
931756343 2:65377946-65377968 TGTGCTCTGCTTCTGCCTGAAGG - Intronic
932639923 2:73434549-73434571 TGTATTCTGCTGTTGTTAGGTGG + Intronic
932770899 2:74500232-74500254 TGTGTTCTGATTTCGTCAGGTGG - Intronic
933264133 2:80163570-80163592 TGTATTCTGCTATTGCTGGGTGG + Intronic
933589778 2:84219356-84219378 TGTATTCTGCTTTTGTTGGGTGG + Intergenic
934064392 2:88327106-88327128 TGTGTTCTGCAGTTGATAGGTGG - Intergenic
935796624 2:106647943-106647965 TGTGTGCTGCTTCTGCTGGGAGG + Intergenic
935893762 2:107711037-107711059 TGTGTTCTGTTATTGCTGGGTGG - Intergenic
938115380 2:128599657-128599679 TGTGTTCTGGTCTTGTCAAGGGG + Intergenic
938224672 2:129605770-129605792 TGTCTTCTGCTTTTTTCAGCTGG + Intergenic
942437878 2:176001353-176001375 CGTGTTCTGCTTTTCCCAGTTGG - Intronic
943247600 2:185474523-185474545 TGAGTTTTGCTCTTGCCTGGTGG - Intergenic
945017325 2:205532976-205532998 TGTGTTCTGCTTTTGCCAGGAGG + Intronic
945581654 2:211602527-211602549 TGAGTTGTGTTTTGGCCAGGGGG - Intronic
947957050 2:234201179-234201201 TGTGATTTGCTTTGGCCAAGGGG + Intergenic
1168886352 20:1261100-1261122 TCTGTTCTGCATTTGTTAGGTGG + Intronic
1169271921 20:4206925-4206947 TGTCTTCTGTTTTTGCTGGGTGG + Intergenic
1169902569 20:10568543-10568565 TGTGTTCTGCTTTACCAAAGAGG + Intronic
1171358956 20:24573090-24573112 TCTGTTCTGCTTTTGAGAGTGGG + Intronic
1173932458 20:46832236-46832258 TGTGTCCTGGTTCTGCCATGTGG - Intergenic
1175412752 20:58782046-58782068 TGTGTACTTTTTTTGCAAGGTGG + Intergenic
1176089760 20:63313574-63313596 TGTGGTGTGGTTGTGCCAGGGGG + Intronic
1176926510 21:14756519-14756541 TGTATTCTGCTGCTGCAAGGTGG - Intergenic
1177833503 21:26166665-26166687 TGTGTTTTGTTTTTGTCTGGTGG - Intronic
1180476218 22:15710967-15710989 GGTGTTCTGCTTTTCCTTGGTGG - Exonic
1182584282 22:31334882-31334904 TGTGCTTTGCTTTGGCCAGTGGG - Intronic
1182859411 22:33546345-33546367 TTTGTTCCCCTTTTCCCAGGTGG + Intronic
1184490926 22:44808470-44808492 TGTGGGCTGCTTGTGGCAGGAGG + Intronic
1185049936 22:48548707-48548729 TGTGGCCTGCTTTAGCCAGTGGG - Intronic
949390841 3:3560379-3560401 TGTGTTCTGCCATTGCAGGGAGG + Intergenic
949602311 3:5613558-5613580 TTTGTTGTCCTTTTGCCATGTGG + Intergenic
950697124 3:14710801-14710823 TGTGTTCTGCTGTTGTTGGGTGG + Intronic
953069490 3:39505188-39505210 AGTGTTCTGCTTTTGGGAGCTGG + Intronic
953204401 3:40810483-40810505 TGTATTCTGCTGTTGTCAGGTGG + Intergenic
953818124 3:46179298-46179320 TGAATTCTGCTGTTGTCAGGTGG + Intronic
955774067 3:62414980-62415002 TGTGTCCCGCTTTTGCCCAGCGG - Intronic
956296403 3:67719065-67719087 TGTATTCTGCTCTTGTTAGGTGG + Intergenic
956983956 3:74675044-74675066 TATGTTCTGCTTTTAATAGGGGG - Intergenic
957040500 3:75332290-75332312 TGTGTTCTACTGGTGACAGGAGG - Intergenic
958441531 3:94161903-94161925 TGTGATTTGCTTTGGCCAGTGGG + Intergenic
959128524 3:102321265-102321287 TATGTTCTGTTTTTGTTAGGTGG + Intronic
960512491 3:118567866-118567888 TGTATGCTGATTTTGCTAGGAGG + Intergenic
961045284 3:123703852-123703874 TGTGTTCTACTGGTGACAGGAGG - Intronic
961201000 3:125045308-125045330 TCTGAGCTGATTTTGCCAGGAGG - Intronic
961643943 3:128382482-128382504 TGTGGTGTGTTTTTGACAGGGGG + Intronic
962248404 3:133818553-133818575 TGTATTCAGCTTTTGCCACAAGG - Intronic
964141131 3:153400950-153400972 TGTATTCTACTTTTTCCAAGAGG - Intergenic
964409753 3:156385400-156385422 TGTGTTCTGCTTTAGACAAAAGG + Intronic
964551271 3:157887576-157887598 TGTCTTCTGCCTTGGCAAGGTGG - Intergenic
965875511 3:173313468-173313490 TGTATGCTGCTTTGGCCAGTGGG - Intergenic
966423519 3:179757180-179757202 TGTGTGCAGCTTTTCCCAGGTGG + Intronic
967602688 3:191408226-191408248 TGTGTTCTGCTGTTGATGGGTGG + Intergenic
967809962 3:193750129-193750151 TGTATTCTGCTGTTGTTAGGTGG + Intergenic
968362932 3:198160891-198160913 AGTGTTCTGCTATTGCCCAGAGG - Intergenic
969404435 4:6980080-6980102 TGTATTCTGCTTTTGCTGGAGGG - Intronic
971977963 4:33715329-33715351 TGTGTTTTGTTTTTGTCAGATGG + Intergenic
972193021 4:36617511-36617533 TGTATTCTGCTGTTGCTGGGTGG - Intergenic
972321387 4:37976606-37976628 TGTGTTATGCATGTGTCAGGTGG - Intronic
973107141 4:46354149-46354171 TGGCTTCTGCATTTGCCAAGAGG - Intronic
973267152 4:48222020-48222042 TCCATTCTACTTTTGCCAGGAGG + Intronic
977000415 4:91491697-91491719 AGTGTTCTTCTTTGGCCAGTAGG + Intronic
978061664 4:104346142-104346164 TGTGTTCTGCTCATGCCTGCTGG - Intergenic
978458839 4:108927844-108927866 TGGGTTCTGGTTTTGTCAAGTGG - Intronic
979355816 4:119703779-119703801 TGTGTTCTGCTGTTGTTGGGTGG - Intergenic
980401492 4:132291951-132291973 TGCTTTCTGCTTTTTTCAGGTGG + Intergenic
980590780 4:134885196-134885218 TGTGTTTTGTTTTAGCCAGTGGG - Intergenic
983545300 4:168957011-168957033 TACCTACTGCTTTTGCCAGGGGG - Intronic
983773787 4:171581802-171581824 TGGGTTCTGTTTTTCCCATGTGG + Intergenic
984942650 4:184947616-184947638 TGTGTTCTGCTATTGTTGGGTGG + Intergenic
986242475 5:5973336-5973358 TGTGGTCTGCCTTTCCAAGGAGG + Intergenic
986851210 5:11816334-11816356 TGTGTTCTCCTTGTCCCAGCAGG - Intronic
988299455 5:29403779-29403801 ACTGCTCTGCTTTTGCCAAGGGG + Intergenic
988716058 5:33829479-33829501 TGTGTGCTGCTTTGGAAAGGTGG - Intronic
989297591 5:39848035-39848057 AGTGTTCTGCTTTTGCTATGGGG - Intergenic
989396557 5:40963394-40963416 TTTGTTTTGTTTTTGCAAGGTGG + Intronic
992008546 5:72503896-72503918 TGTGTTTTGCTTTTGGAAAGTGG + Intronic
992843631 5:80721870-80721892 AGTGTTCTGCTTTTGTGACGAGG + Intronic
993415959 5:87631332-87631354 AGTTCTCTGCTTTTGCCATGAGG - Intergenic
993974755 5:94465056-94465078 CGTGTGCTGGCTTTGCCAGGGGG - Intronic
995731862 5:115253373-115253395 TATTTTTTGCTTTTGCAAGGTGG - Intronic
1000833772 5:166132207-166132229 TGAGTTCTGCTTTTTTGAGGCGG + Intergenic
1002013060 5:176299802-176299824 TGTGTTCTGCTGTTGTTGGGTGG - Intronic
1003740211 6:8928347-8928369 TGTGTTCTGTTTTTGTAAGAGGG + Intergenic
1004710314 6:18163885-18163907 TGTATTTTGCTATTGTCAGGTGG + Intronic
1005424835 6:25691819-25691841 TGTGTTCTGGTTGGGCCAGATGG + Intronic
1007267535 6:40608521-40608543 TCTGGTCTGATTTTTCCAGGAGG - Intergenic
1007512138 6:42381761-42381783 TGGGCTCTGCTTCTCCCAGGAGG - Intronic
1008070040 6:47090263-47090285 TGTTTTCAGCTTTTGGCATGAGG - Intergenic
1009911348 6:69932957-69932979 TGTGTTCTGTTGAAGCCAGGTGG + Intronic
1011197874 6:84800930-84800952 GTTGTTCTGCTTTTGTCAGGTGG + Intergenic
1012988691 6:105902493-105902515 TTTGTTGGGCTTTTGGCAGGAGG - Intergenic
1013240891 6:108244669-108244691 TTTGCTCTGTTGTTGCCAGGCGG + Intronic
1019252750 7:27820-27842 AGTGTTCTGCTATTGCCCAGAGG + Intergenic
1019998689 7:4742155-4742177 TGTGATCTGCTTTTTCCACTGGG - Intronic
1020763793 7:12296620-12296642 TCAGTGCTGCTTTTGCCAGCTGG - Intergenic
1020959124 7:14780129-14780151 TCTGCCCTGCTTTTGCCAGCTGG + Intronic
1022600423 7:31753306-31753328 TGTGTCCTGCTGTGGCCAGTGGG + Exonic
1022958246 7:35401168-35401190 TGTGGTCTGTTTTTGCCATCTGG + Intergenic
1023168378 7:37365479-37365501 TCTCTTCTGCTTTTTCCAGCGGG - Intronic
1023886711 7:44362276-44362298 TGTATTCTGCTCTTGTTAGGTGG - Intergenic
1026501465 7:70946547-70946569 TCTGTTCATCTTTTGGCAGGGGG + Intergenic
1028566339 7:92235643-92235665 TGTTTTTTTATTTTGCCAGGTGG - Exonic
1028778858 7:94712335-94712357 TGATTTCTGCATTTTCCAGGGGG + Intergenic
1030310431 7:108063641-108063663 TGGGTGCTGCTTTTGCCTGCTGG + Intronic
1031827050 7:126578476-126578498 TGAGCTGTGCATTTGCCAGGTGG + Intronic
1034149639 7:148904281-148904303 GTTGTTCTGCTTTTTCCAGTTGG + Intergenic
1034886112 7:154800326-154800348 TGAGTTTTGCTTGTGCCAGCTGG + Intronic
1036427607 8:8660308-8660330 TGTGTTTTGCTGTTGCTAGGTGG - Intergenic
1036935318 8:12996593-12996615 TGTGTTCTGCCATTCCCATGAGG - Intronic
1037320772 8:17640741-17640763 TGTGTTGGTCTTCTGCCAGGAGG + Intronic
1038476265 8:27870655-27870677 CGTGTTCTGCTTTTTACATGAGG - Exonic
1038604018 8:28980052-28980074 TGTCTTCTGTTTTTGTTAGGAGG + Exonic
1039348684 8:36736395-36736417 TGTATTCTGCTGTTGCTGGGTGG + Intergenic
1040627686 8:49169923-49169945 TGTATTCTGCTGTTGCTAGGTGG + Intergenic
1040654689 8:49493014-49493036 TGTGTTCTACATCTGCCAGATGG + Intergenic
1042889293 8:73589467-73589489 TGTTATCTGCTTTTTCCAGTTGG - Intronic
1043106442 8:76118432-76118454 TGTCTTTTGCTTGTGCCAGTTGG + Intergenic
1043115743 8:76251911-76251933 GGTTTTCTGCTCTTTCCAGGTGG - Intergenic
1043170110 8:76955248-76955270 AAAGATCTGCTTTTGCCAGGAGG - Intergenic
1045466365 8:102474121-102474143 TGTATTCTGCTGTTGTTAGGTGG - Intergenic
1045817976 8:106299537-106299559 TGTGTACTTTTTTTTCCAGGTGG + Intronic
1047190886 8:122678104-122678126 TGTGTTCTGTCTTTGGCAGCTGG - Intergenic
1047359515 8:124154852-124154874 TGTATTCTGCTGTTGTCAGTTGG - Intergenic
1047432177 8:124802252-124802274 TTTGGGCTGCTTTTGCCAGAAGG - Intergenic
1048306490 8:133288420-133288442 TGTGATCTCCTTCTGCCAGCAGG + Intronic
1048463836 8:134645811-134645833 TGTATTCTGCTGTTGCTGGGTGG - Intronic
1048931291 8:139317368-139317390 TGTGTTCTGTTTTTGCCCTCTGG - Intergenic
1050292152 9:4166110-4166132 TGTTTTCTGCATTTGCCAGAGGG - Intronic
1051249564 9:15145748-15145770 TTTGTTCTGCCTTTGTCAGTGGG - Intergenic
1052204382 9:25821186-25821208 TGGTTTCTGCTATTGGCAGGTGG + Intergenic
1052282008 9:26743718-26743740 GGTTTTCTCATTTTGCCAGGTGG - Intergenic
1054839618 9:69722620-69722642 TGTGTTGAGCTTTTTCTAGGGGG + Intronic
1057317258 9:93977647-93977669 TGTGTGTTGCTTTGGCCAGTGGG + Intergenic
1057577386 9:96254286-96254308 TGTGCTCTGCTGTTGGCAGGAGG - Intronic
1057892569 9:98880489-98880511 TGTGTTCTGCCTGGGCCAGTTGG + Intergenic
1058358902 9:104118516-104118538 TTTGTTTTACTTTTGACAGGAGG - Intronic
1059754774 9:117282331-117282353 TGCATTGTGCTTTGGCCAGGAGG + Intronic
1059837661 9:118174671-118174693 TGTGATTTGCTTTAGCCAGTAGG - Intergenic
1060358579 9:122933040-122933062 TGTATTCTGCTCTTGCTGGGTGG + Intergenic
1060671457 9:125473448-125473470 TGTTTTCTGCCTTTGACAGTTGG - Intronic
1060780145 9:126405737-126405759 TGGGTTCAGTTTTTGCCAGTGGG + Intronic
1061818889 9:133212351-133212373 TGTGTAGTGCTGTTGCCAGGTGG - Intergenic
1061827568 9:133270146-133270168 TGACTTCGGCTCTTGCCAGGTGG - Intronic
1061871098 9:133521052-133521074 TGTGTTCAGCTTCTGCAAGGGGG - Intronic
1062747619 9:138224554-138224576 AGTGTTCTGCTATTGCCCAGAGG - Intergenic
1187609502 X:20926653-20926675 TGTGTCCTGCTTCTACCAGGTGG + Intergenic
1188018633 X:25133235-25133257 TGTATTCTGCTGTTGCTGGGTGG + Intergenic
1188112215 X:26206219-26206241 TGGGTTCTGCTTGTTTCAGGTGG + Intergenic
1188233873 X:27701402-27701424 TGTATTCTGCTTTTGTTGGGTGG - Intronic
1188607509 X:32050324-32050346 AGTGTTGTGCTTATGCCAAGTGG + Intronic
1190417325 X:50192862-50192884 TTGGTTCTCCTTTTGACAGGTGG + Exonic
1191167870 X:57410327-57410349 TGTGTTCTGCTGCTGCTAGATGG + Intronic
1193408729 X:81137258-81137280 TGTGTTCTGCTGTTCTCATGTGG - Intronic
1195548074 X:106136107-106136129 TGTATTCTGCTATTGCTGGGTGG - Intergenic
1195739991 X:108054497-108054519 TGTGTTCTGCTGTTGTTGGGTGG - Intronic
1196182657 X:112710780-112710802 TGTGTTCAGCTATTGTCAGGTGG + Intergenic
1196941766 X:120784132-120784154 TGTTTTCTGCATTTGTAAGGTGG + Intergenic
1197679150 X:129363759-129363781 TGTATTCTGCCCTAGCCAGGTGG - Intergenic
1197902156 X:131385099-131385121 TGTATTCTGCTGTTGTTAGGTGG - Intronic
1198274419 X:135087820-135087842 GGCCTTCTGATTTTGCCAGGTGG + Intergenic
1199964716 X:152810478-152810500 GGTGATCTGCTGCTGCCAGGGGG - Intergenic
1200369359 X:155706038-155706060 TGTATTCTGCTTTTGTTGGGTGG - Intergenic
1201385087 Y:13431414-13431436 TGTGTTCTGATTTTGATAGCAGG - Intronic