ID: 945017870

View in Genome Browser
Species Human (GRCh38)
Location 2:205538705-205538727
Sequence TGTAAGCCAGATCTGCTCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 137}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945017866_945017870 19 Left 945017866 2:205538663-205538685 CCGTTTTCGGAATAGTATCGGTG 0: 1
1: 0
2: 0
3: 1
4: 30
Right 945017870 2:205538705-205538727 TGTAAGCCAGATCTGCTCAGGGG 0: 1
1: 0
2: 0
3: 11
4: 137
945017863_945017870 26 Left 945017863 2:205538656-205538678 CCCAATACCGTTTTCGGAATAGT 0: 1
1: 0
2: 0
3: 4
4: 53
Right 945017870 2:205538705-205538727 TGTAAGCCAGATCTGCTCAGGGG 0: 1
1: 0
2: 0
3: 11
4: 137
945017864_945017870 25 Left 945017864 2:205538657-205538679 CCAATACCGTTTTCGGAATAGTA 0: 1
1: 0
2: 0
3: 3
4: 73
Right 945017870 2:205538705-205538727 TGTAAGCCAGATCTGCTCAGGGG 0: 1
1: 0
2: 0
3: 11
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945017870 Original CRISPR TGTAAGCCAGATCTGCTCAG GGG Intronic
901559479 1:10058831-10058853 TGGGAGCCACATCTGGTCAGTGG - Intronic
901825866 1:11860506-11860528 TTTAGGCAAGATCTGCTTAGAGG - Intergenic
902576320 1:17380025-17380047 TATAAGCCAAATCTGCCCACAGG + Intronic
908814379 1:68016562-68016584 TTGAAGCCAGATTTGCTCAGTGG - Intergenic
911054411 1:93698060-93698082 TGAAAGCCAGCTCTGCTCACAGG + Intronic
911570339 1:99511398-99511420 TGTAAGCCAGACCAGCTGTGAGG - Intergenic
916617251 1:166454754-166454776 TGTAAACCAGAGCAGCCCAGTGG - Intergenic
920435900 1:205946988-205947010 TCTTAGCAAGATCAGCTCAGAGG - Intergenic
923289266 1:232528665-232528687 TGTAAGCCAGGTCTGTGCATGGG - Intronic
923562529 1:235052116-235052138 TGTAGGCCAAATCTGGCCAGTGG - Intergenic
1062793925 10:328027-328049 TGGAACCCAGAGCTGCTAAGGGG + Intronic
1065294265 10:24259640-24259662 TGAAAGCGAGTCCTGCTCAGGGG + Intronic
1068150221 10:53121913-53121935 TGTAATCTAGATCAGCTCGGTGG - Intergenic
1072040117 10:91598876-91598898 AGTAAGGCAGATCAACTCAGTGG + Intergenic
1074097291 10:110325312-110325334 TGCAAGCCAGAGTTGTTCAGGGG - Intergenic
1076004242 10:126935388-126935410 TGCAAGCCAGAACTCCTCTGGGG - Intronic
1076062748 10:127426556-127426578 GATAAGCCAGATGTGGTCAGGGG + Intronic
1076712741 10:132347621-132347643 TCAAAGTCAGATGTGCTCAGTGG + Intronic
1078708463 11:13767563-13767585 TGTAATCCTGATCTACACAGAGG - Intergenic
1079091325 11:17482299-17482321 TTTAGGCAAGCTCTGCTCAGGGG - Intergenic
1084045610 11:66566208-66566230 TCTAAGCCAGACCTGACCAGAGG + Intronic
1085279887 11:75323173-75323195 CCTAAGCCAGAACTGCCCAGCGG + Intronic
1088536043 11:110862542-110862564 TGTGGGCCAAATCTGCCCAGTGG - Intergenic
1090873539 11:130769061-130769083 TGTAAGCCAGAGGGCCTCAGAGG - Intergenic
1091957358 12:4657992-4658014 TGTCAGCTACATCTCCTCAGGGG - Intronic
1092002103 12:5041500-5041522 TGTAACCCTGCTGTGCTCAGAGG + Intergenic
1092945038 12:13445243-13445265 TGTAAGACATATCTGATAAGAGG - Intergenic
1093142515 12:15525685-15525707 TGTGACCCAGCTCTGATCAGTGG - Intronic
1093568777 12:20641284-20641306 TGTCAGCCAGATGTTCCCAGGGG - Intronic
1093950200 12:25156899-25156921 TGAAAACAAGATCTGTTCAGAGG + Intronic
1096647353 12:53046138-53046160 TGTAAGGAAGACCTTCTCAGAGG + Intergenic
1098813807 12:75130864-75130886 TGTAATCCATATCAGCTCACTGG + Intronic
1099366982 12:81778579-81778601 TCTTAGCCAGATTTGCTCATGGG - Intergenic
1100185465 12:92134293-92134315 TTAAAGCCAGATTTGGTCAGTGG - Intronic
1101130064 12:101680119-101680141 AGAAAGCCAGATGTGTTCAGAGG - Intronic
1101595228 12:106158773-106158795 TGTATACCAGATCTGGTCAGAGG - Intergenic
1109506853 13:63312719-63312741 TCTGAGCCATATCTGCTTAGGGG - Intergenic
1110165767 13:72441289-72441311 TGTAAGGCAGAACTTTTCAGTGG - Intergenic
1113498752 13:110756355-110756377 TGTTAGGCAGAGCTGCTGAGAGG - Intergenic
1115037657 14:28879612-28879634 TGCAAGCCAGGTCTGCTCAAAGG - Intergenic
1115903731 14:38183936-38183958 TGTAAGCTAGATCTCTTGAGGGG + Intergenic
1115934518 14:38536707-38536729 AGGAAGCAAGATCTGCTAAGTGG - Intergenic
1120213311 14:81655742-81655764 TGTAAGCCACCTCTGAGCAGAGG - Intergenic
1122548924 14:102539602-102539624 TGTTCCCCAGAGCTGCTCAGGGG - Intergenic
1127310810 15:57750698-57750720 TGTGACTCAGATCTTCTCAGAGG + Intronic
1129292889 15:74582063-74582085 TGCCAGGCAGATCTGCCCAGTGG + Intronic
1132473288 16:118934-118956 GGGAAGCCACATCTGCCCAGGGG + Intronic
1141693175 16:85607754-85607776 TTTAACCCAGATCTGCTGATTGG - Intergenic
1144067968 17:11641413-11641435 TGTGAGGCAGGTCTGCCCAGCGG + Intronic
1145080739 17:19892417-19892439 TGTAAGCCAGATCGGGTGTGAGG + Intergenic
1146429156 17:32774093-32774115 TGTAAGCCAGATCGGGTGTGAGG - Intronic
1148730641 17:49833918-49833940 TGGAAGCCAGATGTGCCTAGAGG + Exonic
1149253921 17:54802505-54802527 TGTAAGCCATACATGCTCAGTGG - Intergenic
1149321510 17:55486494-55486516 CGTCAGCCAGTTCTGATCAGAGG - Intergenic
1150860557 17:68796571-68796593 TGTAAGCCAGACCTGGTATGAGG + Intergenic
1152044548 17:77927465-77927487 GGTGAGCCAGGGCTGCTCAGGGG + Intergenic
1152684779 17:81688595-81688617 TGTCAGCCCCATCTGCTCAGAGG + Intronic
1154122451 18:11662999-11663021 TGGAGGCCAGCTCTTCTCAGAGG + Intergenic
1161747331 19:6068990-6069012 AGTCAGCCAGATCTGCTGACGGG + Intronic
1164527910 19:29025468-29025490 AGTAAGACATCTCTGCTCAGGGG - Intergenic
1164961626 19:32436004-32436026 TGTAAGCCATAGCTGAGCAGAGG - Intronic
1165008868 19:32828710-32828732 TGTGATCCAGACCTGCTCACAGG - Intronic
1167590750 19:50403081-50403103 TGTCATCCAGATCTGCTCGCTGG + Exonic
925068522 2:949579-949601 CGAAACCCAGGTCTGCTCAGGGG + Intergenic
926802706 2:16673824-16673846 TGTAATTCAGATCAACTCAGCGG - Intergenic
927286970 2:21367084-21367106 TGTATACCAGATCTGCTGTGAGG + Intergenic
927601938 2:24450746-24450768 TGTAAGACAGTTTAGCTCAGTGG + Intergenic
928110188 2:28501217-28501239 TGTAACCCAGATTTGCACTGTGG - Intronic
931130772 2:59333026-59333048 TGGAAGCCTGACCTTCTCAGTGG + Intergenic
931441656 2:62294348-62294370 CGTTAGCCCTATCTGCTCAGAGG - Intergenic
933572999 2:84035752-84035774 TGTCAGTCTCATCTGCTCAGAGG - Intergenic
935206616 2:100901823-100901845 TGTAAGTCAGCACTCCTCAGAGG + Intronic
939464089 2:142534878-142534900 TGTAAGGTAGAGATGCTCAGAGG - Intergenic
941428747 2:165385380-165385402 TGTAAACCAGTTCTGATCATTGG - Intronic
944403251 2:199352899-199352921 TGAAAACCAGATCTGCCCATAGG + Intronic
945017870 2:205538705-205538727 TGTAAGCCAGATCTGCTCAGGGG + Intronic
946162980 2:217847408-217847430 TGAAAGCAACATCTGCTTAGGGG + Intronic
946225054 2:218260032-218260054 TCTAAGACAGATCTGCTGAGAGG - Intronic
946629551 2:221652138-221652160 TGTAAGCCCGATTTTCTGAGAGG - Intergenic
948291073 2:236825195-236825217 TGTAAACCACATCTGATCACTGG - Intergenic
1170553026 20:17493443-17493465 TGTCTGCCAGAGCTCCTCAGTGG + Intergenic
1170700482 20:18699014-18699036 AGTAACCCAGCTCTGCCCAGAGG - Intronic
1171005605 20:21462648-21462670 TGGAAGCCAGAGGTGCACAGGGG + Intergenic
1176200734 20:63859140-63859162 TCCAAGCAGGATCTGCTCAGGGG + Intergenic
1179012232 21:37564658-37564680 TGGAAGCCGGGGCTGCTCAGTGG + Intergenic
1182097771 22:27637603-27637625 CAGATGCCAGATCTGCTCAGAGG - Intergenic
1182517579 22:30867808-30867830 TGTAAGCAAGAGCTGGTGAGAGG - Intronic
950109011 3:10406797-10406819 TGTAAGACAGGGCTGGTCAGTGG - Intronic
950181960 3:10919665-10919687 TGTACGCCTGATTTCCTCAGGGG - Intronic
952583373 3:34862366-34862388 TGTAAGGCAGGACTGCTCTGTGG + Intergenic
953401054 3:42617663-42617685 TGTAAGCCACAGCTTCTCATTGG - Intronic
953531190 3:43741108-43741130 TGTGAGCCAGTCATGCTCAGAGG + Intergenic
955075634 3:55610429-55610451 TTTAAGTCAGTTCTCCTCAGGGG - Intronic
955823888 3:62924618-62924640 TGTCAGTCAGAGCTGCCCAGGGG - Intergenic
959487172 3:106940298-106940320 TTTAAGCCTTTTCTGCTCAGTGG - Intergenic
961018644 3:123486009-123486031 TGTGGGCCAGATATGCTCTGGGG + Intergenic
961438033 3:126932748-126932770 TGTCAGCCCGATCTGGTCACTGG - Intronic
961473759 3:127134565-127134587 GGGCAGCCAGATCTTCTCAGGGG + Intergenic
962404803 3:135091818-135091840 GGTCAGCCAGGTCTGCTGAGTGG - Intronic
962413292 3:135160495-135160517 AGTACCCCAGATCTGCACAGGGG + Intronic
963472576 3:145760822-145760844 TGTATGGCAAATATGCTCAGTGG + Intergenic
964185639 3:153939544-153939566 TGTAAGCCATATCTGATACGTGG + Intergenic
965262721 3:166504760-166504782 TGTAAGCCAGACCTGGTGTGAGG + Intergenic
965825679 3:172727196-172727218 TGTAAGACAGCTCTGTTCAAGGG + Intergenic
965850185 3:173013723-173013745 TGTAACTCAGGCCTGCTCAGAGG + Intronic
967450925 3:189621989-189622011 TGTAAACAAGACCTACTCAGGGG + Intergenic
969571113 4:8009021-8009043 TCTCAGCCAGATCTGCTCCCTGG + Intronic
970028673 4:11653037-11653059 TGGAAGACATATCTGCTCTGTGG - Intergenic
975347493 4:73309926-73309948 TGTGGGCCAGATCTGGTCTGAGG - Intergenic
982476783 4:155862591-155862613 TGTACACCAAATCTGCTAAGAGG - Intronic
985475420 5:76297-76319 TGAAAGCCAACTCTGCTGAGAGG + Intergenic
997438582 5:133892647-133892669 TACCAGCCAGATCTGCTCAGAGG - Intergenic
1002387262 5:178877554-178877576 TGGAAGCCACATCAGGTCAGTGG + Intronic
1007073886 6:39054628-39054650 TGGAAGCCAGTTCTTCCCAGAGG - Intronic
1012030220 6:94050759-94050781 TGAAAGCCAGAAGTCCTCAGGGG - Intergenic
1013365211 6:109432419-109432441 AATAAACCAGATCTCCTCAGAGG - Intronic
1013578571 6:111509674-111509696 TGAAAACAAGACCTGCTCAGAGG + Intergenic
1014102763 6:117530103-117530125 TGAAAACCAGATCAGTTCAGTGG - Intronic
1015147762 6:130006318-130006340 TGTCAGCCAGGTCTCCTCAGAGG - Intergenic
1016502599 6:144738444-144738466 TAAAAGTCAGATCTGCACAGGGG + Intronic
1017729547 6:157303023-157303045 AGAAAGCCAGTTCTGCTTAGGGG - Intronic
1022191289 7:28018998-28019020 TGTAACCTGGAGCTGCTCAGAGG - Intronic
1022372807 7:29786610-29786632 TGTAAGCCAGACCTGGTGTGAGG - Intergenic
1031018590 7:116602166-116602188 TGCTACCCAGATCTTCTCAGAGG + Intergenic
1032731218 7:134645124-134645146 TGTAAGACAAATGTGCACAGAGG - Intergenic
1040798074 8:51309050-51309072 TGTTAGCCAGAACTATTCAGAGG - Intergenic
1040952105 8:52947777-52947799 TGAAAGCCAGTTGTGTTCAGGGG + Intergenic
1046367008 8:113247249-113247271 CCTGAGCCAGAACTGCTCAGTGG - Intronic
1046367073 8:113248639-113248661 TCTGACCCAGAACTGCTCAGTGG - Intronic
1046681016 8:117170025-117170047 TGCAAAGCAGAGCTGCTCAGTGG + Intronic
1048267885 8:133003806-133003828 TGCAAACCAGAGCTGCTGAGGGG - Intronic
1057831540 9:98410734-98410756 TGTATTCCAAATCTGCTCTGTGG + Intronic
1057831583 9:98411079-98411101 TGTATTCCAAATCTGCTCTGTGG - Intronic
1059402064 9:114076783-114076805 TGTCAGCCAGGTCTGCTTTGAGG - Intronic
1060089699 9:120732119-120732141 TCTAAGCCAGATGACCTCAGGGG + Intergenic
1061147104 9:128806438-128806460 TCCAAACCAGATCTGCTCAGGGG - Intronic
1061479633 9:130890895-130890917 AGTGAGCCAGCACTGCTCAGGGG + Intergenic
1185701384 X:2233196-2233218 TGTCAGCCACAGCTGCACAGCGG - Intronic
1186090019 X:6036759-6036781 TTAAAGCCAGTTCTGCACAGAGG - Intronic
1187665912 X:21609248-21609270 TGTAAGCCTGAACTTGTCAGTGG - Exonic
1188563447 X:31496914-31496936 TGGAAGCCAGTTCTGACCAGTGG - Exonic
1188954771 X:36420954-36420976 TGTAATCCAAATCTGCCCACAGG - Intergenic
1189228312 X:39432148-39432170 TGAAAGCCAGATAAGCCCAGAGG - Intergenic
1189890155 X:45592319-45592341 TGTAAGCCAGTTCTAGCCAGAGG - Intergenic
1192826595 X:74703911-74703933 TGTAAGCCATATCTGCATAGGGG + Intergenic
1196072516 X:111542236-111542258 TTATAGCTAGATCTGCTCAGTGG + Intergenic
1196330757 X:114468523-114468545 TGTAAGCCAGACCTGGTGTGAGG - Intergenic
1196806286 X:119589789-119589811 TGTAAGCCTCCTCTGCTGAGCGG + Exonic
1198318420 X:135493652-135493674 GGTAAGCAAGATATCCTCAGGGG - Intergenic