ID: 945022061

View in Genome Browser
Species Human (GRCh38)
Location 2:205583830-205583852
Sequence CAGTAGAACTGGAGGTGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 342
Summary {0: 1, 1: 0, 2: 0, 3: 31, 4: 310}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945022061 Original CRISPR CAGTAGAACTGGAGGTGAGG TGG (reversed) Intronic
902651615 1:17841232-17841254 CAGAGGAGCTGCAGGTGAGGGGG - Intergenic
902990541 1:20184644-20184666 CATTAGAACTGGAGGGAGGGAGG + Intergenic
903768680 1:25750509-25750531 CAGCAGCAGTGGAGGTGAAGAGG - Intronic
904755148 1:32764868-32764890 CAGTAAAAAAGGAGGTGAGGTGG - Intronic
905312927 1:37063091-37063113 CAGTGACACTGGAGGTGAGAGGG - Intergenic
905371690 1:37485893-37485915 CAGTGGAGCAGGAGGTGATGGGG - Intergenic
905776012 1:40667582-40667604 CAGAAGGACTGGATGGGAGGTGG + Intergenic
905979634 1:42211882-42211904 CTGGAGTACTGGGGGTGAGGAGG + Intronic
906572783 1:46858694-46858716 CAGCAGAACTGGGGGGCAGGAGG + Intergenic
906598986 1:47107194-47107216 CAGCAGAACTGGGGGGCAGGAGG - Intronic
906866093 1:49421891-49421913 CGATAGAACTGGAGGTGGAGTGG - Intronic
909069717 1:70980083-70980105 AAGAAGAACTGGAAGGGAGGCGG + Intronic
910089479 1:83445405-83445427 CAGTAAAAATGGAGAGGAGGAGG + Intergenic
910710654 1:90176425-90176447 CAGCCCAACTGGAGGAGAGGTGG - Intergenic
910728025 1:90359327-90359349 CAGCTGAAAAGGAGGTGAGGTGG + Intergenic
912036495 1:105323851-105323873 CTGTGGAACTGGAGGTGCAGTGG + Intergenic
912480036 1:109976189-109976211 AGGTAGAGCTGGGGGTGAGGGGG + Intergenic
912503014 1:110134975-110134997 CAGGAAAATTCGAGGTGAGGTGG + Intergenic
913391503 1:118318097-118318119 CAGGAGCTCTGGAGGTGTGGAGG + Intergenic
913572806 1:120138314-120138336 GTGTAGAACTGGGGCTGAGGTGG + Intergenic
914294073 1:146303102-146303124 GTGTAGAACTGGGGCTGAGGTGG + Intergenic
914314971 1:146501264-146501286 TAGTAGAGATGGGGGTGAGGTGG + Intergenic
914499383 1:148232115-148232137 TAGTAGAGATGGGGGTGAGGTGG - Intergenic
914555117 1:148753885-148753907 GTGTAGAACTGGGGCTGAGGTGG + Intergenic
915029795 1:152868299-152868321 CAGTAGGAATGGAGGTGGTGAGG - Intergenic
915037747 1:152942868-152942890 CAGTGGAACTCAGGGTGAGGTGG - Intergenic
915119993 1:153623981-153624003 CCTTAGAACCTGAGGTGAGGAGG + Intronic
915604970 1:156944756-156944778 GGGTAGAACTGGAGGTAAGGTGG - Intronic
916399293 1:164428757-164428779 CAGTAGGGCTGCAGGTTAGGAGG - Intergenic
917661126 1:177178115-177178137 CAGTAGCACGAGGGGTGAGGAGG - Intronic
917929001 1:179811092-179811114 CGGAAGAAAGGGAGGTGAGGAGG + Intronic
918439808 1:184555703-184555725 GAGGAGGACTGGAGGTGGGGTGG + Intronic
918441975 1:184576717-184576739 CATGAGAACTGGAGGTAGGGAGG - Intronic
919213730 1:194523040-194523062 CAGTAGAACTGGGAGTCAGGGGG + Intergenic
919450758 1:197770993-197771015 CAGTTGAACTGGGGTTGTGGAGG - Intronic
919838766 1:201594333-201594355 CAGGAGAAAGGGAGGGGAGGAGG + Intergenic
919880639 1:201898441-201898463 CAGTAGGGAGGGAGGTGAGGTGG - Intronic
921668510 1:217901217-217901239 CAGAAGGACTGGAAGTGGGGAGG + Intergenic
922874249 1:228927442-228927464 CAGCAGACCAGGAGGTGGGGTGG - Intergenic
924753045 1:246914888-246914910 CAGTAGAAATGGAGAAGATGGGG - Intronic
1068189655 10:53634895-53634917 AAATAGAATTGGAGGGGAGGGGG - Intergenic
1068877195 10:62009593-62009615 CAGTAGACCTGGGGGTGTGTGGG - Intronic
1070163708 10:73881929-73881951 CAGGAGAAATGGAGGGGAGGGGG + Intergenic
1070593481 10:77816855-77816877 CAGTAGGCCTGGTGGTGTGGGGG - Intronic
1070796721 10:79221204-79221226 CAGGAGAGCTGGCGGTGAGCCGG + Intronic
1070809977 10:79292850-79292872 ATGCAGAACAGGAGGTGAGGAGG + Intronic
1071508974 10:86249586-86249608 GGGTAGAAATGGAGGTGAGTCGG - Intronic
1072753575 10:98001870-98001892 CAGTAGGACTGGAGAAGAGAAGG + Intronic
1072899091 10:99391677-99391699 GAGTCGAACTGGAGGTAACGAGG - Exonic
1073092167 10:100951399-100951421 CAGTAGAAATGGCAGTCAGGTGG + Intronic
1073250347 10:102117401-102117423 CCTTAGAATTGGTGGTGAGGTGG + Intronic
1073940741 10:108694629-108694651 CAACAGACCTGCAGGTGAGGGGG + Intergenic
1074020627 10:109578994-109579016 CAGGAGAAGTGACGGTGAGGAGG + Intergenic
1075045041 10:119139970-119139992 TAGCAGAACGGGAGGTGGGGTGG + Intergenic
1075084067 10:119402390-119402412 CTGTAGAACTGGAGGGTAGAAGG - Intronic
1075180513 10:120206936-120206958 CAGTGGAGCTGGAGGGAAGGAGG - Intergenic
1075551059 10:123392536-123392558 CAGTAGGAGTGGTGGTGGGGTGG + Intergenic
1075700593 10:124467195-124467217 CAGTAGGGCAGGAGGTGGGGGGG + Intronic
1076002993 10:126927274-126927296 GACCAGAACTGGAGGTGAGCAGG + Intronic
1076175167 10:128362723-128362745 CAGTAGATCTGGAGCAGATGGGG + Intergenic
1077076350 11:704154-704176 CAGGAGAACTGGAGATGGGGTGG - Intronic
1077181832 11:1220360-1220382 CACTCGAGCTGGGGGTGAGGGGG + Intergenic
1077636063 11:3841618-3841640 CAGCAGAACAGGGGGCGAGGGGG - Intergenic
1081573938 11:44308024-44308046 CATTCCAACTGGAGGTGAAGAGG + Intronic
1082006903 11:47424420-47424442 CAGGAGACCTGGTGGTGAGTGGG - Exonic
1083536952 11:63478248-63478270 CCGCAGAGCTGGAGGTGAAGGGG + Intronic
1084531615 11:69731016-69731038 CAGGACAGGTGGAGGTGAGGCGG - Intergenic
1084610862 11:70202281-70202303 CCGTGGGTCTGGAGGTGAGGAGG - Intergenic
1084674466 11:70626010-70626032 CAGCGGAACTGGAGGCGGGGAGG - Intronic
1086250746 11:84811203-84811225 AAGAAGTACAGGAGGTGAGGTGG - Intronic
1086331763 11:85761454-85761476 CAGGAGAGCAGGAGGAGAGGAGG + Intronic
1086596594 11:88579464-88579486 AGGTAGAACTGGATATGAGGGGG + Intronic
1088549854 11:111001666-111001688 CAGTAGAGCTGGAGAAGAGAAGG + Intergenic
1088615656 11:111625062-111625084 CAGTAGAAGAGGAGGTCAGAGGG + Intronic
1090801436 11:130175036-130175058 TAGGAGAACTGCAGGTTAGGTGG + Intronic
1093081822 12:14821445-14821467 AAGCAGAAATGGAGGTGATGTGG - Intronic
1093953731 12:25193568-25193590 CAGTAGATTTGGAGTTGAGTGGG + Intronic
1094009247 12:25789335-25789357 GAGTAGAACTGAAGGTCAGGAGG + Intergenic
1095956294 12:47808324-47808346 CAGCAGAAGTGGAGGTGGGGTGG - Intronic
1100494467 12:95111575-95111597 AAGTAGGACTGGAGATGAGTGGG - Intronic
1101728923 12:107410609-107410631 CAGTAGCAGTGGAGATGGGGAGG + Intronic
1102515123 12:113441252-113441274 CAGAACACCTGGAGCTGAGGTGG - Intergenic
1104573552 12:129946094-129946116 CAACAGAACTGGAGGAGATGAGG - Intergenic
1105244802 13:18639794-18639816 CACTAAGACTGGAAGTGAGGGGG + Intergenic
1105621070 13:22066773-22066795 AAGAAAAAATGGAGGTGAGGAGG - Intergenic
1109251891 13:60030005-60030027 CAGTAGTACTGAACATGAGGTGG - Intronic
1109311708 13:60702607-60702629 CAGAAGTAATGGGGGTGAGGTGG - Intergenic
1109843124 13:67947509-67947531 AAGAAGAACTGGGAGTGAGGAGG - Intergenic
1110159765 13:72361449-72361471 CACTAGAAGTACAGGTGAGGAGG - Intergenic
1111781987 13:92740069-92740091 CAATACAACTGGAGGAGAAGAGG - Intronic
1111857058 13:93651671-93651693 CACTGCACCTGGAGGTGAGGAGG + Intronic
1114400717 14:22407940-22407962 GAGTAGAACTGTTGGTCAGGTGG - Intergenic
1115773039 14:36686416-36686438 AAGCAGAACTGGAGCTCAGGAGG + Intronic
1115897569 14:38106641-38106663 TAATAGAACTGGGGGGGAGGTGG - Intergenic
1116726299 14:48565322-48565344 CAGGACAACTGGAGGCGGGGAGG + Intergenic
1117202252 14:53403279-53403301 CTGGAGAAATGGAGGTGAGATGG - Intergenic
1117557822 14:56904669-56904691 GAGTAGCACTGGAGGAGAAGAGG + Intergenic
1118337116 14:64863036-64863058 CAGTAGGAATGGAAGGGAGGTGG - Intronic
1122227940 14:100290608-100290630 GAACAGAACTGCAGGTGAGGTGG + Intergenic
1122497090 14:102165210-102165232 CAGGAGCTCTGGAGCTGAGGAGG - Intronic
1125933950 15:43618622-43618644 GAGCAGAACTGGGGATGAGGAGG - Intronic
1125947047 15:43718084-43718106 GAGCAGAACTGGGGATGAGGAGG - Intergenic
1126704115 15:51391809-51391831 CAGTAGAAGAGGATGTGAAGAGG - Intronic
1127311217 15:57753810-57753832 AAGTAGTACTGGAGCTGAGGCGG + Intronic
1127957832 15:63868517-63868539 TAGTCTAACCGGAGGTGAGGTGG - Intergenic
1128525004 15:68406356-68406378 CAGTATGGCTGGAGGAGAGGAGG - Intronic
1128718905 15:69931216-69931238 AGGTAGAGCTGGAGGGGAGGGGG + Intergenic
1129613130 15:77076479-77076501 CAGTAGAAGTGGAGTTGTGTGGG - Intronic
1130121176 15:81048941-81048963 CAGAAGAAGTGGAGCTGAAGGGG - Intronic
1131925962 15:97384031-97384053 CAGTATCACTGGGGGTAAGGAGG - Intergenic
1132500228 16:281731-281753 CAGGAGGACTGGGGGTGGGGAGG - Exonic
1135030719 16:19036158-19036180 CAGGAGAAATGGGAGTGAGGAGG + Intronic
1135091564 16:19522019-19522041 CAGTAGAACGAGAAGCGAGGGGG + Exonic
1135388283 16:22064824-22064846 GAAGAGAACTGGAGGTGACGTGG - Intronic
1137670647 16:50276309-50276331 CAGCAGCACTGGGGGTGAGGAGG - Intronic
1137862640 16:51861894-51861916 CAGAATAACTGCAGGTGAGAGGG - Intergenic
1137904184 16:52302381-52302403 GTGTAGAACTGGAGGTGATGAGG + Intergenic
1138116056 16:54361624-54361646 CAGTGGCACTGAAGGGGAGGAGG + Intergenic
1138151656 16:54662549-54662571 CAGCAGACCTGCAGGAGAGGAGG + Intergenic
1138158690 16:54731775-54731797 AAGGAGGACTGGAGGGGAGGAGG - Intergenic
1138511028 16:57508452-57508474 CAGTGGAGCTGGGGGTGGGGTGG + Intergenic
1140306778 16:73810149-73810171 CAGTGGAAGTGGAGGTGGCGGGG - Intergenic
1140728320 16:77833822-77833844 CATTAGAAGTGGAGGTGGGCTGG + Intronic
1141888447 16:86909886-86909908 GAGTAGAGCTGCAGGTGGGGAGG + Intergenic
1142560007 17:804221-804243 CAGAAGAACTGGTGGTGAGCGGG + Intronic
1142767430 17:2073022-2073044 AAATAGAACTGGGGATGAGGAGG + Intronic
1143377139 17:6473458-6473480 TGGTAGAAATGGAGGCGAGGAGG - Intronic
1143532915 17:7516120-7516142 CCTGAGAACTGGAGGTGGGGTGG + Intergenic
1144487647 17:15680621-15680643 CAGTAGCAGTGAAGGTCAGGAGG - Intronic
1144913379 17:18701666-18701688 CAGTAGCAGTGAAGGTCAGGAGG + Intronic
1145788854 17:27611656-27611678 CAGTAGGGCTGGAGGTGGGGTGG + Intronic
1146693614 17:34892997-34893019 CAGTTGCACTGAGGGTGAGGTGG - Intergenic
1147864723 17:43545035-43545057 TAGTGGAATTGGAGGTGAGGTGG + Intronic
1147899218 17:43773044-43773066 CAGTACAGCTGGAGTGGAGGAGG + Intronic
1149414503 17:56445227-56445249 CAGTTGACCTGAAAGTGAGGAGG + Intronic
1149728352 17:58920320-58920342 CAAGATCACTGGAGGTGAGGAGG - Intronic
1149986617 17:61352532-61352554 GAGTAGAAGTGGAGGGAAGGAGG + Intronic
1151059237 17:71071860-71071882 CAGAAGAACTGGAGGAAATGGGG + Intergenic
1152299433 17:79486455-79486477 CAGAAGAAGGGGAGTTGAGGAGG - Intronic
1152325633 17:79634261-79634283 CAGTGGCTCTGGCGGTGAGGTGG - Intergenic
1152932404 17:83116553-83116575 CAGTGGGACTGGAGTTGAGCTGG - Intergenic
1153018072 18:602311-602333 GAATAGATCTGGAGGAGAGGGGG - Intronic
1153697387 18:7657889-7657911 CAGTAAAACTGGGGGAGGGGAGG - Intronic
1153807041 18:8717724-8717746 CTGTAGAATGGGAGGGGAGGGGG + Intronic
1154197814 18:12279227-12279249 CAGCAGGAGAGGAGGTGAGGAGG + Intergenic
1154444139 18:14420096-14420118 CACTAAGACTGGAAGTGAGGGGG - Intergenic
1155803685 18:30140411-30140433 CAGGACAACTTGAGGCGAGGAGG + Intergenic
1157353675 18:46914375-46914397 CAGAAGAACTGGAAGAGAGGTGG + Intronic
1160112104 18:76043081-76043103 TAGTAGAAATGGAAGTGAGAAGG + Intergenic
1160215482 18:76925424-76925446 CAGTAGAGGAGGAGTTGAGGAGG - Exonic
1163288573 19:16364433-16364455 CAGTAGAGCTGAAGGTGGGAGGG - Intronic
1165806112 19:38581778-38581800 TAGTAGAGATGGAGGTGGGGGGG + Intronic
925667854 2:6280672-6280694 CAATAGTATTGGTGGTGAGGAGG + Intergenic
927653788 2:24928655-24928677 CAGCAGTACTGGAGGGGAGGCGG + Intergenic
927657071 2:24958206-24958228 GAGTGGAACTGGAGGTGGGACGG - Intronic
929175592 2:38972254-38972276 GATTTGAACTGGAGGTAAGGGGG + Intronic
929774219 2:44918145-44918167 CAGTGGGTCTGGAGGTGAGATGG + Intergenic
931034423 2:58221981-58222003 GAGTAGAACTGGGGAGGAGGAGG + Exonic
931699973 2:64901601-64901623 CAGGAGAGCTGGAGGTGGGGAGG - Intergenic
932216538 2:69969825-69969847 AGGTGGAACTGGAGCTGAGGTGG - Intergenic
932308120 2:70718309-70718331 AACTAGAACTGGATGTGAGAGGG + Intronic
932495981 2:72146024-72146046 CCCTAGATCTGGAGGTGAGGAGG - Intronic
933658409 2:84907164-84907186 CACTAGAACTGGGGGAGGGGAGG + Intergenic
933840741 2:86284009-86284031 AAGTAGGCCTGGGGGTGAGGGGG + Intronic
934042217 2:88136984-88137006 TACTGGAACTGGAGGAGAGGGGG - Intergenic
934856357 2:97732715-97732737 CAGCAGATCTGGAGGTGATGGGG + Intronic
935811803 2:106805825-106805847 GGGTAGATCTGCAGGTGAGGAGG + Exonic
937474742 2:122205107-122205129 CACTTGAACTGGACGTGTGGAGG + Intergenic
938600886 2:132837946-132837968 CAGAAGAGGTGGAGGTGGGGAGG + Intronic
940964104 2:159818537-159818559 CAGGAGAACTAAAGGTTAGGTGG + Intronic
941638642 2:167962957-167962979 CAGGAGAGCTGGAGGAGTGGGGG + Intronic
941681414 2:168403543-168403565 CAGCAGAACTGGCAGTCAGGAGG + Intergenic
943294935 2:186126287-186126309 CTCTAGAACTGGAGCTGAGTTGG - Intergenic
944263399 2:197698227-197698249 CAGTAAAAGTGGTGGTTAGGAGG - Intronic
944299975 2:198112533-198112555 CAGTAGAACTGTGGCTGTGGAGG - Intronic
945022061 2:205583830-205583852 CAGTAGAACTGGAGGTGAGGTGG - Intronic
946417150 2:219545722-219545744 CAGGAGAATTGTAGGTGAGTGGG + Intronic
946969418 2:225075136-225075158 CTGTTGCACTGGGGGTGAGGAGG - Intergenic
948176734 2:235949465-235949487 CAGAAGAACAGGCGGAGAGGTGG - Intronic
1169341686 20:4801117-4801139 CAGCAGAACTTGGGGTGGGGAGG + Intronic
1170587632 20:17747064-17747086 AAATAGAAAAGGAGGTGAGGTGG + Intergenic
1170980117 20:21204599-21204621 CAAAAGAACTGAAGGTGGGGAGG - Intronic
1173169677 20:40713812-40713834 CAGAAGCACTGGGGGTGGGGAGG - Intergenic
1173503606 20:43570602-43570624 AAGAAGAGCTGGAGGGGAGGAGG - Exonic
1173657407 20:44709890-44709912 CAGCAGGGCTGGAAGTGAGGAGG - Intergenic
1173763972 20:45589215-45589237 CAGAAGAATTGAAGGTAAGGTGG - Intergenic
1174279436 20:49428060-49428082 CAGAAGACGTGGAGGTGAGGGGG + Intronic
1174390226 20:50214405-50214427 CAGATGAGCTGGAGGTGGGGAGG + Intergenic
1174439748 20:50541076-50541098 CAGGAGAAGTAGAGGTGAAGAGG + Intronic
1175505100 20:59477120-59477142 CAGGACAACTTGAAGTGAGGAGG - Intergenic
1175635395 20:60578636-60578658 CAGAACAACTCGAAGTGAGGTGG + Intergenic
1176451843 21:6869761-6869783 CACTAAGACTGGAAGTGAGGGGG + Intergenic
1176830015 21:13734812-13734834 CACTAAGACTGGAAGTGAGGGGG + Intergenic
1177887430 21:26763086-26763108 CAGGACAACTGGAAGCGAGGAGG - Intergenic
1180224935 21:46386623-46386645 CAGCATCACTGCAGGTGAGGAGG - Intronic
1180616779 22:17133606-17133628 CTGCAGAACTGGAGGTCAGAAGG + Intergenic
1181514732 22:23404053-23404075 CAGTCGCACAGAAGGTGAGGTGG + Intergenic
1181614739 22:24045850-24045872 AACAAGAACTGGAGGTGAGAAGG - Intronic
1181799257 22:25333682-25333704 GAGTAGCAGGGGAGGTGAGGAGG + Intergenic
1182046625 22:27279199-27279221 CAGTTGAGCAGGAGGTGTGGTGG - Intergenic
1182049952 22:27305066-27305088 CAGCAGAAGTCGAGGTGATGAGG - Intergenic
1182776663 22:32836550-32836572 CAATAGCACTGAAGGTGCGGAGG - Intronic
1183007709 22:34917038-34917060 CAGGACAACTGGAAGTGGGGAGG - Intergenic
1183168380 22:36165202-36165224 CAGTAAAAATGGAGTTAAGGAGG - Intronic
1184697675 22:46149377-46149399 CAGGGGAACTGGAGATCAGGCGG - Intergenic
1184900858 22:47445627-47445649 CAGGAGGACAGGAGGTCAGGAGG - Intergenic
949254844 3:2033647-2033669 TAGTAAAACTGGAGGTGAAGGGG + Intergenic
949847596 3:8387558-8387580 CAGTAGAGCTGAAGCTGAGAAGG + Intergenic
951374646 3:21898867-21898889 CAGTAAAACTGGAGATGCGTAGG - Intronic
955227620 3:57074008-57074030 CAGGAGAGCTGGAGGTGAAGAGG - Exonic
957243476 3:77688900-77688922 CTGTAGAAATGCAGGAGAGGAGG + Intergenic
957482047 3:80810850-80810872 CAGCACAGCAGGAGGTGAGGAGG + Intergenic
958028902 3:88083084-88083106 CAGTAGGATTGGTGGTGAGGAGG - Intronic
959824061 3:110771821-110771843 CAGCAGAGCTGGTGGTGAGGGGG - Intergenic
961368162 3:126414450-126414472 CAGTGGAAGTGGCGGCGAGGTGG - Intronic
961584395 3:127910227-127910249 CAGGAGACCTGGAGGTGGAGGGG + Intergenic
962717026 3:138135237-138135259 CCATAGAACTGGAGGAGAAGAGG + Intergenic
963838904 3:150084826-150084848 CACTACAGCTGGGGGTGAGGTGG - Intergenic
964383822 3:156126232-156126254 CAGGAGAACAAGAGGAGAGGAGG + Intronic
965753972 3:172006496-172006518 ATGTTTAACTGGAGGTGAGGAGG - Intergenic
966657313 3:182374140-182374162 CAGTGGAAGTGGAGGTTGGGAGG + Intergenic
967127697 3:186439899-186439921 CAGTGGGACAGGAGGGGAGGCGG - Intergenic
967315927 3:188152524-188152546 CAGGAGACCTGGATGGGAGGAGG + Intergenic
967342924 3:188421019-188421041 CAGTAAAATGGGGGGTGAGGGGG - Intronic
967691860 3:192483675-192483697 AAGTAGAAGTGTAGCTGAGGTGG + Intronic
969424350 4:7115569-7115591 CAGGTGATGTGGAGGTGAGGAGG + Intergenic
969512941 4:7629987-7630009 TAGGAGAACTGGAGGGGAGAGGG - Intronic
971234811 4:24831185-24831207 AAGAAGAGCTGGAGGAGAGGTGG + Intronic
971452298 4:26811463-26811485 CAGTGGAATTGGAGGTGACGAGG + Intergenic
971526490 4:27625427-27625449 CAGTAAACCTGGATGTGAGTAGG - Intergenic
971690180 4:29823749-29823771 CTGTAGCCCTGGAGATGAGGAGG - Intergenic
973609246 4:52618629-52618651 CAGTAGAAAAGGTGATGAGGTGG + Intronic
974405442 4:61462346-61462368 CAGCAGAACTTTAGGTGAGGGGG + Intronic
974455459 4:62124503-62124525 AAATAGAAATGCAGGTGAGGAGG - Intergenic
976052744 4:81028614-81028636 AAGGAGGACTGGAGCTGAGGGGG + Intergenic
976979241 4:91205711-91205733 CAGTAGAAAGGGAGGCCAGGTGG - Intronic
977124465 4:93147649-93147671 CAGCAGAACAGAAGGGGAGGTGG + Intronic
977919490 4:102627272-102627294 CAGGAGAGCTGGAGGTGTCGGGG - Intergenic
979940295 4:126753671-126753693 CTGAAGTACTGGAGGTTAGGAGG - Intergenic
980444263 4:132885892-132885914 CAGCAGAACTGAAGGTGCTGGGG + Intergenic
982700532 4:158656288-158656310 AATTAGAACTGGAGGTATGGAGG - Intergenic
982744065 4:159087977-159087999 CAGTAGGAATGGTGGTGGGGAGG + Intergenic
983227102 4:165095491-165095513 CATGAGAACTAGAGGTGAGCAGG + Intronic
984163938 4:176285754-176285776 CAGTGGATCAGGAGGAGAGGAGG + Intergenic
984856798 4:184202419-184202441 GAGTGGAACAGGAGGGGAGGAGG + Intronic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
985987140 5:3525362-3525384 CAGGAGAGCTGGTGGTGAAGGGG + Intergenic
986326255 5:6677098-6677120 CAGTTGAACAAGAGGTGGGGTGG + Intergenic
986573675 5:9191105-9191127 AAGAAGAACAGGAGATGAGGAGG + Intronic
986988040 5:13521300-13521322 CAGGAGAACTGGAAGTGGGGAGG - Intergenic
989208301 5:38833571-38833593 CAGCAGAACTGCAAGTGAGGTGG - Intergenic
989458845 5:41672967-41672989 CAGTAGTTCTGGAGGTGCTGGGG - Intergenic
991138107 5:63206895-63206917 CAATAGAACTGGTGGTGTGCTGG + Intergenic
991573020 5:68075265-68075287 CAATAGAATAGGAGGTGAGTAGG - Intergenic
992051323 5:72943661-72943683 AAGAAGAACTGGAAGTGATGGGG - Intergenic
992547836 5:77832483-77832505 CAGTGGGACTAGAGGCGAGGAGG - Intronic
996757551 5:126950503-126950525 CAGTAGATGAGGAGGTGGGGTGG - Intronic
997198262 5:131994022-131994044 CAGAAGAAGTAGAGGTGAGCAGG - Exonic
998400691 5:141847359-141847381 GAGTAGAAATGGAGGGGAGTTGG - Intergenic
1000367328 5:160504084-160504106 CCAAAGAACTGGAGATGAGGGGG - Intergenic
1000407611 5:160905258-160905280 TAGTAGAATTGTAGGTAAGGAGG + Intergenic
1000980266 5:167809436-167809458 CAGGAGAGCAGGAGGTGAGAAGG + Intronic
1001200331 5:169710249-169710271 CAGTGGAAATGGAGGCCAGGTGG + Intronic
1001705897 5:173741070-173741092 CAGAAGACCTGGAGGTCAGGAGG - Intergenic
1001799299 5:174529524-174529546 CAGTAAGACTGGGGGTGGGGAGG - Intergenic
1003913732 6:10766269-10766291 CTGTATAACTGGGAGTGAGGAGG + Intronic
1004059253 6:12176051-12176073 CAGCAGAACTGGAGATGCAGAGG - Intergenic
1004897606 6:20163776-20163798 CAGCAGCCCTGGAGGTGAGGTGG + Intronic
1004937875 6:20525845-20525867 GAGTAGAAATGGAGGTGATCAGG - Intergenic
1005375733 6:25180469-25180491 CTCTAGAGCTGGAGGTGAGAAGG - Intergenic
1005994757 6:30924399-30924421 CAGGAGAACAGGACCTGAGGGGG - Exonic
1006324687 6:33344871-33344893 CAGAAGCAGAGGAGGTGAGGGGG - Intergenic
1007518406 6:42431584-42431606 AAGTAGAACTGGAGGAAGGGAGG + Intronic
1007580660 6:42957553-42957575 TGGGACAACTGGAGGTGAGGAGG + Intergenic
1009339522 6:62536563-62536585 AAGTAGCTCTGTAGGTGAGGTGG + Intergenic
1010976835 6:82325104-82325126 TAGTAGAGATGGAGGTGTGGCGG + Intergenic
1013490307 6:110640377-110640399 GAGTGGAATTGGATGTGAGGTGG + Intronic
1013671417 6:112407528-112407550 CAGTAAAATTGGAATTGAGGTGG + Intergenic
1015799540 6:137046304-137046326 CAGGAGGACAGGATGTGAGGTGG - Intergenic
1016514643 6:144880571-144880593 CAGGAGAATTCGTGGTGAGGGGG + Intergenic
1016572900 6:145534898-145534920 CACTGGACCTAGAGGTGAGGTGG - Intronic
1018884054 6:167917455-167917477 CAGAAGGACTAGAGGAGAGGAGG + Intronic
1020777164 7:12469867-12469889 CAGCAGAACTGGAGTTGAAACGG + Intergenic
1021760997 7:23903248-23903270 GAGCACAACTGGGGGTGAGGTGG - Intergenic
1023431422 7:40095355-40095377 TTGTAAAACTGGAGGTGGGGAGG - Exonic
1024492666 7:50003421-50003443 CTGTGCCACTGGAGGTGAGGTGG - Intronic
1026079554 7:67205535-67205557 CATTACAGCTGGAGGGGAGGAGG + Intronic
1026593212 7:71713626-71713648 CTCCAGAACTGGAGGTGGGGAGG + Intergenic
1026697295 7:72606447-72606469 CATTACAGCTGGAGGGGAGGAGG - Intronic
1027111489 7:75443120-75443142 AAGTAGAAATGGAAGTGGGGGGG - Intronic
1027214328 7:76174117-76174139 GACCAGAACTGGAGGTCAGGGGG - Intergenic
1027283720 7:76627653-76627675 AAGTAGAAATGGAAGTGGGGGGG - Intergenic
1030194530 7:106840635-106840657 CTGTAGGCCTGGAGATGAGGTGG - Intergenic
1033194940 7:139319694-139319716 CAGAATAACTGGAGGTCAGAAGG - Intergenic
1033996992 7:147362594-147362616 CAGTATGCCTGTAGGTGAGGTGG - Intronic
1034283014 7:149866535-149866557 GAGTAGTTCTGGAGCTGAGGTGG + Exonic
1036622254 8:10431985-10432007 CGGAAGAACTGGAGCAGAGGGGG - Intergenic
1037330078 8:17735658-17735680 AGGGAGAACTGGAGGAGAGGCGG - Intronic
1037560542 8:20070436-20070458 CAGTGGAACAGGAGTGGAGGGGG - Intergenic
1037961158 8:23099323-23099345 CAGTGGATCTGGGGATGAGGAGG - Intronic
1037970521 8:23168534-23168556 CAGTGGATCTGGGGATGAGGGGG + Intergenic
1038957434 8:32482769-32482791 CAGAAGGACTGGAGCTGTGGGGG + Intronic
1039829507 8:41201702-41201724 CAGTAGAAGTGGAAGTGACAGGG + Intergenic
1039903878 8:41772430-41772452 GAGAAGAAATGGAGGGGAGGAGG - Intronic
1040349688 8:46551656-46551678 CAGTAGAATTTGTGGTTAGGTGG - Intergenic
1041122131 8:54597238-54597260 TAGAAAAACTGGAGTTGAGGAGG - Intergenic
1042300417 8:67273825-67273847 GACTAGAACAGGAGGGGAGGTGG - Intronic
1045251345 8:100485612-100485634 TGGTAGGAATGGAGGTGAGGAGG + Intergenic
1045962042 8:107979792-107979814 CAGTGGTACTTGAGGTGGGGAGG - Intronic
1047635297 8:126755310-126755332 AATCAGAACTGGAGGAGAGGAGG - Intergenic
1047690576 8:127349541-127349563 CAGTTGAACACGAGATGAGGTGG - Intergenic
1047964429 8:130035492-130035514 CAGCAGCCCTGGAGCTGAGGAGG - Intergenic
1048592987 8:135838701-135838723 GAATAGTACTGGAGGTGAGGTGG - Intergenic
1048983386 8:139715368-139715390 CAGTAGAAGGGGAAGTGAGCAGG + Intergenic
1049402273 8:142433751-142433773 AAGGTGCACTGGAGGTGAGGAGG + Intergenic
1050907953 9:11028459-11028481 CAAGAGAACTGGGGGTGATGAGG + Intergenic
1052971387 9:34379309-34379331 CAGTAGAACCTAAGGTCAGGAGG - Intronic
1055594381 9:77850381-77850403 CAGTAGAGGTGGAGGTGTAGAGG - Intronic
1056462744 9:86823988-86824010 CACAACAACTGGAGGTGATGTGG + Intergenic
1058113518 9:101057910-101057932 GAGTACATTTGGAGGTGAGGAGG + Intronic
1058506437 9:105670781-105670803 CAGTCTAACAGGAGCTGAGGAGG - Intergenic
1059070583 9:111131821-111131843 CAGCAGAAGTGGAGAGGAGGAGG + Intergenic
1059329669 9:113526878-113526900 CATTAGAACTGGGGGCTAGGAGG - Intronic
1060124132 9:121025213-121025235 CAGTAGAAGTGGAGGTAATAGGG + Intronic
1203517338 Un_GL000213v1:14754-14776 CACTAAGACTGGAAGTGAGGGGG - Intergenic
1185816880 X:3164371-3164393 CAGTAGATTTGGAGGTTATGGGG - Intergenic
1186924816 X:14321971-14321993 CAGTTGACCTGGAGGGGAGAAGG - Intergenic
1187099368 X:16177077-16177099 CATTATAAATGCAGGTGAGGTGG + Intergenic
1188930760 X:36108331-36108353 ATACAGAACTGGAGGTGAGGAGG - Intronic
1188960210 X:36482335-36482357 CAGTAAAACTGAAGGTGAAATGG - Intergenic
1189270449 X:39747845-39747867 CAGGGCAACTGGAGCTGAGGTGG - Intergenic
1189901229 X:45708483-45708505 GACTGGAACTGGAGGGGAGGGGG + Intergenic
1192420257 X:71023026-71023048 CAGAAGGACAGGAGGGGAGGAGG + Intergenic
1192966432 X:76182537-76182559 CAGCAGACCTGCAGGAGAGGGGG - Intergenic
1195067903 X:101254218-101254240 AAGTTGAACTGGAGGGGTGGGGG - Intronic
1196067913 X:111486117-111486139 CACCAGAAGTGGAGGTGAAGAGG - Intergenic
1196382790 X:115110203-115110225 CGGGAAAACTGGAAGTGAGGAGG + Intergenic
1197934035 X:131722300-131722322 CAGGACAACTGGAGAGGAGGCGG - Intergenic
1198243616 X:134808055-134808077 CAGAAGATCTGGAGGTGAGTGGG - Intronic
1199212594 X:145231440-145231462 GAGTAGAAATGAAGGTCAGGTGG - Intergenic
1199392663 X:147299028-147299050 TAGTAGAACGTGAGGTGGGGGGG - Intergenic
1200293386 X:154893153-154893175 CAGGACAACTGGAAGCGAGGCGG - Intronic