ID: 945023410

View in Genome Browser
Species Human (GRCh38)
Location 2:205596720-205596742
Sequence ATCATGTTTGTGGCCAAATA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 138}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945023406_945023410 -8 Left 945023406 2:205596705-205596727 CCCAAAATGTATGTAATCATGTT 0: 1
1: 1
2: 5
3: 88
4: 675
Right 945023410 2:205596720-205596742 ATCATGTTTGTGGCCAAATAGGG 0: 1
1: 0
2: 0
3: 13
4: 138
945023405_945023410 -7 Left 945023405 2:205596704-205596726 CCCCAAAATGTATGTAATCATGT 0: 1
1: 1
2: 4
3: 69
4: 750
Right 945023410 2:205596720-205596742 ATCATGTTTGTGGCCAAATAGGG 0: 1
1: 0
2: 0
3: 13
4: 138
945023407_945023410 -9 Left 945023407 2:205596706-205596728 CCAAAATGTATGTAATCATGTTT 0: 1
1: 0
2: 4
3: 35
4: 399
Right 945023410 2:205596720-205596742 ATCATGTTTGTGGCCAAATAGGG 0: 1
1: 0
2: 0
3: 13
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945023410 Original CRISPR ATCATGTTTGTGGCCAAATA GGG Intronic
900769173 1:4527334-4527356 ATGATGCTTGTGGGCGAATATGG + Intergenic
903060149 1:20663655-20663677 ACCCTGTTTGTGCCCACATAGGG - Intergenic
904578041 1:31518189-31518211 AACATGTTTTTAGCCAAAGAAGG - Intergenic
907347898 1:53799018-53799040 ATCATGAGTCTGACCAAATATGG - Intronic
908745735 1:67374895-67374917 ATCAGATTTGTGACAAAATAAGG - Intronic
909727893 1:78857741-78857763 ATCATATTTGTAGACATATATGG - Intergenic
909849606 1:80443889-80443911 ATCATGTTATTGGCAAATTAAGG - Intergenic
911672104 1:100619199-100619221 ATCATGTTAGTCTCCAAAGATGG + Intergenic
915883880 1:159702446-159702468 CTCATGTTTGGGGTCAAAGAGGG - Intergenic
917245304 1:172994782-172994804 CTAAAGTTTTTGGCCAAATAAGG - Intergenic
918948553 1:191103887-191103909 CTCATGTTTGTAGGCAAAGAAGG - Intergenic
919150564 1:193692112-193692134 ATCAAGTTTATGGTAAAATACGG - Intergenic
920722578 1:208401452-208401474 AGCATGTTTGTGACCGAATCTGG + Intergenic
920849295 1:209617860-209617882 TTCCTGTTTATGCCCAAATATGG + Intronic
921562309 1:216673241-216673263 CTCCTTTCTGTGGCCAAATACGG - Intronic
921589618 1:216988231-216988253 ATCATGCTGTTGGCCATATATGG - Intronic
923966660 1:239148484-239148506 ATAATGTTAGTCACCAAATAAGG + Intergenic
1069040669 10:63692551-63692573 ATATTGTGTGTGGCCAAAGAAGG - Intergenic
1074538456 10:114345607-114345629 ATCAGGGATGTGGCCAAATTGGG - Intronic
1078947410 11:16085145-16085167 ATCCTCTTCATGGCCAAATAGGG - Intronic
1079816893 11:25072495-25072517 TTCATTTGTGTGGCCAAAAAGGG + Intronic
1080576993 11:33609142-33609164 TTCATGTTAGTGGCCATACAAGG + Intronic
1091018257 11:132073837-132073859 AACAGGTTTGTGGCCAGAAATGG - Intronic
1094120182 12:26965144-26965166 ATCAACTTTGACGCCAAATAAGG - Exonic
1095718776 12:45377389-45377411 ATAACGTATCTGGCCAAATAAGG - Intronic
1095971177 12:47902977-47902999 ATCAGTTTTGAGGTCAAATAGGG + Intronic
1096841524 12:54382669-54382691 TACATGTTTATGGCTAAATATGG + Intronic
1097352615 12:58565006-58565028 ATTATGAGTTTGGCCAAATAGGG - Intronic
1097785526 12:63754734-63754756 ATCATGTCTTTGGCCAAACTTGG - Intergenic
1098490018 12:71064683-71064705 ATCATGTCTGTTGCCTACTATGG - Intronic
1099259379 12:80358093-80358115 ATTGTTTTTATGGCCAAATAAGG + Intronic
1101574273 12:105983037-105983059 AACATGTTTGTGTCCCAAGATGG + Intergenic
1102765895 12:115432811-115432833 ATCCTGTTTATGGCCTAATCAGG - Intergenic
1103385808 12:120531723-120531745 ATCATGTATGTGGCCAGGCAAGG - Intronic
1104113237 12:125723990-125724012 CTCCTGTTTGTGGACAAACATGG - Intergenic
1104494838 12:129227175-129227197 CTCAAGCATGTGGCCAAATATGG + Intronic
1104844976 12:131842090-131842112 CTGATCTTTGTGGCCATATAAGG + Intronic
1108325070 13:49322331-49322353 ATCCTTTTTGTGGCCAAAATTGG + Intronic
1109921164 13:69061710-69061732 TTCATGTTGTTGGCCATATATGG - Intergenic
1110516478 13:76418684-76418706 ATCTTTTTTCTGGCTAAATAGGG + Intergenic
1111337989 13:86847081-86847103 CACATGGTTGGGGCCAAATAAGG + Intergenic
1112710545 13:102122428-102122450 ATGATATTTGTGGGCACATATGG - Intronic
1116063306 14:39951189-39951211 ATGATGTTTGCAGCCAAATAGGG + Intergenic
1117016363 14:51521906-51521928 ATCATATTTGTGGTCACATCTGG + Intronic
1117424897 14:55583811-55583833 AACATGTTTGAGGAAAAATACGG - Intronic
1118169891 14:63378489-63378511 TTCATGTTTTTGATCAAATATGG + Intronic
1118789899 14:69080877-69080899 ATGAAGTTTGTGGCCAAATGGGG + Intronic
1122401246 14:101468845-101468867 ATCAAGTTTGTGGCCCATGAGGG + Intergenic
1126301104 15:47197039-47197061 CTCATCTATGTGGCCAAATGGGG + Intronic
1127908303 15:63393897-63393919 ATCATGATTATGTCTAAATAAGG - Intergenic
1129103595 15:73289392-73289414 ATAATGTTTGTTGCAAAATATGG - Intronic
1135835823 16:25824274-25824296 ATACTGTTTATGGCCAGATATGG + Intronic
1138800741 16:60025393-60025415 ATCATTTTTAGGGCCAAGTAGGG - Intergenic
1140251849 16:73301278-73301300 ATCATGTTTCTGGCGGAAGAAGG + Intergenic
1144417683 17:15067376-15067398 ATTATATTTGTGACCCAATATGG - Intergenic
1146377753 17:32306075-32306097 GTCAAGTTTGTGGCAAAATGAGG + Intronic
1149194151 17:54099804-54099826 ATCATGTTTGAAGTCATATAGGG - Intergenic
1151031304 17:70743225-70743247 ATCATTTTTATGACCAAATGGGG - Intergenic
1153525281 18:5989269-5989291 ATCATGTATGTGACCAAACATGG + Intronic
1155811913 18:30247839-30247861 ACCTTGTTAGTGGACAAATATGG + Intergenic
1156941580 18:42773416-42773438 ATCATGAGTGTGGCAAACTAAGG + Intronic
1159458212 18:68690243-68690265 ACCATGTTGGAGGCCAGATAGGG - Intronic
1162835281 19:13312952-13312974 AGCATGTTGGAGGCCAAATCAGG - Intronic
1163149669 19:15403508-15403530 ATCATGTCTGTCTCCAAATGCGG + Exonic
1163333606 19:16657555-16657577 AACTTTTTTGTGGCCACATAGGG - Intronic
1167791043 19:51681747-51681769 ATCATATCCGTGCCCAAATAAGG + Intergenic
925834386 2:7929816-7929838 AGGATGTTTGTGGCTAAATTGGG + Intergenic
930917111 2:56706241-56706263 ATCATGTTTTTGAATAAATAAGG + Intergenic
933148888 2:78890706-78890728 ATAATCTTTGTGGCCAAAATGGG - Intergenic
937210876 2:120269454-120269476 GACATGGGTGTGGCCAAATAAGG - Intronic
937502519 2:122495496-122495518 ATCAAGTTTGTAGACAAATTTGG + Intergenic
942577708 2:177382237-177382259 ATCATGTTTGTGTTCATATCTGG + Intronic
944541995 2:200762978-200763000 ATCATTTTAATGGCCAAAAATGG - Intergenic
945023410 2:205596720-205596742 ATCATGTTTGTGGCCAAATAGGG + Intronic
1170431927 20:16283844-16283866 TTCAGGTTGTTGGCCAAATACGG + Intronic
1173559778 20:43994770-43994792 ATCATGTTTGTTCCCAGATAGGG + Intronic
1173680615 20:44877991-44878013 ATCATGTCTGTGAACAAAGATGG - Intergenic
1175081259 20:56422285-56422307 ATCATGGATGTGGCCCAAGATGG - Intronic
1178451149 21:32701784-32701806 ATAATGTTTGTTGCCCAAAAAGG - Intronic
1178841403 21:36140463-36140485 ATCTTTTTTGTGGCTATATAGGG + Intronic
1185282576 22:49981231-49981253 ATCATGTTTGTCTGCAAATCAGG - Intergenic
949652937 3:6181906-6181928 TTCATGTTGGTGGACAACTAGGG + Intergenic
951812347 3:26714772-26714794 ATCATGAGTGTGGGCAAATGTGG - Intergenic
957610795 3:82462832-82462854 ATCATTTTTATTGCAAAATAAGG - Intergenic
958536221 3:95408082-95408104 ATCATTTTGGTGCCCAAACATGG + Intergenic
959515678 3:107264131-107264153 TTCAAGTTGTTGGCCAAATATGG + Intergenic
963436692 3:145277723-145277745 ATCATGCTTCTGGCCAAACAAGG + Intergenic
965991019 3:174818200-174818222 TTCATCTTTGCAGCCAAATAGGG + Intronic
967318892 3:188176538-188176560 AACAAGTTTGTGGCCAGATCAGG - Intronic
967540519 3:190661858-190661880 ATCATATTTGTAGACAAAGATGG - Intergenic
969103558 4:4788248-4788270 ATTATGTTTGTGAACACATATGG - Intergenic
970335329 4:15033605-15033627 ATTGTGTTTGTGGTTAAATAAGG + Intronic
973697942 4:53509069-53509091 TTCATGTTCATGGCAAAATATGG - Intronic
980177709 4:129366780-129366802 CTCATGTTGGTGGCCAACCAAGG + Intergenic
981078129 4:140611210-140611232 ATCGTGTATGTGGCCAGATGTGG + Intergenic
982117184 4:152107431-152107453 GCCTTGTTTGCGGCCAAATAAGG + Intergenic
982281597 4:153688814-153688836 ATTTTGTTTATGGCCAAATCTGG + Intergenic
982348146 4:154384571-154384593 ATCATGTCTGTTGCCATATAAGG - Intronic
982356868 4:154480230-154480252 ATCGTGTTTAAGGCCATATACGG + Intronic
983110446 4:163742851-163742873 ATTTTGTTAGGGGCCAAATATGG + Intronic
983160331 4:164405673-164405695 ATCATGTTGGTGGAAAAAGAAGG + Intergenic
983274240 4:165598127-165598149 ATGATGTTTCTGGGCAAGTAAGG - Intergenic
985586834 5:744582-744604 ATCATGTTTCAGGCCAGGTACGG + Intronic
986084156 5:4426236-4426258 AACAAGGTTGTGGCAAAATAAGG - Intergenic
988486006 5:31668677-31668699 ATCTTATTTGTGGGCAAATATGG + Intronic
989734197 5:44683423-44683445 TTCATGTTTATGGCTAAACAAGG + Intergenic
991086400 5:62651869-62651891 GTCAGGTCTGTGGCCTAATAAGG - Intergenic
991251335 5:64564997-64565019 AACAAGTTTGTGGCCACATTTGG + Intronic
992133044 5:73714187-73714209 ATCATCTTTGGGACCAGATAAGG + Intronic
993128702 5:83868924-83868946 ATCATATTTATGGCCAAGCATGG + Intergenic
993476053 5:88366025-88366047 TTCATGTTTCTGTCCAAAGATGG + Intergenic
999506325 5:152201226-152201248 ATCATGTTGCTTTCCAAATATGG + Intergenic
1001528668 5:172446797-172446819 ATCGTGCTTGCAGCCAAATAGGG - Intronic
1004853383 6:19724342-19724364 ATCATTTTTGTTGTCAAATTGGG + Intergenic
1006661246 6:35647327-35647349 AACCTTTTTGAGGCCAAATAGGG - Intronic
1010545176 6:77145570-77145592 ATCATTTTTGTGAGAAAATAAGG + Intergenic
1011029407 6:82905415-82905437 ATTAAGTTTGTGGCTATATATGG - Intronic
1011386709 6:86806053-86806075 ATCATCTTTATAGCAAAATATGG - Intergenic
1012624464 6:101390202-101390224 AGCATGTTTATGTCCAATTATGG + Intergenic
1013193888 6:107828333-107828355 ATCATCTTTGTGGTCACTTATGG + Intergenic
1016053108 6:139550836-139550858 ATCATCTTTGTCCCCAAATAAGG + Intergenic
1016411984 6:143792991-143793013 ATCACAATTGTGGCCAAATTTGG + Intronic
1018545447 6:164930504-164930526 ATGTTGTTTGAGGCCAAATTTGG + Intergenic
1023831724 7:44042578-44042600 ACCATGTTTTTGTCCAAATTAGG + Intergenic
1024987850 7:55211257-55211279 ATTATTTTTGTGGCCAAATCAGG - Exonic
1026677294 7:72438441-72438463 ATCGTGTTTTTGGAGAAATAGGG - Intronic
1027749814 7:82128630-82128652 ATCATGTTTGTGTAGAAAGAAGG - Intronic
1027940632 7:84674472-84674494 ATCATCCTTGTAGCCAAAAAGGG - Intergenic
1030917506 7:115334325-115334347 ATCTTCTTTGTGGCAGAATAAGG + Intergenic
1032586168 7:133148896-133148918 ATCATGTATGTGGGGAAATTTGG - Intergenic
1040701297 8:50069277-50069299 ATCATGTTGGTGGCCAGTTTAGG + Intronic
1041784362 8:61615188-61615210 AGCATGTTTGAGGCCTAACAAGG - Intronic
1042538261 8:69881032-69881054 AGCATATCTGTGGCCAAATTTGG + Intergenic
1050197548 9:3103219-3103241 TTTATGTCTGTGGCCAAATTTGG - Intergenic
1050888503 9:10794698-10794720 ATCATATTTTTAGCAAAATAAGG + Intergenic
1052799369 9:32953252-32953274 AATTTCTTTGTGGCCAAATATGG + Intergenic
1054865969 9:70001711-70001733 ATCATGTTTGAGACTGAATAGGG + Intergenic
1056816030 9:89801777-89801799 CTCATATTTCTGGCCAAATATGG + Intergenic
1058203157 9:102068499-102068521 ATCATTTTTGTGTCCAGATAAGG - Intergenic
1185916946 X:4046254-4046276 ATCATGTATGTGGCCAGAACAGG + Intergenic
1188262715 X:28038292-28038314 ATCATATTTCTTGCCAACTATGG - Intergenic
1193841275 X:86411704-86411726 AACATGTTTTTAGCAAAATAAGG + Intronic
1194273521 X:91851159-91851181 AACATGTTTATGACAAAATATGG - Intronic
1194563898 X:95457646-95457668 ATCATCTTTGTGGCAATATAAGG - Intergenic
1195027896 X:100896459-100896481 ATCATCTTTGTGTACAAAAAGGG + Intergenic
1196500103 X:116370980-116371002 ATCATGTTTCTGGCCTAGGAAGG + Intergenic
1196560008 X:117134943-117134965 AAGATGTCTGTGGACAAATAGGG - Intergenic
1198640743 X:138753596-138753618 TTCAGTTTTGTGGCCAAATCTGG + Intronic
1198670878 X:139079547-139079569 ATCATTTTTGTGCTCATATAGGG - Intronic
1200888135 Y:8292777-8292799 ATTATGTTTATGCCCAAAAATGG - Intergenic
1201649259 Y:16266803-16266825 AACATGTGTGGGGCCAAGTAAGG - Intergenic
1201653550 Y:16318497-16318519 AACATGTGTGGGGCCAAGTAAGG + Intergenic