ID: 945027069

View in Genome Browser
Species Human (GRCh38)
Location 2:205629682-205629704
Sequence ACTCAAAGGCACAGCCCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945027069_945027074 7 Left 945027069 2:205629682-205629704 CCCTCTGGGCTGTGCCTTTGAGT No data
Right 945027074 2:205629712-205629734 ATATCAAGCTACAGGATGCAGGG No data
945027069_945027073 6 Left 945027069 2:205629682-205629704 CCCTCTGGGCTGTGCCTTTGAGT No data
Right 945027073 2:205629711-205629733 AATATCAAGCTACAGGATGCAGG No data
945027069_945027072 -1 Left 945027069 2:205629682-205629704 CCCTCTGGGCTGTGCCTTTGAGT No data
Right 945027072 2:205629704-205629726 TATCTGCAATATCAAGCTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945027069 Original CRISPR ACTCAAAGGCACAGCCCAGA GGG (reversed) Intergenic
No off target data available for this crispr