ID: 945030044

View in Genome Browser
Species Human (GRCh38)
Location 2:205654983-205655005
Sequence GCTGGTGGGACACCACAACC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945030038_945030044 -3 Left 945030038 2:205654963-205654985 CCTAGCTCCTGCTGGATGGGGCT No data
Right 945030044 2:205654983-205655005 GCTGGTGGGACACCACAACCGGG No data
945030033_945030044 25 Left 945030033 2:205654935-205654957 CCTATCTTGTCGGGAGGGTTGTA No data
Right 945030044 2:205654983-205655005 GCTGGTGGGACACCACAACCGGG No data
945030042_945030044 -10 Left 945030042 2:205654970-205654992 CCTGCTGGATGGGGCTGGTGGGA No data
Right 945030044 2:205654983-205655005 GCTGGTGGGACACCACAACCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945030044 Original CRISPR GCTGGTGGGACACCACAACC GGG Intergenic
No off target data available for this crispr