ID: 945032886

View in Genome Browser
Species Human (GRCh38)
Location 2:205682105-205682127
Sequence CGTCCCCCCGGGGTCTCCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 131}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945032886 Original CRISPR CGTCCCCCCGGGGTCTCCCT TGG Intronic
900338067 1:2174578-2174600 AGTCCCGCCGGGTCCTCCCTGGG - Intronic
901459420 1:9382855-9382877 CGTTCCCCATGGGTCACCCTCGG + Intergenic
902820155 1:18938710-18938732 CCTCCCTGCAGGGTCTCCCTAGG - Intronic
905648352 1:39639916-39639938 CTTCCCCGCGGGGCCTCCCAGGG - Exonic
907508297 1:54938515-54938537 CTTCCCCCAGGGGTCACCCTTGG + Intergenic
912449912 1:109762329-109762351 CCTCCCCCAAGTGTCTCCCTAGG + Intronic
919743547 1:200994733-200994755 CGTCCCCACTCTGTCTCCCTGGG - Intronic
920704867 1:208243671-208243693 CGTCCCCGCTCGGTCTACCTCGG + Exonic
922730880 1:227948196-227948218 CGTCCCGCCGTGGTCGCCCCGGG - Intergenic
1062858881 10:794513-794535 CCGCCCCCTGGGTTCTCCCTTGG + Intergenic
1063049620 10:2432980-2433002 CCTCCCCACTGGGTCTCCCTAGG + Intergenic
1065099041 10:22316067-22316089 AGTCTCCCCGGGGTCTCTCAGGG + Exonic
1065712594 10:28532633-28532655 CGTCCGCCCGTGGTCTCGCCAGG + Intronic
1067711759 10:48656059-48656081 CGGCCGCCCGGGGCCTGCCTGGG + Intronic
1069891419 10:71654789-71654811 CCTCCCCCAGAGGCCTCCCTGGG - Intronic
1070615681 10:77967734-77967756 CGTCTCCCAGGGGTCTCCATGGG + Intergenic
1073095826 10:100979097-100979119 CTTCCCTCCCAGGTCTCCCTGGG - Exonic
1074438183 10:113452357-113452379 CTTCCCTCAGGGGTCTCACTGGG + Intergenic
1074563936 10:114559554-114559576 GCTCACCCTGGGGTCTCCCTCGG + Intronic
1075075808 10:119349514-119349536 CCTCCCCAGGGGGTCTCCATGGG + Intronic
1075629900 10:123994645-123994667 CCTCATCCCGGGGTCCCCCTTGG + Intergenic
1077083058 11:734067-734089 CCTCCTCCCGGGGCCTGCCTAGG - Intergenic
1077254255 11:1573336-1573358 GGGCCCCCCAGGGTCACCCTGGG + Intergenic
1077282769 11:1753092-1753114 CGTCCTCCCGGGCCCTCCCTTGG - Exonic
1077323442 11:1952950-1952972 CGGCCTCACGGGGGCTCCCTGGG - Intronic
1077364716 11:2156904-2156926 CATCCCCCCGGGGTCTGCTCAGG + Intronic
1081672607 11:44950248-44950270 TGTCTCCCCGGGGTCTGACTCGG - Intronic
1083389578 11:62337879-62337901 TGTCCCCACAGGGTCTCCCGAGG + Exonic
1083720323 11:64600631-64600653 CTGACCCCCTGGGTCTCCCTGGG + Intronic
1083769729 11:64859906-64859928 CCTCACCCCAGGGTCTACCTTGG + Exonic
1084476976 11:69394640-69394662 AGTCCCCCAGGGCTCTGCCTGGG + Intergenic
1088811032 11:113392480-113392502 TGTGCTCCCGGGGTCTCCCTGGG - Intronic
1090350399 11:126104406-126104428 CTTCCCCTCAGGGGCTCCCTGGG + Intergenic
1091022405 11:132112638-132112660 CGTCCCCCCGGGCTCTCAGAGGG + Intronic
1202806430 11_KI270721v1_random:8145-8167 CGGCCTCACGGGGGCTCCCTGGG - Intergenic
1095687949 12:45056812-45056834 CCTCCCACCTGGGTCTCCCCAGG + Intergenic
1096252310 12:50041000-50041022 CGTTCCCCGAGGGTTTCCCTGGG - Intergenic
1096817377 12:54210131-54210153 CTTCCCTCCAGAGTCTCCCTGGG - Intergenic
1096983639 12:55743172-55743194 CGGCCCCCCGGGTCCCCCCTCGG + Intergenic
1101967640 12:109292042-109292064 CCTCACCCCGTGGTCTCCCAGGG - Intronic
1103415460 12:120739529-120739551 CGGCCCGGCGGGGGCTCCCTGGG + Exonic
1103446135 12:120996482-120996504 GGTCCCCACAGGGCCTCCCTAGG - Intronic
1107305249 13:39012161-39012183 TGTCCCTCCCGGGTATCCCTGGG - Exonic
1107466986 13:40660158-40660180 AGCCCCCCCAGGATCTCCCTGGG - Intronic
1111501122 13:89121011-89121033 AGTCCAACCTGGGTCTCCCTGGG - Intergenic
1113767331 13:112889522-112889544 CAACACCCCGGGGTCTCCCCAGG + Intergenic
1113814920 13:113163142-113163164 CTTCCCCCAAGGGCCTCCCTGGG + Intronic
1123050180 14:105537692-105537714 CGGCCCCCCGGGGTGTCTCTGGG + Intergenic
1202881837 14_KI270722v1_random:67726-67748 CGGCCCCCCGGGATCCCCCGAGG - Intergenic
1127071159 15:55289628-55289650 CGTCCCCCTGGGGCCGTCCTAGG - Intronic
1128557612 15:68642337-68642359 CGTCACCGCAGGCTCTCCCTGGG - Intronic
1128708642 15:69855786-69855808 TTTCTCCCCTGGGTCTCCCTGGG - Intergenic
1131452933 15:92561218-92561240 TCTGCCCCCGTGGTCTCCCTTGG + Intergenic
1132378400 15:101348144-101348166 CGCCCCCCCGGGGTCCCGCTGGG + Intronic
1132594797 16:743847-743869 TGTCCCCCCGTGCCCTCCCTGGG - Intronic
1132804561 16:1769542-1769564 TGTCCCCCCAGGCTCTGCCTGGG + Exonic
1132999007 16:2839914-2839936 CGGCCCCCCGGAGTCACCCTGGG + Intergenic
1133009891 16:2905135-2905157 GGTCTCCCTGGGGTCTCCCAGGG + Intergenic
1133802191 16:9092531-9092553 CGGCCACCCGGTGTCCCCCTCGG + Intronic
1139392181 16:66612015-66612037 AGCCCCTCCGGAGTCTCCCTGGG - Intronic
1139953097 16:70681342-70681364 TGTCCCCTCGGGGTTTCCCAGGG + Intronic
1141987400 16:87588929-87588951 CGTCCAGACGGGGTCTCCCTTGG + Intergenic
1142109802 16:88325285-88325307 CGGCCCCCCGGGGTGCACCTCGG - Intergenic
1142128392 16:88421319-88421341 TGCTCCTCCGGGGTCTCCCTGGG + Intergenic
1142235683 16:88921494-88921516 CCTCTTCCCGGGATCTCCCTGGG + Intronic
1147332705 17:39708257-39708279 CCACCCCCCAGGGCCTCCCTGGG - Intronic
1148081015 17:44967793-44967815 CGGCCCTCCGGGGCCTCCCGGGG - Exonic
1150840279 17:68600677-68600699 CCTGCCCCCGGCGTCCCCCTTGG - Exonic
1151876628 17:76870680-76870702 CTTCACCCCAGGGTCTCCCTGGG + Intronic
1151951414 17:77356299-77356321 AGTCCCCACCGGGTCTCCCAAGG - Intronic
1152572253 17:81126011-81126033 TGTCCCCCCGGGGTCCCCAGGGG + Intronic
1153515049 18:5895029-5895051 CGACCTCCCTCGGTCTCCCTGGG - Exonic
1159841235 18:73401497-73401519 CCTCCCCCTGGTCTCTCCCTTGG - Intergenic
1160757505 19:765305-765327 CGTCAGACTGGGGTCTCCCTGGG - Intergenic
1160763949 19:798796-798818 CTTCCCCCCGGGGTGTCCCGAGG + Intronic
1161964719 19:7541624-7541646 GGCCGCCCTGGGGTCTCCCTGGG - Exonic
1162325369 19:9996108-9996130 CCTCCCCCAAGGGTCTCCCCGGG - Exonic
1163290931 19:16378487-16378509 CGTCCCCCAGAGCTCTCCCAGGG + Intronic
1163301963 19:16453346-16453368 CTTCCCACCGGGGCCTCCCACGG + Intronic
1164916059 19:32053148-32053170 CGTCCCCCCACAGCCTCCCTTGG - Intergenic
1165330681 19:35139809-35139831 AGTCCCCGGGGGGCCTCCCTTGG - Intronic
1165488104 19:36107576-36107598 TCTCTCCCAGGGGTCTCCCTGGG + Intergenic
1167641870 19:50686838-50686860 CCCGCCCCCGGGGGCTCCCTGGG - Intronic
1167797799 19:51721185-51721207 TGTCCCCCAGGGCTCTCCCGAGG - Intronic
1168076363 19:53982635-53982657 CGCCCCCCCGCGGTCCCGCTCGG - Exonic
1168294304 19:55371123-55371145 TTTCCCCTCGGGGTCTCCCTGGG - Intergenic
1202657445 1_KI270708v1_random:36825-36847 CGGCCCCCCGGGATCGCCCGAGG - Intergenic
928201686 2:29251313-29251335 CCTCCTCCAGGGGCCTCCCTGGG + Intronic
928395015 2:30936970-30936992 CGGCCTCAGGGGGTCTCCCTTGG + Intronic
934567185 2:95347289-95347311 CGTCCCCTCTGGGGCTTCCTGGG - Intronic
935010313 2:99128989-99129011 CCTCCCGCCTAGGTCTCCCTGGG + Intronic
936863944 2:117055981-117056003 TGTCCCCCCGGAGTCCGCCTCGG + Intergenic
938079170 2:128360158-128360180 CGTGCCCCCGGGGCCTCTCCAGG + Intergenic
943692359 2:190881398-190881420 CGTCTCCCCGGGGCCGTCCTTGG - Exonic
945032886 2:205682105-205682127 CGTCCCCCCGGGGTCTCCCTTGG + Intronic
1168887112 20:1267272-1267294 CGTCTCCCCGGAGCTTCCCTGGG + Intronic
1169770297 20:9192610-9192632 CGTCCTCCCAGGGTCTCCATAGG + Intronic
1175841650 20:62031796-62031818 CTGCACCCCGGCGTCTCCCTGGG - Intronic
1175993640 20:62802398-62802420 AGTCACCCCTGGGTCGCCCTGGG - Intergenic
1176286462 21:5021665-5021687 CGTCCCCCCTGGGCCTCACCTGG + Intergenic
1177197476 21:17918559-17918581 CTTCCCCCCGGGTTCCTCCTAGG + Intronic
1179810145 21:43865080-43865102 TGTCCCCCCAGCGTGTCCCTCGG + Intergenic
1179870719 21:44241810-44241832 CGTCCCCCCTGGGCCTCACCTGG - Intergenic
1180376449 22:12098021-12098043 CGGCCCCCCGGGATCCCCCGAGG - Intergenic
1181010295 22:20036443-20036465 CTGCCCCCCGGGGACCCCCTCGG + Intronic
1181381471 22:22508308-22508330 CGCCCCCGCGGGGTCTCTTTTGG - Intronic
1183100173 22:35579010-35579032 TGTGCCCCTGGGGACTCCCTGGG + Intergenic
1183370020 22:37427100-37427122 GGTCCCCCGGGGGTCTCACGGGG + Intronic
1183587693 22:38762518-38762540 CGTTCCCCCTGGGACCCCCTTGG + Intronic
1183616257 22:38947612-38947634 CTTTCCCCCAGGGTCTTCCTGGG + Intergenic
1184424965 22:44403957-44403979 GGTCCTCCCGGGGCCTCCCAGGG - Intergenic
1184781610 22:46652412-46652434 AGTCCAGCCTGGGTCTCCCTGGG - Intronic
1185004974 22:48270437-48270459 AGTCCTCCCGGGGTCTCCATGGG - Intergenic
1185205505 22:49535772-49535794 CATCCTCCCGGGGGCTCCCTCGG - Intronic
954148049 3:48643976-48643998 GGTCCCCCCAGAGTCTCCCATGG - Intronic
954866465 3:53733766-53733788 CTTCCCACCTGTGTCTCCCTAGG - Intronic
957362091 3:79173521-79173543 CGGCCCACCGGGTTCTCACTGGG + Intronic
966794254 3:183698390-183698412 CATCCCCACCGGGCCTCCCTGGG + Intronic
966860813 3:184230143-184230165 CGGCCCCCCGGGGCCCCCCGCGG - Intronic
968521304 4:1035938-1035960 CTTCCCCTGGGGGTCTCCCTGGG - Intergenic
968972392 4:3802845-3802867 CCTCCCCCAGGGGTCAGCCTTGG - Intergenic
975441969 4:74421325-74421347 CCTCCCCCGGGTGTCTCCCATGG + Intergenic
976226311 4:82798016-82798038 GGTCCCCCCCGGCTCTCCATCGG + Intronic
1202758049 4_GL000008v2_random:83454-83476 CGGCCCCCCGGGATCCCCCGAGG - Intergenic
999300098 5:150485814-150485836 CTTCCACCCGGATTCTCCCTCGG - Intronic
1001115062 5:168932590-168932612 CTGCCCCACGGGGTGTCCCTGGG - Intronic
1002866273 6:1125065-1125087 GCTCCCCCCGGGGGCTCCCATGG + Intergenic
1013033776 6:106360928-106360950 GGGCTCCCCGGGGTCGCCCTGGG - Intergenic
1016014150 6:139166799-139166821 CGTTCCCCCGGTGGCTCCCCGGG + Exonic
1018845191 6:167551165-167551187 CGTCCCCCAGGGTGCCCCCTTGG + Intergenic
1021106734 7:16646348-16646370 CGCCCCGCCGGGGTTTCCATCGG + Intronic
1026901614 7:74040457-74040479 GGTCCCCCCTGGCTTTCCCTGGG - Intronic
1029544354 7:101202412-101202434 CGTCCCCACCGGGTCACGCTCGG + Intergenic
1029715651 7:102324072-102324094 CCCCCCCCCGGGCTCTCCCAAGG + Intergenic
1035625667 8:1068797-1068819 AGCCCCCACGAGGTCTCCCTGGG - Intergenic
1037758684 8:21727706-21727728 CCTCCCCGCTGGGCCTCCCTCGG + Intronic
1037817591 8:22120250-22120272 CAGCCCCTCGGGGTCACCCTGGG + Intronic
1039904994 8:41780126-41780148 AGTCCTCCCAGGGCCTCCCTAGG + Intronic
1043053210 8:75407301-75407323 CGGACCCCCGGGGGCTCCCCAGG + Intergenic
1049576790 8:143393385-143393407 CCTCCCCTCAGGGTCTCCCTTGG + Intergenic
1050907788 9:11027217-11027239 CCACCCCCCATGGTCTCCCTTGG + Intergenic
1051353293 9:16218310-16218332 AATCCACCCGGGGTCTCCCCTGG + Intronic
1051353344 9:16218535-16218557 CTTTCCCCCGGGTTCACCCTTGG - Intronic
1061484054 9:130911509-130911531 CTTCCTGCCGGGGTCACCCTGGG - Intronic
1203538838 Un_KI270743v1:68326-68348 CGGCCCCCCGGGATCCCCCGAGG - Intergenic
1185894061 X:3843173-3843195 CCTGCGCCCTGGGTCTCCCTGGG - Intronic
1185899179 X:3881597-3881619 CCTGCGCCCTGGGTCTCCCTGGG - Intergenic
1185904296 X:3920026-3920048 CCTGCGCCCTGGGTCTCCCTGGG - Intergenic
1201506034 Y:14701516-14701538 AGTCCCACATGGGTCTCCCTAGG + Intronic