ID: 945036409

View in Genome Browser
Species Human (GRCh38)
Location 2:205707574-205707596
Sequence GCATCTTCCAAGTTTTGTTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 146}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945036407_945036409 19 Left 945036407 2:205707532-205707554 CCTACTTGGATTTCTGCATGGCA 0: 1
1: 0
2: 0
3: 9
4: 194
Right 945036409 2:205707574-205707596 GCATCTTCCAAGTTTTGTTAGGG 0: 1
1: 0
2: 0
3: 21
4: 146
945036403_945036409 30 Left 945036403 2:205707521-205707543 CCAAACTGTCCCCTACTTGGATT 0: 1
1: 0
2: 0
3: 9
4: 110
Right 945036409 2:205707574-205707596 GCATCTTCCAAGTTTTGTTAGGG 0: 1
1: 0
2: 0
3: 21
4: 146
945036406_945036409 20 Left 945036406 2:205707531-205707553 CCCTACTTGGATTTCTGCATGGC 0: 1
1: 0
2: 0
3: 16
4: 142
Right 945036409 2:205707574-205707596 GCATCTTCCAAGTTTTGTTAGGG 0: 1
1: 0
2: 0
3: 21
4: 146
945036404_945036409 21 Left 945036404 2:205707530-205707552 CCCCTACTTGGATTTCTGCATGG 0: 1
1: 0
2: 1
3: 17
4: 172
Right 945036409 2:205707574-205707596 GCATCTTCCAAGTTTTGTTAGGG 0: 1
1: 0
2: 0
3: 21
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945036409 Original CRISPR GCATCTTCCAAGTTTTGTTA GGG Intronic
901948111 1:12719734-12719756 CATTCTTCCAAGTTATGTTAAGG - Intronic
904015697 1:27418678-27418700 GAATCTTCCAAGTACTTTTATGG + Intronic
905702769 1:40031051-40031073 GACTCTTACAAGTTTTCTTAGGG - Intergenic
909220163 1:72948632-72948654 GCATGTTCCAAGTGGTGATAAGG - Intergenic
910857802 1:91713287-91713309 GCTACGTCCAAATTTTGTTAAGG + Intronic
910906142 1:92181272-92181294 GTATCTTCCAAGTGTTTTTCGGG + Exonic
911415224 1:97563484-97563506 GCATGTAACAAGTTTTGTTAGGG - Intronic
911417589 1:97594761-97594783 ACATCTTCCAATGTTTGTTAAGG + Intronic
913362414 1:117996688-117996710 TCATCTTCCAATTTTTTTTCAGG + Exonic
915102335 1:153509404-153509426 TCATCTTCCAAGATTTGTGTGGG + Intergenic
915850480 1:159316504-159316526 GCATATTCCAAGTTATGTTGGGG + Intergenic
920739646 1:208568477-208568499 GCTTCTTCCATATTTTCTTAGGG - Intergenic
921283739 1:213590916-213590938 TCCTCTTCCAAGTTTTGCTCAGG - Intergenic
921610122 1:217202975-217202997 GCCTTTTCCAAATTTGGTTATGG + Intergenic
923462846 1:234222192-234222214 GCATCTTCCAAGCTTTGCCTGGG + Intronic
1064855535 10:19763405-19763427 GCATCTAATAAGTTTTGATATGG + Intronic
1066791186 10:39065606-39065628 GCATCTTTCTAGTTTTGTTCTGG + Intergenic
1068754674 10:60638361-60638383 GCTGCTTGTAAGTTTTGTTATGG - Intronic
1075180851 10:120209700-120209722 GCATCTACCAAGTTGGCTTAGGG + Intergenic
1075220483 10:120580333-120580355 GCTTCTTCCAATTGTTGTCATGG + Intronic
1075251669 10:120882977-120882999 GTATCCTACAATTTTTGTTATGG + Intronic
1075578923 10:123601932-123601954 GCTTCTTCCATGTTTTTTTGTGG + Intergenic
1079462688 11:20697796-20697818 ACATCTTCCAAGGTCTGTTCAGG - Intronic
1081910871 11:46699136-46699158 ACATCTCCTAAGTTTTCTTAGGG - Intronic
1082292502 11:50394512-50394534 GCTTCTTTCTAGTTTTTTTATGG - Intergenic
1084343200 11:68523163-68523185 GAATTTTGCAAATTTTGTTAGGG - Intronic
1087950508 11:104214893-104214915 GCATATACCCAGTTTTCTTAGGG + Intergenic
1088079320 11:105891567-105891589 TCCTCTTCCCAGTTTTGTTTAGG + Intronic
1090544137 11:127744114-127744136 GGCTCTTCCATGTTTTTTTATGG + Intergenic
1092699411 12:11210776-11210798 GCTGCTTCCAAGTTTTGACAAGG - Intergenic
1093069727 12:14696279-14696301 GCATCTTCCAAGTTTTTCAGGGG + Exonic
1093397414 12:18700357-18700379 CCATTTCCCAAGTTTTGTTTTGG + Intronic
1094480179 12:30875240-30875262 ACATCTTCCAAGTTGAGTTTGGG - Intergenic
1095074852 12:37906303-37906325 GAATCTTCCAAGTTATTTTTGGG - Intergenic
1095431865 12:42143549-42143571 GCATTTGCCAAGTCTTGGTAGGG + Intronic
1098614168 12:72502532-72502554 GAATCTTCCTAGATTTATTATGG + Intronic
1100682438 12:96942017-96942039 GAATTTTACAATTTTTGTTATGG + Intronic
1101222503 12:102656025-102656047 GCATCTTTCAAGTTCTTTTATGG - Intergenic
1102415316 12:112757183-112757205 GCATCTTTCCAGTTTTATTTGGG - Intronic
1104532658 12:129586999-129587021 GCATTTTCCAACTTATTTTATGG - Intronic
1105697569 13:22903835-22903857 GCATTTTCCAAGTATGGTTTTGG - Intergenic
1106717993 13:32410912-32410934 GCTACTTACAAGTTTTGTTTTGG + Intronic
1108339629 13:49485608-49485630 ACATCTTCCTTGTTTTTTTAAGG + Exonic
1108833724 13:54513616-54513638 TCATCTTCTAATTTTTTTTAGGG - Intergenic
1112175139 13:97015066-97015088 GCATCCACCAAGTTTTATTCAGG - Intergenic
1114337424 14:21705897-21705919 GCATATCATAAGTTTTGTTATGG + Intergenic
1118338721 14:64877904-64877926 GCTTCTTCCAAGTGTTCTGAAGG - Intronic
1119684821 14:76623248-76623270 TCATCTTCCAAGTTGTCTTGGGG - Intergenic
1120040399 14:79746441-79746463 GCAGCTTCCAAGACTTGTTATGG - Intronic
1120464538 14:84839771-84839793 GCATCTTCCATGTGTTTTCATGG - Intergenic
1120990869 14:90375802-90375824 GCATTTGCTAAGTTTTATTATGG - Intergenic
1121000260 14:90446848-90446870 GCATATTTTAAGTTTTGTTATGG - Intergenic
1121642671 14:95496155-95496177 GCATCTCCCAAGCTTTGGAAAGG - Intergenic
1126690328 15:51284147-51284169 GCTGCTTCCTAGTTTTGTTTAGG - Intronic
1129140403 15:73592703-73592725 GCATTTTCCAAATTTTGTGGAGG + Intronic
1135181233 16:20276301-20276323 GCATTTCCCAAGATTTGTTCTGG + Intergenic
1137915573 16:52426269-52426291 GCATCTTCAAAGTTATTGTAGGG - Intergenic
1144317718 17:14079013-14079035 CCATATTCCAAGTTTTGAAAAGG - Intronic
1149895798 17:60427326-60427348 GCAACTTCCAAGTATTGCTATGG + Intronic
1150887770 17:69107483-69107505 GCATCTACCAAGTTTCCTTTTGG - Intronic
1153022761 18:646382-646404 GCATCTACTAAGTTTAGATACGG + Intronic
1155761994 18:29579776-29579798 GCATCTTCCAAGAGATGTGAAGG + Intergenic
1157277275 18:46320356-46320378 ACATCTTCCAAGTTTGGTTTTGG - Intergenic
1158813760 18:61069773-61069795 GCATCTTAAAAGTTTCATTATGG + Intergenic
1158837939 18:61351147-61351169 GTGTCTTCCAAGATTTGTTAGGG - Intronic
1159238121 18:65704276-65704298 GCAGCTTCCAAGTTTTCTGTTGG - Intergenic
1164331304 19:24260291-24260313 GCTTCTTCCTAGTTTTTATATGG + Intergenic
1167775304 19:51550758-51550780 CCTTCTTCCAAGTTTTGACAGGG + Intergenic
1168173052 19:54602437-54602459 GCATCTTCCAAGTTCTAGTTTGG + Intronic
930463908 2:51720165-51720187 GCATCTTCAAAGTTGTTTTCAGG - Intergenic
931821528 2:65956872-65956894 GCACCTTCCATGTCTTGTAAGGG - Intergenic
932347805 2:71007174-71007196 GCATCTACCCAGTTTTTTTGAGG + Intergenic
938663289 2:133508816-133508838 GCATGTTCCATGTGTTCTTAGGG - Intronic
939648018 2:144725058-144725080 TTAATTTCCAAGTTTTGTTAAGG - Intergenic
942413269 2:175733635-175733657 GCATATTCCAAGTTTTGTCCTGG + Intergenic
945036409 2:205707574-205707596 GCATCTTCCAAGTTTTGTTAGGG + Intronic
1171175128 20:23046510-23046532 GCAGCTTCCAATTCTTGTTCAGG + Exonic
1173274844 20:41571254-41571276 GCAACTTCTAAGCTTTTTTATGG - Intronic
1174547785 20:51338802-51338824 GCAACTTCCAGGTGTTGCTATGG + Intergenic
1174680455 20:52401643-52401665 GCATATTGCCAGGTTTGTTATGG + Intergenic
1174868143 20:54158038-54158060 GTATCTTCCAAGGTTTTGTAAGG + Intronic
1178274041 21:31219662-31219684 TCATCTTCCTATTTTTGTTTGGG - Intronic
1178749857 21:35291732-35291754 GGATTTTCCAAGATTTGTAAAGG - Intronic
1182466038 22:30516870-30516892 GTAACTCCCAAGTGTTGTTATGG + Intergenic
951129851 3:19029573-19029595 CCATCTTTCAAGTTTATTTAAGG - Intergenic
951428616 3:22580137-22580159 GCATCTTCTAAGATTTTTCAAGG - Intergenic
953204556 3:40812893-40812915 ACATCTTCCAATTTTTGCTGAGG + Intergenic
953616392 3:44494224-44494246 GCCTCTTCCAAGTCTTTTAAGGG - Intergenic
956535913 3:70276422-70276444 GCATATGCAAAGATTTGTTATGG - Intergenic
957670689 3:83297988-83298010 GCTTTTTACAAGTTTTGATATGG - Intergenic
958545682 3:95546971-95546993 GCATCTTACAAATTTTGATATGG + Intergenic
958558751 3:95714978-95715000 GCATGTTTCAAGTTGTATTATGG - Intergenic
959250458 3:103935305-103935327 TCATCTTCAAACTTTTGTTGTGG + Intergenic
959320869 3:104873552-104873574 GAAGCTGCCAAGTTTTCTTAAGG + Intergenic
960780963 3:121316077-121316099 GTATCTTCCAAGTTTTCTAGAGG + Intronic
962441676 3:135425016-135425038 GAATCTTCAAAGTTTTGGTATGG - Intergenic
967695061 3:192521381-192521403 TCATCTTTAAAGTTTTCTTATGG - Intronic
970435375 4:16028879-16028901 ACATCTTCCATATTTTATTATGG + Intronic
971475602 4:27068927-27068949 GCATCTTCCAAAATGTTTTAGGG - Intergenic
973103272 4:46297904-46297926 GCATCTCGTAAGTTTTGGTATGG + Intronic
974104330 4:57451739-57451761 GTTTATTCCAAGTTTTCTTATGG + Intergenic
975539626 4:75493836-75493858 GCAACTTCCAAGTTAGTTTATGG - Intronic
976985435 4:91290059-91290081 GCATCTTTAAAGTTTTGAGAGGG + Intronic
978151259 4:105438292-105438314 TCATCTTCCAAGTTCAGTCAGGG + Intronic
979287715 4:118945005-118945027 GCATGTTTCAAGTTTTATTAAGG - Intronic
979875101 4:125879769-125879791 GCATATCACAAGTTTTGGTATGG - Intergenic
980948679 4:139349294-139349316 TCATTTACCAAGTTATGTTATGG - Intronic
981119824 4:141037422-141037444 TCTTCTTCCAAATTTTCTTAAGG - Intronic
982271001 4:153588088-153588110 GAATCTTCCAATTTTTCCTATGG - Intronic
987615890 5:20274661-20274683 TTATCTTCCTAGTTTTGATACGG - Intronic
990055635 5:51573778-51573800 GCATCTTTCAAGTATTGTAGAGG + Intergenic
993978987 5:94519099-94519121 GCATCTGCCAAATTCGGTTATGG - Intronic
994962014 5:106617367-106617389 GCATCTTCTAAGTTGTGCTACGG - Intergenic
996175090 5:120346827-120346849 GAATCTTCCAAATTTTCTTCTGG - Intergenic
996893391 5:128450507-128450529 GCATCCTGCAAATTTTGATATGG - Intronic
996929176 5:128865801-128865823 GTATCTTCAAAGCTTTGTGAAGG + Intronic
1001799827 5:174533311-174533333 GCATGTCCCAAGCTTTGTTCTGG + Intergenic
1003450413 6:6226098-6226120 GCATCTTGCCAGTTTTTTTCTGG + Intronic
1003850513 6:10217802-10217824 GCAATTTCCACTTTTTGTTATGG + Intergenic
1009331441 6:62425761-62425783 GCATTTTGCAAGTTTTGAGAGGG - Intergenic
1009512976 6:64576101-64576123 GCATTTTCCAAGATTTTTAAAGG - Intronic
1010991024 6:82480071-82480093 GCATCTTCCAAGATTGGGGAAGG - Intergenic
1011790485 6:90893500-90893522 GCATCCTCCAAGTCTCGTTCTGG - Intergenic
1017290712 6:152732846-152732868 GCATCTTCCATGTTCTGACAGGG - Intergenic
1019047304 6:169159039-169159061 GCAGCTTCCAAGCTCTGGTAAGG - Intergenic
1020875553 7:13689219-13689241 TCATATTCCAAGTTTTCTGAAGG + Intergenic
1021035946 7:15799142-15799164 GCATCTTTTCAGTTTTGTTGAGG - Intergenic
1021593691 7:22292383-22292405 GTATCTTGCAATTTTTGTAAAGG - Intronic
1022548179 7:31208693-31208715 GCATCATCCAAGTCTTCTTAGGG + Intergenic
1024190925 7:47008909-47008931 ACATCTTCGAGGTTTTATTATGG - Intergenic
1025534252 7:61928514-61928536 GCATCTTTCTAGTTTTTTTCTGG - Intergenic
1025536614 7:61956201-61956223 GCTTCTTCCTAGTTTTCATATGG - Intergenic
1028712395 7:93924189-93924211 GCAACTTGCAAGTTTTGTCTGGG - Intronic
1030211088 7:106996384-106996406 GCGTCTTCCAGGTTTTCTGAGGG + Intergenic
1033187709 7:139244020-139244042 GTATCTTCCGAGTTTTATTAAGG - Intronic
1036406498 8:8460119-8460141 GCATCATCCTAGTTCTGTTGAGG - Intergenic
1038689394 8:29747405-29747427 GCATCTTCAAAGTATTCATATGG + Intergenic
1039642742 8:39241556-39241578 GCAGCTTCCATGTGTTGTTGAGG - Intronic
1040115956 8:43619392-43619414 GCATCTTTCTAGTTTTTATATGG - Intergenic
1040117059 8:43634140-43634162 GCATCTTTCAAGTTTTGATCTGG - Intergenic
1040125738 8:43735331-43735353 GCTTCTTCCTAGTTTTTTTCTGG - Intergenic
1040127614 8:43755904-43755926 GCTTCTTTCAAGTTTTTTTATGG - Intergenic
1040327497 8:46360112-46360134 GCGTCTTCCTAGTTTTATTGTGG + Intergenic
1040346386 8:46502731-46502753 GCTTCTTTCAAGTTTTTTTTTGG + Intergenic
1043722235 8:83559259-83559281 GGATCTGACAAGTTTTGTTTAGG - Intergenic
1043819937 8:84850391-84850413 GCATTTTCAATGTTTTATTATGG - Intronic
1043913011 8:85885664-85885686 GCATGATCCAACTTTTGTTTGGG - Intergenic
1044479912 8:92673674-92673696 GCATTTTCCAGGTTCTGTTGTGG + Intergenic
1045162539 8:99564668-99564690 CCATCTTCCAAATGTTGTTAAGG + Intronic
1046457269 8:114483498-114483520 GCATCTCCCAACTTATGTAACGG + Intergenic
1050981060 9:12016711-12016733 GCATATTCCAAGCATTTTTAAGG + Intergenic
1052589142 9:30468509-30468531 GGATCTTACAAGTGTTTTTATGG - Intergenic
1058770300 9:108224670-108224692 GCATCCTCCAAGTCTTGGCATGG - Intergenic
1187518929 X:19996657-19996679 GCAACTACCAAATTTTGTTTAGG - Intergenic
1187662481 X:21565053-21565075 TCATCTTCAAACTTTTGTTCAGG - Intronic
1187703325 X:21985646-21985668 TCATTTTCAAAATTTTGTTAAGG - Intronic
1190239974 X:48650236-48650258 GCCTCTTCCATGTCTTTTTATGG + Intergenic
1190633675 X:52413455-52413477 GGTTCTTCAAAGTTTTTTTAAGG + Intergenic
1191017268 X:55822486-55822508 GTCTCTTCCAGGTTTTGGTATGG + Intergenic
1191116430 X:56857805-56857827 GCAGCTTCCAAGTGGTGTTGAGG - Intergenic
1191260767 X:58317946-58317968 GCTTCTTCCTAGTTTTTTTCTGG - Intergenic
1193050626 X:77095776-77095798 GCATTTTTCAAATTTAGTTAAGG + Intergenic
1193858138 X:86630895-86630917 GCATCCTCCAACTGTTGTTTTGG + Intronic
1194659285 X:96611630-96611652 GCATTTTGAAAGTCTTGTTATGG - Intergenic
1195630359 X:107049430-107049452 GCATCTGCCAAGTCTGGGTATGG - Intergenic
1197810940 X:130442286-130442308 CCATCTTTCAAGTTTTTTTAAGG + Intergenic
1198684143 X:139209946-139209968 GCATCTGCCAAGTTTCTTAAAGG - Intronic
1200362166 X:155619055-155619077 CAATCTACCAAGTTTTTTTATGG + Intronic