ID: 945041900

View in Genome Browser
Species Human (GRCh38)
Location 2:205749430-205749452
Sequence GGCCACGAGACAATAATGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 735
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 724}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945041900_945041910 23 Left 945041900 2:205749430-205749452 CCCTCCATTATTGTCTCGTGGCC 0: 1
1: 0
2: 0
3: 10
4: 724
Right 945041910 2:205749476-205749498 TGCTGTGGAGTAAAGAATGTGGG 0: 1
1: 0
2: 2
3: 22
4: 250
945041900_945041904 -5 Left 945041900 2:205749430-205749452 CCCTCCATTATTGTCTCGTGGCC 0: 1
1: 0
2: 0
3: 10
4: 724
Right 945041904 2:205749448-205749470 TGGCCTTTTGTGCTAAACTCGGG 0: 1
1: 0
2: 1
3: 10
4: 108
945041900_945041903 -6 Left 945041900 2:205749430-205749452 CCCTCCATTATTGTCTCGTGGCC 0: 1
1: 0
2: 0
3: 10
4: 724
Right 945041903 2:205749447-205749469 GTGGCCTTTTGTGCTAAACTCGG 0: 1
1: 0
2: 0
3: 1
4: 96
945041900_945041905 -4 Left 945041900 2:205749430-205749452 CCCTCCATTATTGTCTCGTGGCC 0: 1
1: 0
2: 0
3: 10
4: 724
Right 945041905 2:205749449-205749471 GGCCTTTTGTGCTAAACTCGGGG 0: 1
1: 0
2: 0
3: 3
4: 44
945041900_945041907 8 Left 945041900 2:205749430-205749452 CCCTCCATTATTGTCTCGTGGCC 0: 1
1: 0
2: 0
3: 10
4: 724
Right 945041907 2:205749461-205749483 TAAACTCGGGGCCTCTGCTGTGG 0: 1
1: 0
2: 0
3: 5
4: 85
945041900_945041909 22 Left 945041900 2:205749430-205749452 CCCTCCATTATTGTCTCGTGGCC 0: 1
1: 0
2: 0
3: 10
4: 724
Right 945041909 2:205749475-205749497 CTGCTGTGGAGTAAAGAATGTGG 0: 1
1: 0
2: 3
3: 27
4: 238

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945041900 Original CRISPR GGCCACGAGACAATAATGGA GGG (reversed) Intronic
900673945 1:3872444-3872466 GGCCAAAAGACAATGAGGGAAGG - Intronic
901030446 1:6304457-6304479 GGTCACAGGACAATAGTGGAGGG + Intronic
901100265 1:6714570-6714592 GGTCACAGGACAATAGTGGAGGG + Intergenic
901223831 1:7600549-7600571 GGTCACAGGACAATAGTGGAGGG + Intronic
901726853 1:11249481-11249503 GGTCATGGGACAATAGTGGAGGG + Intronic
902062813 1:13658992-13659014 GGTCACAGGACAATAGTGGAGGG - Intergenic
903081916 1:20817174-20817196 GGTCACAGGACAATAGTGGAGGG - Intronic
903100543 1:21024822-21024844 GGTCATGGGACAATAGTGGAGGG - Intronic
903103713 1:21054401-21054423 GGTCACAGGACAATAGTGGAGGG - Intronic
903148689 1:21389686-21389708 GGTCATGGGACAATAGTGGAGGG - Intergenic
903525753 1:23992782-23992804 GGTCATGGGACAATAGTGGAGGG + Intergenic
903531085 1:24031489-24031511 GGTCACAGGACAATAGTGGAGGG + Intergenic
903634452 1:24800995-24801017 GGTCATGGGACAATAGTGGAGGG - Intronic
903748695 1:25604867-25604889 GGTCACAGGACAATAGTGGAGGG - Intergenic
904078120 1:27855015-27855037 GGTCATGGGACAATAGTGGAGGG - Intergenic
904795511 1:33053398-33053420 GGTCATGGGACAATAGTGGAGGG - Intronic
905192018 1:36243260-36243282 GGTCACAGGACAATAGTGGAGGG + Intronic
905427772 1:37897665-37897687 GGTCACAGGACAATAGTGGAGGG - Intronic
905527230 1:38648244-38648266 GGTCACAGGACAATAGTGGAGGG - Intergenic
905686471 1:39912540-39912562 GGTCACAGGACAATAGTGGAGGG + Intergenic
905699495 1:40000548-40000570 GGTCATGGGACAATAGTGGAGGG - Intergenic
906036206 1:42751500-42751522 GGTCACAGGACAATAGTGGAGGG - Intronic
906050292 1:42865793-42865815 GACCACAATACAATAATAGATGG + Intergenic
906487474 1:46242866-46242888 GGTCATGGGACAATAGTGGAGGG - Intergenic
906957022 1:50382490-50382512 GGTCACAGGACAATAGTGGAGGG - Intergenic
907140773 1:52182681-52182703 GGTCACAGGACAATAGTGGAGGG - Intronic
907402701 1:54234278-54234300 GGTCATGGGACAATAGTGGAGGG - Intronic
907453315 1:54561165-54561187 GGTCATGGGACAATAGTGGAGGG + Intronic
909478709 1:76111501-76111523 GGTCACAGGACAATAGTGGAGGG + Intronic
910344224 1:86217249-86217271 GGTCATGGGACAATAGTGGAGGG - Intergenic
910379010 1:86605941-86605963 GGCCCTGATACAATAATGGCTGG - Intergenic
911601928 1:99856507-99856529 GGTCATAAGACAATAGTGGAGGG + Intronic
912116471 1:106413279-106413301 GGTCATAGGACAATAATGGAGGG - Intergenic
912266040 1:108159528-108159550 GGTCACAGGACAATAGTGGAGGG + Intronic
912297965 1:108488410-108488432 GGTCATGGGACAATAGTGGAGGG + Intergenic
912302837 1:108535539-108535561 GGTCACAGGACAATAGTGGAGGG + Intergenic
912317181 1:108676631-108676653 GGTCATGGGACAATAGTGGAGGG - Intergenic
912371347 1:109176668-109176690 GGTCACAGGACAATAGTGGAGGG + Intronic
912660866 1:111529431-111529453 GGTCACAGGACAATAGTGGAGGG + Intronic
912690369 1:111800473-111800495 GGTCATGGGACAATAGTGGAGGG - Intronic
912808454 1:112774892-112774914 GGTCATGGGACAATAGTGGAGGG - Intergenic
912825002 1:112897688-112897710 GGTCATGGGACAATAGTGGAGGG + Intergenic
912845438 1:113071064-113071086 GGTCATGGGACAATAGTGGAGGG - Intergenic
913305676 1:117428865-117428887 GGTCATGGGACAATAGTGGAGGG + Intronic
914002506 1:143704066-143704088 GGTCACAGGACAATAGTGGAGGG - Intergenic
914774908 1:150728011-150728033 GGTCATGGGACAATAGTGGAGGG + Intergenic
914780774 1:150782457-150782479 GGTCATGGGACAATAGTGGAGGG - Intergenic
915208532 1:154288343-154288365 GGTCACAGGACAATAGTGGAGGG - Intergenic
915411143 1:155701610-155701632 GGTCATGGGACAATAGTGGAGGG - Intronic
916105151 1:161424231-161424253 GGTCACAGGACAATAGTGGAGGG - Intergenic
917375461 1:174348521-174348543 GGTCATGGGACAATAGTGGAGGG + Intronic
917860235 1:179136641-179136663 GGTCACAGGACAATAGTGGAGGG - Intronic
918166636 1:181955401-181955423 GGTCACAGGACAATAGTGGAGGG - Intergenic
918228433 1:182508749-182508771 GGTCATGGGACAATAGTGGAGGG + Intronic
919080364 1:192858316-192858338 GGTCACAGGACAATAGTGGAGGG - Intergenic
919424040 1:197406507-197406529 GGTCACAGGACAATAGTGGAGGG - Intronic
919925694 1:202190885-202190907 GGTCACAGGACAATAGTGGAGGG + Intergenic
920152061 1:203918628-203918650 GGTCACAGGACAATAGTGGAGGG + Intergenic
920747473 1:208642772-208642794 GGCCAGGAGACAAAACTGGTCGG + Intergenic
920749320 1:208658999-208659021 GGTCATGGGACAATAGTGGAGGG + Intergenic
921142240 1:212320012-212320034 GGTCACAGGACAATAGTGGAGGG + Intronic
921413906 1:214868663-214868685 GGTCATGGGACAATAGTGGAGGG + Intergenic
921638205 1:217523236-217523258 GGTCACAGGACAATAGTGGAGGG + Intronic
921654772 1:217721795-217721817 AGCCTTGAGACAATAAGGGATGG - Intronic
921845281 1:219872871-219872893 GGTCATGGGACAATAGTGGAGGG + Intronic
922278667 1:224101649-224101671 GGTCACAGGACAATAGTGGAGGG - Intergenic
922503638 1:226114362-226114384 GGTCACAGGACAATAGTGGAGGG + Intergenic
922692895 1:227710065-227710087 GGTCACAGGACAATAGTGGAGGG + Intergenic
923268262 1:232333019-232333041 GGTCACAGGACAATAGTGGAGGG - Intergenic
923711183 1:236387931-236387953 GGTCATGGGACAATAGTGGAGGG - Intronic
924178378 1:241416170-241416192 GGTCATGGGACAATAGTGGAGGG - Intergenic
924524804 1:244836278-244836300 GGCCAGCGGACAATAGTGGAAGG - Intronic
1063811497 10:9714057-9714079 TGCCAAGAGAAAATAATAGAAGG + Intergenic
1064108111 10:12518550-12518572 GGTCACAGGACAATAGTGGAGGG + Intronic
1064108919 10:12522260-12522282 GGTCACAGGACAATAGTGGAGGG + Intronic
1064615991 10:17156903-17156925 GGTCAAGAGACAGAAATGGAAGG + Intronic
1064663349 10:17628415-17628437 GGTCATGGGACAATAGTGGAGGG + Intergenic
1065012369 10:21431131-21431153 GGTCATGGGACAATAGTGGAGGG - Intergenic
1065336533 10:24657982-24658004 GGTCATGGGACAATAGTGGAGGG - Intronic
1065594099 10:27295624-27295646 GGTCATGGGACAATAGTGGAGGG + Intergenic
1066437255 10:35406292-35406314 GGTCACAGGACAATAGTGGAGGG + Intronic
1066953039 10:42138932-42138954 GGTCATGGGACAATAGTGGAGGG - Intergenic
1067331859 10:45330143-45330165 GGTCATAGGACAATAATGGAGGG + Intergenic
1068005791 10:51392194-51392216 GGTCATAGGACAATAATGGAGGG + Intronic
1068668187 10:59697664-59697686 GGTCACAGGACAATAGTGGAGGG - Intronic
1069365939 10:67692671-67692693 GGTCACAGGACAATAGTGGAGGG - Intronic
1069698814 10:70407177-70407199 GGTCACAGGACAATAGTGGAGGG + Intronic
1069740847 10:70686348-70686370 GGTCATGGGACAATAGTGGAGGG + Intronic
1069928678 10:71868721-71868743 GGTCACAGGACAATAGTGGAGGG + Intergenic
1070135642 10:73690540-73690562 GGTCACAGGACAATAGTGGAGGG - Intronic
1070317758 10:75332538-75332560 GGTCATGGGACAATAGTGGAGGG + Intergenic
1070966896 10:80535491-80535513 GGTCACAGGACAATAGTGGAGGG - Intergenic
1071138358 10:82478316-82478338 GGTCATGGGACAATAGTGGAGGG + Intronic
1072117434 10:92377364-92377386 GGTCATGGGACAATAGTGGAGGG - Intergenic
1072149417 10:92673793-92673815 GGTCATGGGACAATAGTGGAGGG + Intergenic
1072648926 10:97277528-97277550 GGTCATGGGACAATAGTGGAGGG - Intronic
1072949187 10:99837535-99837557 GGTCATGGGACAATAGTGGAGGG + Intronic
1072956669 10:99892689-99892711 GGTCATGGGACAATAGTGGAGGG - Intronic
1072980681 10:100094476-100094498 GGTCATGGGACAATAGTGGAGGG - Intergenic
1073274789 10:102301044-102301066 GGTCACAGGACAATAGTGGAGGG + Intronic
1073386613 10:103130486-103130508 GGTCATGGGACAATAGTGGAGGG - Intronic
1073865735 10:107801464-107801486 GGTCACAGGACAATAGTGGAGGG - Intergenic
1074588274 10:114788261-114788283 GGTCACAGGACAATAGTGGAGGG - Intergenic
1075129047 10:119723006-119723028 GGTCATGGGACAATAGTGGAGGG - Intergenic
1075136801 10:119794081-119794103 GGTCACAGGACAATAGTGGAGGG + Intronic
1075407132 10:122202722-122202744 GGTCACAGGACAATAGTGGAGGG + Intronic
1075685705 10:124363956-124363978 GCGGACGAGAGAATAATGGAAGG - Intergenic
1076914276 10:133413978-133414000 GGTCACAGGACAATAGTGGAGGG + Intronic
1077397767 11:2333403-2333425 GGTCATGGGACAATAGTGGAGGG - Intergenic
1079039562 11:17049664-17049686 GGTCATGGGACAATAGTGGAGGG + Intergenic
1079371703 11:19859203-19859225 GGTCACAGGACAATAGTGGAGGG + Intronic
1080098461 11:28431711-28431733 GGTCATGGGACAATAGTGGAGGG - Intergenic
1080404983 11:31971099-31971121 GGTCACAGGACAATAGTGGAGGG + Intronic
1080770257 11:35334156-35334178 GTCAAGGAGACAATAAGGGATGG - Intronic
1080860456 11:36145937-36145959 GGTCACAGGACAATAGTGGAGGG - Intronic
1081289372 11:41305835-41305857 GGTCATGGGACAATAGTGGAGGG - Intronic
1081627573 11:44664555-44664577 GGTCATGGGACAATAGTGGAGGG - Intergenic
1081784493 11:45737589-45737611 GGTCATGGGACAATAGTGGAGGG + Intergenic
1081950032 11:47037449-47037471 GGTCACAGGACAATAGTGGAGGG + Intronic
1081956647 11:47098238-47098260 GGTCATGGGACAATAGTGGAGGG - Intronic
1082232972 11:49791806-49791828 GGTCACAGGACAATAGTGGAGGG + Intergenic
1083131167 11:60623577-60623599 GGTCACAGGACAATAGTGGAGGG - Intergenic
1083154889 11:60816288-60816310 GGTCATGGGACAATAGTGGAGGG - Intergenic
1083338465 11:61942389-61942411 GGTCATGGGACAATAGTGGAGGG - Intergenic
1083382812 11:62280226-62280248 GGTCATGGGACAATAGTGGAGGG - Intergenic
1083645541 11:64170814-64170836 GGTCATGGGACAATAGTGGAGGG + Intergenic
1083739856 11:64702732-64702754 GGTCACAGGACAATAGTGGAGGG - Intronic
1083832255 11:65240234-65240256 GGTCATGGGACAATAGTGGAGGG - Intergenic
1084140126 11:67222136-67222158 GGTCATGGGACAATAGTGGAGGG + Intronic
1084388942 11:68862274-68862296 GGTCATAGGACAATAATGGAGGG - Intergenic
1084745382 11:71166851-71166873 GGTCACAGGACAATAGTGGAGGG + Intronic
1084924454 11:72501576-72501598 GGTCATGGGACAATAGTGGAGGG + Intergenic
1085359772 11:75876911-75876933 GGTCATGGGACAATAGTGGAGGG + Intronic
1085448926 11:76619773-76619795 GGTCACAGGACAATAGTGGAGGG - Intergenic
1085512924 11:77097533-77097555 GGTCATGGGACAATAGTGGAGGG + Intronic
1086591386 11:88518961-88518983 GGCCACAAAACAAAAATGTATGG - Intronic
1086785275 11:90961536-90961558 TGCCAAGAGACTATAAAGGAGGG + Intergenic
1086881843 11:92158836-92158858 GGTCATAGGACAATAATGGAGGG - Intergenic
1087198040 11:95320292-95320314 GGTCATGGGACAATAGTGGAGGG + Intergenic
1087380242 11:97396538-97396560 GGCCTCAATACAATAATAGATGG - Intergenic
1087486955 11:98769654-98769676 GGTCATAGGACAATAATGGAGGG + Intergenic
1087948891 11:104195558-104195580 GGTCATGGGACAATAGTGGAGGG - Intergenic
1089264622 11:117250677-117250699 GGTCACAGGACAATAGTGGAGGG + Intronic
1089420571 11:118330348-118330370 GGTCATGGGACAATAGTGGAGGG + Intergenic
1089585339 11:119507052-119507074 GGTCATGGGACAATAGTGGAGGG + Intergenic
1089808169 11:121110368-121110390 GGCAACGAGTCAATTGTGGAGGG + Intronic
1090060823 11:123462813-123462835 GGTCATGGGACAATAGTGGAGGG - Intergenic
1090323475 11:125864608-125864630 GGTCATGGGACAATAGTGGAGGG - Intergenic
1090762150 11:129847470-129847492 GGTCACAGGACAATAGTGGAGGG + Intronic
1090790592 11:130090326-130090348 GGTCATGGGACAATAGTGGAGGG + Intronic
1091213773 11:133886992-133887014 GGCCTGGAGACAAGAAGGGAAGG - Intergenic
1091762179 12:3094933-3094955 GGTCATGGGACAATAGTGGAGGG + Intronic
1092402106 12:8185283-8185305 GGTCACAGGACAATAGTGGAGGG - Intronic
1092591326 12:9954141-9954163 GGTCATGGGACAATAGTGGAGGG - Intronic
1092827265 12:12412969-12412991 GGTCATGGGACAATAGTGGAGGG + Intronic
1092843970 12:12566839-12566861 GGTCACAGGACAATAGTGGAGGG - Intergenic
1092849913 12:12617732-12617754 GGTCACAGGACAATAGTGGAGGG + Intronic
1093453451 12:19340880-19340902 GGTCACAGGACAATAGTGGAGGG - Intronic
1093842770 12:23924952-23924974 GGTCACAGGACAATAGTGGAGGG - Intronic
1093935389 12:24995133-24995155 GGTCACAGGACAATAGTGGAGGG + Intronic
1094039414 12:26107161-26107183 GGACACCAGACAATAAAGAAAGG - Intergenic
1094520313 12:31180306-31180328 GGTCACAGGACAATAGTGGAGGG + Intergenic
1095068397 12:37813788-37813810 GGTCATGGGACAATAGTGGAGGG + Intergenic
1095166093 12:38973807-38973829 GGCCACGAGAATAAAAAGGAGGG - Intergenic
1095280964 12:40352524-40352546 GGTCATAGGACAATAATGGAGGG + Intronic
1095440056 12:42229343-42229365 GGTCATGGGACAATAGTGGAGGG - Intronic
1096021823 12:48331764-48331786 GGTCATGGGACAATAGTGGAGGG + Intergenic
1096082710 12:48843229-48843251 GGTCACAGGACAATAGTGGAGGG - Intronic
1096092877 12:48915174-48915196 GGTCACAGGACAATAGTGGAGGG + Intronic
1096441347 12:51645884-51645906 GGTCACAGGACAATAGTGGAGGG - Intronic
1096557205 12:52410618-52410640 GGTCACAGGACAATAGTGGAGGG - Intergenic
1097028346 12:56075158-56075180 GGTCATGGGACAATAGTGGAGGG + Intergenic
1098019334 12:66135993-66136015 GGTCATGGGACAATAGTGGAGGG - Intronic
1098242701 12:68484848-68484870 GGTCACAGGACAATAGTGGAGGG - Intergenic
1098717735 12:73853277-73853299 GGTCATGGGACAATAGTGGAGGG + Intergenic
1100577431 12:95906886-95906908 GGTCACAGGACAATAGTGGAGGG + Intronic
1100582596 12:95949062-95949084 GGTCATGGGACAATAGTGGAGGG - Intronic
1100606888 12:96158833-96158855 GGTCACAGGACAATAGTGGAGGG - Intergenic
1100845579 12:98654892-98654914 GGTCATGGGACAATAGTGGAGGG + Intronic
1101393256 12:104322866-104322888 GGTCATGGGACAATAGTGGAGGG + Intronic
1101562700 12:105873719-105873741 GGTCATGGGACAATAGTGGAGGG - Intergenic
1102578927 12:113873611-113873633 GGTCATGGGACAATAGTGGAGGG - Intronic
1103299573 12:119917868-119917890 GGTCATGGGACAATAGTGGAGGG + Intergenic
1103535911 12:121633753-121633775 GGTCATGGGACAATAGTGGAGGG + Intronic
1103591624 12:121994889-121994911 GGTCATGGGACAATAGTGGAGGG - Intronic
1103682813 12:122708318-122708340 GGTCACAGGACAATAGTGGAGGG + Intergenic
1103872391 12:124101209-124101231 GGTCACAGGACAATAGTGGAGGG + Intronic
1104861329 12:131925798-131925820 GGTCACAGGACAATAGTGGAGGG + Intergenic
1105248628 13:18674635-18674657 GGTCACAGGACAATAGTGGAGGG - Intergenic
1105248639 13:18674682-18674704 GGTCACAGGACAATAGTGGAGGG - Intergenic
1105368243 13:19780742-19780764 GGTCATGGGACAATAGTGGAGGG - Intronic
1105556277 13:21449149-21449171 GGTCATGGGACAATAGTGGAGGG - Intronic
1106559832 13:30838646-30838668 GGTCACAGGACAATAGTGGAGGG + Intergenic
1107042926 13:35967758-35967780 GGTCATAGGACAATAATGGAGGG - Intronic
1107493518 13:40901827-40901849 GGTCACAGGACAATAGTGGAGGG - Intergenic
1107499270 13:40956509-40956531 GGTCACAGGACAATAGTGGAGGG - Intronic
1107692604 13:42967211-42967233 GGTCATGGGACAATAGTGGAGGG - Intronic
1107807667 13:44169757-44169779 GGCCCCAATACAATAATGGCTGG - Intergenic
1107953134 13:45484663-45484685 GGTCATGGGACAATAGTGGAGGG + Intronic
1108024532 13:46163567-46163589 GGTCACAGGACAATAGTGGAGGG - Intronic
1108059038 13:46514958-46514980 GGTCATGGGACAATAGTGGAGGG + Intergenic
1108330718 13:49379627-49379649 GGTCATGGGACAATAGTGGAGGG - Intronic
1108351705 13:49594155-49594177 GGTCATGGGACAATAGTGGAGGG - Intergenic
1108685976 13:52818765-52818787 GGTCACAGGACAATAGTGGAGGG - Intergenic
1110269763 13:73576138-73576160 GGTCATGGGACAATAGTGGAGGG - Intergenic
1111161659 13:84402616-84402638 GGCCACAAACCAAGAATGGAAGG - Intergenic
1111400836 13:87732756-87732778 GGTCATGAGAAAATGATGGAAGG + Intergenic
1112055804 13:95690048-95690070 GGTCACAGGACAATAGTGGAGGG + Intronic
1112077115 13:95927728-95927750 GGTCACAGGACAATAGTGGAGGG + Intronic
1112590169 13:100756006-100756028 GGCCAGGAGTCAATATTGGGAGG + Intergenic
1113478803 13:110605721-110605743 GGTCACAGGACAATAGTGGAGGG + Intergenic
1113735718 13:112677977-112677999 GGTCACAGGACAATAGTGGAGGG + Intronic
1113915370 13:113867636-113867658 GGTCACAGGACAATAGTGGAGGG - Intergenic
1114428421 14:22639916-22639938 GGTCATGGGACAATAGTGGAGGG - Intergenic
1115610056 14:35040190-35040212 GGTCATGGGACAATAGTGGAGGG - Intergenic
1116871819 14:50074843-50074865 GGTCATGGGACAATAGTGGAGGG - Intergenic
1117716775 14:58589080-58589102 GGTCATGGGACAATAGTGGAGGG - Intergenic
1118184415 14:63523640-63523662 GGTCACGGGACAATAGTGGAGGG - Intronic
1118517301 14:66544651-66544673 GGTCACAGGACAATAGTGGAGGG + Intronic
1119158772 14:72435657-72435679 GGCCACGAGACAAGAAATGCAGG - Intronic
1120302132 14:82721261-82721283 AACCAGGAGACAATAATAGATGG - Intergenic
1120411530 14:84163160-84163182 GGACAGGAGACAATTTTGGAAGG - Intergenic
1121306455 14:92910775-92910797 GGTCATGGGACAATAGTGGAGGG + Intergenic
1121961890 14:98267798-98267820 GGCCATGGGACAAGGATGGAAGG - Intergenic
1122212527 14:100181861-100181883 GGTCACAGGACAATAGTGGAGGG - Intergenic
1122238388 14:100345593-100345615 GGTCACAGGACAATAGTGGAGGG - Intronic
1122528837 14:102410392-102410414 GGTCATGGGACAATAGTGGAGGG - Intronic
1122957633 14:105078664-105078686 GGTCATGGGACAATAGTGGAGGG + Intergenic
1122963439 14:105110845-105110867 GGTCATGGGACAATAGTGGAGGG + Intergenic
1124246052 15:28071094-28071116 GGTCATGGGACAATAGTGGAGGG - Intronic
1125017138 15:34947442-34947464 GGTCACAGGACAATAGTGGAGGG - Intronic
1125079657 15:35657502-35657524 GGTCATGGGACAATAGTGGAGGG - Intergenic
1125566987 15:40684179-40684201 GGTCACAGGACAATAGTGGAGGG - Intergenic
1125659667 15:41383966-41383988 GGTCATGGGACAATAGTGGAGGG - Intergenic
1126799592 15:52286872-52286894 GGTCACAGGACAATAGTGGAGGG - Intronic
1127073419 15:55304394-55304416 GGTCATGGGACAATAGTGGAGGG - Intronic
1127154706 15:56111579-56111601 GGTCACAGGACAATAGTGGAGGG - Intronic
1128586718 15:68858961-68858983 GGTCACAGGACAATAGTGGAGGG + Intronic
1128938759 15:71769848-71769870 GGTCATGGGACAATAGTGGAGGG - Intronic
1129428799 15:75482709-75482731 GGTCATGGGACAATAGTGGAGGG - Intronic
1130946040 15:88551786-88551808 GGTCATGGGACAATAGTGGAGGG + Intergenic
1131001071 15:88940811-88940833 GGTCATGGGACAATAGTGGAGGG + Intergenic
1131125757 15:89855458-89855480 GGTCATGGGACAATAGTGGAGGG - Intronic
1131127739 15:89869502-89869524 GGTCATGGGACAATAGTGGAGGG - Intronic
1132777101 16:1600384-1600406 GGTCATGGGACAATAGTGGAGGG - Intronic
1132921697 16:2399374-2399396 GGTCACAGGACAATAGTGGAGGG + Intergenic
1132992100 16:2801403-2801425 GGTCATGGGACAATAGTGGAGGG + Intergenic
1133299594 16:4774417-4774439 GGTCATGGGACAATAGTGGAGGG + Intergenic
1133989358 16:10692553-10692575 GTCCAGGAGAAAATCATGGAAGG - Intronic
1134172272 16:11977557-11977579 GGGCACGGGACAAGAAGGGAAGG - Intronic
1135026653 16:19003963-19003985 GGTCATGGGACAATAGTGGAGGG - Intronic
1136160884 16:28417748-28417770 GGTCATGGGACAATAGTGGAGGG - Intergenic
1136202082 16:28697252-28697274 GGTCATGGGACAATAGTGGAGGG + Intronic
1137244791 16:46693922-46693944 GGTCATGGGACAATAGTGGAGGG + Intronic
1138466918 16:57199972-57199994 GGTCACAGGACAATAGTGGAGGG + Intronic
1138642022 16:58395392-58395414 GGTCACAGGACAATAGTGGAGGG + Intronic
1139233340 16:65308500-65308522 GGCCACGATTCCCTAATGGATGG - Intergenic
1139885796 16:70205885-70205907 GGTCATGGGACAATAGTGGAGGG - Intergenic
1141545825 16:84767841-84767863 GGTCATGGGACAATAGTGGAGGG + Intronic
1141778097 16:86137865-86137887 GGGGAGGCGACAATAATGGAGGG + Intergenic
1142825623 17:2508058-2508080 GGTCACAGGACAATAGTGGAGGG - Intronic
1142830852 17:2547988-2548010 GGTCACAGGACAATAGTGGAGGG + Intergenic
1143206515 17:5143686-5143708 GGTCATGGGACAATAGTGGAGGG - Intronic
1143277187 17:5720908-5720930 GGTCACGGGACAATAGTGGAGGG + Intergenic
1143666905 17:8367865-8367887 GGTCACAGGACAATAGTGGAGGG - Intergenic
1144037777 17:11382842-11382864 GTCCAAGAGCCAAGAATGGATGG + Intronic
1144482288 17:15638179-15638201 GGTCATGGGACAATAGTGGAGGG - Intronic
1144510200 17:15868303-15868325 GGTCACAGGACAATAGTGGAGGG - Intergenic
1144860602 17:18298985-18299007 GGTCACAGGACAATAGTGGAGGG - Intronic
1144934583 17:18887909-18887931 GGTCATGGGACAATAGTGGAGGG + Intronic
1145047033 17:19627186-19627208 GGTCATGGGACAATAGTGGAGGG + Intergenic
1145174359 17:20686021-20686043 GGTCACAGGACAATAGTGGAGGG - Intergenic
1145717406 17:27034757-27034779 GGTCATGGGACAATAGTGGAGGG - Intergenic
1145863261 17:28225210-28225232 GGTCATGGGACAATAGTGGAGGG - Intergenic
1145895511 17:28455473-28455495 GGTCATGGGACAATAGTGGAGGG + Intergenic
1146187644 17:30735790-30735812 GGTCACAGGACAATAGTGGAGGG + Intergenic
1147024336 17:37566566-37566588 GGTCATGGGACAATAGTGGAGGG - Intronic
1147109855 17:38253952-38253974 GGTCATGGGACAATAGTGGAGGG - Intergenic
1147172996 17:38632201-38632223 GGTCACAGGACAATAGTGGAGGG - Intergenic
1147680728 17:42243057-42243079 GGTCACAGGACAATAGTGGAGGG - Intronic
1147785271 17:42973925-42973947 GGTCATGGGACAATAGTGGAGGG - Intronic
1147967198 17:44199690-44199712 GGCGACGGGACAAGAAGGGAGGG - Intronic
1148016557 17:44525676-44525698 GGTCACAGGACAATAGTGGAGGG - Intergenic
1148267407 17:46237641-46237663 GGTCATGGGACAATAGTGGAGGG + Intergenic
1148667635 17:49386729-49386751 GGACAAGAGACAATGAGGGAGGG - Intronic
1149624761 17:58073329-58073351 GGTCACAGGACAATAGTGGAGGG + Intergenic
1149909352 17:60552804-60552826 GGTCATGGGACAATAGTGGAGGG - Intergenic
1150214219 17:63457610-63457632 GGTCACAGGACAATAGTGGAGGG - Intergenic
1150380723 17:64717282-64717304 GGTCACAGGACAATAGTGGAGGG - Intergenic
1150557915 17:66269903-66269925 GGTCATGGGACAATAGTGGAGGG - Intergenic
1150703989 17:67471134-67471156 GGTCATGGGACAATAGTGGAGGG - Intronic
1152487110 17:80601630-80601652 GGTCATGGGACAATAGTGGAGGG + Intronic
1153243309 18:3050346-3050368 GGTCATGGGACAATAGTGGAGGG - Intergenic
1154349999 18:13574886-13574908 GGGCAAGAGACAAAAAGGGAGGG - Intronic
1154440103 18:14382238-14382260 GGTCACAGGACAATAGTGGAGGG + Intergenic
1157640115 18:49203784-49203806 GGTCATGGGACAATAGTGGAGGG - Intronic
1157677083 18:49577080-49577102 GGTCATGGGACAATAGTGGAGGG + Intronic
1157705425 18:49800829-49800851 GCCCACAGGACAATAGTGGAGGG - Intronic
1158148948 18:54344505-54344527 GGTCATGGGACAATAGTGGAGGG - Intronic
1158459082 18:57632140-57632162 GGTCACAGGACAATAGTGGAGGG + Intergenic
1159054334 18:63449834-63449856 GGTCACAGGACAATAATGGAGGG + Intergenic
1160108428 18:76001841-76001863 GGTCACAGGACAATAGTGGAGGG - Intergenic
1160182348 18:76646385-76646407 GGTCACAGGACAATAGTGGAGGG - Intergenic
1162714622 19:12622284-12622306 GGTCATGGGACAATAGTGGAGGG - Intronic
1162887200 19:13704458-13704480 GGTCATGGGACAATAGTGGAGGG - Intergenic
1163905493 19:20148836-20148858 GGTCATGGGACAATAGTGGAGGG + Intergenic
1164055091 19:21615467-21615489 GGCCATAGGACAATAGTGGAGGG - Intergenic
1164081413 19:21864808-21864830 GGTCATGGGACAATAGTGGAGGG + Intergenic
1164192999 19:22928518-22928540 GGTCATGGGACAATAGTGGAGGG - Intergenic
1164218784 19:23173949-23173971 GGTCACAGGACAATAGTGGAGGG - Intergenic
1164652100 19:29898402-29898424 GGTCATGGGACAATAGTGGAGGG + Intergenic
1165295255 19:34921494-34921516 GGTCACAGGACAATAGTGGAGGG + Intergenic
1165842433 19:38797210-38797232 GGTCACAGGACAATAGTGGAGGG + Intergenic
1165883285 19:39058598-39058620 GGTCATGGGACAATAGTGGAGGG + Intergenic
1166028061 19:40107279-40107301 GGTCATGGGACAATAGTGGAGGG + Intergenic
1166030208 19:40119297-40119319 GGTCATGGGACAATAGTGGAGGG - Intergenic
1166114775 19:40647430-40647452 GGTCACAGGACAATAGTGGAGGG + Intergenic
1166140296 19:40801730-40801752 GGTCACAGGACAATAGTGGAGGG + Intronic
1166180500 19:41104169-41104191 GGTCATGGGACAATAGTGGAGGG - Intergenic
1166261889 19:41645789-41645811 GGTCATGGGACAATAGTGGAGGG - Intronic
1166832981 19:45649141-45649163 GGTCACAGGACAATAGTGGAGGG - Intergenic
1167897343 19:52592842-52592864 GGTCACAGGACAATAGTGGAGGG + Intergenic
925400351 2:3568566-3568588 GGTCACAGGACAATAGTGGAGGG + Intergenic
926179075 2:10624237-10624259 GGTCACAGGACAATAGTGGAGGG + Intronic
926252637 2:11164600-11164622 GGTCACAGGACAATAGTGGAGGG + Intronic
926667685 2:15542559-15542581 GGTCACAGGACAATAGTGGAGGG - Intronic
926674632 2:15610947-15610969 GGTCACAGGACAATAGTGGAGGG + Intronic
927757688 2:25722698-25722720 GGTCACAGGACAATAGTGGAGGG + Intergenic
928597572 2:32870464-32870486 GGTCATGGGACAATAGTGGAGGG - Intergenic
929065973 2:37976910-37976932 GGTCACAGGACAATAGTGGAGGG + Intronic
929416622 2:41748628-41748650 GGTCATGGGACAATAGTGGAGGG - Intergenic
929515699 2:42604646-42604668 GGTCATGGGACAATAGTGGAGGG + Intronic
930078987 2:47432477-47432499 GGTCACAGGACAATAGTGGAGGG + Intronic
930116374 2:47721815-47721837 GGTCACAGGACAATAGTGGAGGG + Intronic
930201388 2:48554789-48554811 GGTCATGGGACAATAGTGGAGGG + Intronic
930821651 2:55651706-55651728 GGTCACAGGACAATAGTGGAGGG - Intronic
930948148 2:57101579-57101601 GGCCCCAATACAATAATAGATGG - Intergenic
931480116 2:62631138-62631160 GGTCATAAGACAATAGTGGAGGG - Intergenic
931655850 2:64511011-64511033 GGTCATGGGACAATAGTGGAGGG + Intergenic
931783390 2:65600037-65600059 GGTCACAGGACAATAGTGGAGGG + Intergenic
932367464 2:71162011-71162033 GGCCACAGGACAATAGTGGAGGG - Intergenic
933735312 2:85488978-85489000 GGTCACAGGACAATAGTGGAGGG - Intergenic
934549215 2:95244273-95244295 GGTCACAGGACAATAGTGGAGGG - Intronic
934703938 2:96463034-96463056 GGTCATGGGACAATAGTGGAGGG - Intergenic
934752897 2:96805510-96805532 GGTCATGGGACAATAGTGGAGGG + Intronic
935630324 2:105209524-105209546 GGTCATGGGACAATAGTGGAGGG + Intergenic
935636346 2:105252071-105252093 GGTCACAGGACAATAGTGGAGGG - Intergenic
935991897 2:108726696-108726718 GGTCATGGGACAATAGTGGAGGG + Intronic
936186547 2:110307980-110308002 GGTCACAGGACAATAGTGGAGGG - Intergenic
936546692 2:113395936-113395958 GGTCATGGGACAATAGTGGAGGG - Intergenic
937437818 2:121893704-121893726 GGTCATGGGACAATAGTGGAGGG - Intergenic
937919261 2:127118963-127118985 GGTCATGGGACAATAGTGGAGGG + Intergenic
938005457 2:127786920-127786942 GGTCATGGGACAATAGTGGAGGG + Intronic
938720839 2:134064901-134064923 GGTCACAGGACAATAGTGGAGGG - Intergenic
940269423 2:151875076-151875098 GGTCACAGGACAATAGTGGAGGG + Intronic
940299411 2:152161429-152161451 GGTCACAGGACAATAGTGGAGGG - Intronic
940652094 2:156450726-156450748 GGTCACAGGACAATAGTGGAGGG + Intronic
941023747 2:160438322-160438344 GGTCACAGGACAATAGTGGAGGG + Intronic
941025264 2:160449757-160449779 GGTCACAGGACAATAGTGGAGGG - Intronic
941814309 2:169785089-169785111 GGTCATGGGACAATAGTGGAGGG + Intergenic
941848027 2:170150836-170150858 GGTCACAGGACAATAGTGGAGGG - Intergenic
942630922 2:177947698-177947720 GGTCATGGGACAATAGTGGAGGG - Intronic
943296979 2:186153393-186153415 GGTCATGGGACAATAGTGGAGGG + Intergenic
944061063 2:195569107-195569129 GGTCATGGGACAATAGTGGAGGG - Intergenic
944255533 2:197619674-197619696 GGTCACAGGACAATAGTGGAGGG - Intronic
944283160 2:197922075-197922097 GGTCATGGGACAATAGTGGAGGG + Intronic
944584996 2:201165644-201165666 GGTCACAGGACAATAGTGGAGGG + Exonic
944593337 2:201238830-201238852 GGTCACAGGACAATAGTGGAGGG + Intronic
944598211 2:201281999-201282021 GGTCACAGGACAATAGTGGAGGG + Intronic
944737274 2:202578418-202578440 GGTCATGGGACAATAGTGGAGGG - Intergenic
945041900 2:205749430-205749452 GGCCACGAGACAATAATGGAGGG - Intronic
945114708 2:206400072-206400094 GGTCATGGGACAATAGTGGAGGG + Intergenic
945187510 2:207154568-207154590 GCCCAAGAGACAATAAATGATGG - Intronic
945732533 2:213556624-213556646 GGCTGCAATACAATAATGGAAGG + Intronic
946318398 2:218932532-218932554 GGTCACAGGACAATAGTGGAGGG - Intergenic
947055381 2:226094152-226094174 GACCACCAGACAATAATAGAGGG + Intergenic
947901183 2:233723593-233723615 GGTCATGGGACAATAGTGGAGGG + Intronic
948451440 2:238076644-238076666 GGTCATGGGACAATAGTGGAGGG - Intronic
948990476 2:241551520-241551542 GGCCACGAGACAGAAGGGGAAGG + Intergenic
1169108562 20:3018287-3018309 GGTCACAGGACAATAGTGGAGGG + Intronic
1169371093 20:5028585-5028607 GGTCATGGGACAATAGTGGAGGG - Intergenic
1169449993 20:5702655-5702677 GGTCACAGGACAATAGTGGAGGG - Intergenic
1170384506 20:15801120-15801142 GGTCACAGGACAATAGTGGAGGG - Intronic
1170424616 20:16226600-16226622 GGTCATGGGACAATAGTGGAGGG + Intergenic
1170677441 20:18495519-18495541 GGTCACAGGACAATAGTGGAGGG - Intronic
1171899714 20:30846408-30846430 GGTCACAGGACAATAGTGGAGGG + Intergenic
1172141442 20:32724872-32724894 GGTCATGGGACAATAGTGGAGGG - Intronic
1172199759 20:33116393-33116415 GGTCACAGGACAATAGTGGAGGG - Intergenic
1172208991 20:33184576-33184598 GGTCATAGGACAATAATGGAGGG + Intergenic
1172349135 20:34228647-34228669 GGTCATGGGACAATAGTGGAGGG + Intronic
1172466001 20:35154979-35155001 GGTCATGGGACAATAGTGGAGGG - Intergenic
1172721439 20:37001688-37001710 GGTCACAGGACAATAGTGGAGGG - Intronic
1172767668 20:37359408-37359430 GGCCACGAATCCATAATGCAGGG + Intronic
1173517932 20:43678234-43678256 GGTCACAGGACAATAGTGGAGGG - Intronic
1173566982 20:44047776-44047798 GGTCATGGGACAATAGTGGAGGG - Intronic
1174020350 20:47524996-47525018 GGTCACAGGACAATAGTGGAGGG + Intronic
1174218459 20:48935156-48935178 GGTCACAGGACAATAGTGGAGGG + Intronic
1174345068 20:49923051-49923073 GGTCACAGGACAATAGTGGAGGG - Intergenic
1174614958 20:51828590-51828612 GGACAGGAGACATCAATGGAGGG + Intergenic
1174835947 20:53855148-53855170 GGTCACAGGACAATAGTGGAGGG - Intergenic
1175687596 20:61043003-61043025 GGACTTGAGAGAATAATGGAGGG - Intergenic
1176348082 21:5769869-5769891 GGTCACAGGACAATAGTGGAGGG + Intergenic
1176354896 21:5890453-5890475 GGTCACAGGACAATAGTGGAGGG + Intergenic
1176427402 21:6557283-6557305 GGCCACGAGCCAAGAAAGGCAGG + Intergenic
1176496745 21:7554586-7554608 GGTCACAGGACAATAGTGGAGGG - Intergenic
1176542403 21:8167939-8167961 GGTCACAGGACAATAGTGGAGGG + Intergenic
1176561354 21:8350984-8351006 GGTCACAGGACAATAGTGGAGGG + Intergenic
1177134022 21:17291573-17291595 GGTCATGGGACAATAGTGGAGGG + Intergenic
1177177812 21:17718707-17718729 GGTCATGGGACAATAGTGGAGGG + Intergenic
1178075926 21:29012704-29012726 GGTCACAGGACAATAGTGGAGGG - Intronic
1179626409 21:42652037-42652059 GGCCAGATGACAATAAGGGATGG + Intergenic
1179702893 21:43165600-43165622 GGCCACGAGCCAAGAAAGGCAGG + Intergenic
1180125314 21:45786064-45786086 GGTCACAGGACAATAGTGGAGGG - Intronic
1180672227 22:17561962-17561984 GGTCATGGGACAATAGTGGAGGG - Intergenic
1181301249 22:21883001-21883023 GGTCACAGGACAATAGTGGAGGG + Intergenic
1181657563 22:24316341-24316363 GGTCACAGGACAATAGTGGAGGG + Intronic
1181981790 22:26772211-26772233 GGTCATGGGACAATAGTGGAGGG + Intergenic
1182616026 22:31591030-31591052 GGTCATGGGACAATAGTGGAGGG + Intronic
1182976068 22:34625338-34625360 GGTCACAGGACAATAGTGGAGGG + Intergenic
1183595660 22:38808467-38808489 GGTCATGGGACAATAGTGGAGGG - Intergenic
1183840900 22:40500456-40500478 GGTCATGGGACAATAGTGGAGGG + Intronic
1183845762 22:40538499-40538521 GGTCATGGGACAATAGTGGAGGG - Intronic
1183941161 22:41295630-41295652 GGTCACAGGACAATAGTGGAGGG - Intergenic
1184024126 22:41841378-41841400 GACCAGGAGACAAAAATGGGTGG - Intronic
1203247342 22_KI270733v1_random:84357-84379 GGTCACAGGACAATAGTGGAGGG + Intergenic
949565614 3:5242436-5242458 GGCCATAGGACAATAGTGGAGGG + Intergenic
949853713 3:8441154-8441176 GGTCACAGGACAATAGTGGAGGG - Intergenic
950253488 3:11486897-11486919 GGTCATGGGACAATAGTGGAGGG + Intronic
950948914 3:16979400-16979422 GGTCACAGGACAATAGTGGAGGG + Intronic
951013119 3:17703984-17704006 GGTCATGGGACAATAGTGGAGGG + Intronic
952309042 3:32170530-32170552 GGTCACAGGACAATAGTGGAGGG - Intergenic
952896228 3:38080878-38080900 GGTCATGGGACAATAGTGGAGGG + Intronic
953309178 3:41860333-41860355 GGCCTTGATACAATAATGGCTGG - Intronic
953426504 3:42799219-42799241 GGTCATGGGACAATAGTGGAGGG - Intronic
953652493 3:44820413-44820435 GGTCACAGGACAATAGTGGAGGG + Intronic
953784974 3:45904592-45904614 GTCCACAAGACCAAAATGGAAGG - Intronic
954059834 3:48057541-48057563 GGTCATGGGACAATAGTGGAGGG - Intronic
954081237 3:48213011-48213033 GGTCATGGGACAATAGTGGAGGG - Intergenic
954399085 3:50310663-50310685 GGTCACAGGACAATAGTGGAGGG + Intronic
954483388 3:50823221-50823243 GGTCACAGGACAATAGTGGAGGG + Intronic
955297752 3:57748690-57748712 GGTCATGGGACAATAGTGGAGGG - Intergenic
955394546 3:58549133-58549155 GGTCATGGGACAATAGTGGAGGG + Intergenic
955434646 3:58889615-58889637 GGTCATGGGACAATAGTGGAGGG + Intronic
955699632 3:61671202-61671224 GGTCACAGGACAATAGTGGAGGG + Intronic
955825966 3:62948304-62948326 GGACATGAGAAAAAAATGGATGG - Intergenic
956270911 3:67445550-67445572 GGTCATGGGACAATAGTGGAGGG - Intronic
957203517 3:77165493-77165515 GGTCATGGGACAATAGTGGAGGG - Intronic
957316517 3:78582544-78582566 GGTCATGGGACAATAGTGGAGGG + Intergenic
957789403 3:84919449-84919471 GGTCACAGGACAATAGTGGAGGG - Intergenic
959042985 3:101440503-101440525 GGTCATGGGACAATAGTGGAGGG - Intronic
959092820 3:101922657-101922679 GGCCACCACACAATAATAAAGGG - Intergenic
959418948 3:106110595-106110617 GGTCATGGGACAATAGTGGAGGG + Intergenic
959984418 3:112556953-112556975 GGTCACAGGACAATAGTGGAGGG - Intronic
960029801 3:113045705-113045727 GGTCACAGGACAATAGTGGAGGG + Intergenic
960388789 3:117051410-117051432 GGTCACAGGACAATAGTGGAGGG - Intronic
960862435 3:122165835-122165857 GGTCATGGGACAATAGTGGAGGG - Intergenic
961120020 3:124366267-124366289 GGTCATGGGACAATAGTGGAGGG + Intronic
961163547 3:124749456-124749478 GGTCACAGGACAATAGTGGAGGG + Intergenic
961616656 3:128188111-128188133 GGCCAGGAGACCATTTTGGAGGG + Intronic
961729809 3:128956106-128956128 GGTCATGGGACAATAGTGGAGGG - Intronic
962112605 3:132470049-132470071 GGTCATGGGACAATAGTGGAGGG + Intronic
962245368 3:133786144-133786166 GGTCATGGGACAATAGTGGAGGG - Intronic
962835617 3:139185884-139185906 GGCCAAATGACCATAATGGAGGG - Intronic
963448352 3:145443302-145443324 GGCCCCAATACAATAATAGATGG + Intergenic
963451031 3:145482314-145482336 GGTCACAGGACAATAGTGGAGGG + Intergenic
964060716 3:152518833-152518855 GTGCACTAGACAACAATGGATGG - Intergenic
965449558 3:168820670-168820692 GGCAAAGAGAAAATAATGAAAGG + Intergenic
966253317 3:177891139-177891161 GGTCACAGGACAATAGTGGAGGG + Intergenic
966289333 3:178336599-178336621 GGCTACCAGAGAATAAAGGAAGG - Intergenic
966360319 3:179122012-179122034 GGTCATGGGACAATAGTGGAGGG - Intergenic
966375258 3:179290360-179290382 GGTCATGGGACAATAGTGGAGGG + Intergenic
966419924 3:179727229-179727251 GGTCACAGGACAATAGTGGAGGG + Intronic
967177771 3:186874990-186875012 GGTCACAGGACAATAGTGGAGGG - Intergenic
967524413 3:190474127-190474149 GGTCACAGGACAATAGTGGAGGG - Intergenic
967921658 3:194618823-194618845 GGCCTGGAGACAAAACTGGAGGG - Intronic
968042338 3:195599203-195599225 GGTCATAGGACAATAATGGAGGG + Intergenic
968175064 3:196542645-196542667 GGTCATGGGACAATAGTGGAGGG + Intergenic
968201670 3:196761219-196761241 GGTCATGGGACAATAGTGGAGGG + Intronic
968226269 3:196974259-196974281 GGTCACAGGACAATAGTGGAGGG - Intergenic
968299408 3:197601798-197601820 GGTCACAGGACAATAGTGGAGGG + Intergenic
968316604 3:197731057-197731079 GGTCACAGGACAATAGTGGAGGG + Intronic
968411925 4:396700-396722 GGTCACAGGACAATAGTGGAGGG - Intergenic
968484815 4:854179-854201 GGTCACAGGACAATAGTGGAGGG + Intronic
968666877 4:1827351-1827373 GGTCATGGGACAATAGTGGAGGG + Intronic
968924000 4:3537915-3537937 GGTCACAGGACAATAGTGGAGGG + Intergenic
969374921 4:6756590-6756612 GGTCACGGGACAATAGTGGAGGG - Intergenic
969404335 4:6978672-6978694 GATCACGGGACAATAGTGGAGGG - Intronic
970119043 4:12732147-12732169 GGCCACGAGACAATTATGATGGG - Intergenic
970914722 4:21319667-21319689 GGCCAGGAGAATATACTGGATGG - Intronic
972288571 4:37669969-37669991 GGTCACAGGACAATAGTGGAGGG - Intronic
972551634 4:40140652-40140674 GGTCACAGGACAATAGTGGAGGG + Intronic
973109410 4:46378590-46378612 GGTCACAGGACAATAGTGGAGGG - Intronic
973281120 4:48362824-48362846 GGTCATGGGACAATAGTGGAGGG + Intronic
973593976 4:52466518-52466540 GGTCATGGGACAATAGTGGAGGG - Intergenic
973650544 4:52993325-52993347 GGTCACAGGACAATAGTGGAGGG - Intronic
973707029 4:53591354-53591376 TGCCAAGAGAGAAAAATGGAGGG + Intronic
974076764 4:57174019-57174041 GGTCACAGGACAATAGTGGAGGG - Intergenic
974082298 4:57225111-57225133 GGTCACAGGACAATAGTGGAGGG - Intergenic
974513353 4:62874316-62874338 GGCCCTGATACAATAATAGATGG + Intergenic
974588756 4:63918008-63918030 GGTCATGGGACAATAGTGGAGGG + Intergenic
975042661 4:69762919-69762941 GGTCACAGGACAATAGTGGAGGG - Intronic
975434295 4:74333886-74333908 GGTTAGGAAACAATAATGGAAGG - Intergenic
975664640 4:76722861-76722883 GCGCACTAAACAATAATGGATGG + Intronic
975848604 4:78548983-78549005 GGTCACAGGACAATAGTGGAGGG - Intergenic
976607530 4:86996656-86996678 GGTCACAGGACAATAGTGGAGGG - Intronic
978112021 4:104975589-104975611 GGCCAGGAGACAAGTATAGAGGG - Intergenic
979941945 4:126772090-126772112 GGTCACAGGACAATAGTGGAGGG - Intergenic
981523860 4:145693095-145693117 GGTCATGGGACAATAGTGGAGGG + Intronic
981970926 4:150661000-150661022 GGTCATGGGACAATAGTGGAGGG - Intronic
982053367 4:151525820-151525842 GGTCACAGGACAATATTGGAGGG + Intronic
982615517 4:157635887-157635909 GGTCATGGGACAATAGTGGAGGG + Intergenic
982820451 4:159938423-159938445 GGTCATGGGACAATAGTGGAGGG + Intergenic
983652508 4:170047494-170047516 GGTCACAGGACAATAGTGGAGGG - Intergenic
984038046 4:174692871-174692893 GGTCACAGGACAATAGTGGAGGG - Intronic
984533300 4:180944289-180944311 GGTCATGGGACAATAGTGGAGGG + Intergenic
984976968 4:185239833-185239855 GGTCACAGGACAATAGTGGAGGG + Intronic
985247216 4:187991001-187991023 GGTCACAGGACAATAGTGGAGGG + Intergenic
985439692 4:189971688-189971710 GGTCACAGGACAATAGTGGAGGG - Intergenic
985736741 5:1587235-1587257 GGTCACAGGACAATAGTGGAGGG - Intergenic
988544613 5:32143382-32143404 GGTCACAGGACAATAGTGGAGGG - Intronic
988552504 5:32209567-32209589 GGTCATGGGACAATAGTGGAGGG - Intergenic
988760024 5:34305077-34305099 GGTCATGGGACAATAGTGGAGGG + Intergenic
989021275 5:37012522-37012544 GGTCACAGGACAATAGTGGAGGG + Intronic
989048653 5:37296621-37296643 GGTCACAGGACAATAGTGGAGGG - Intronic
989068027 5:37483165-37483187 GGTCACAGGACAATAGTGGAGGG + Intronic
989075611 5:37562506-37562528 GGTCACAGGACAATAGTGGAGGG + Intronic
990294042 5:54382164-54382186 GGCCACAGGACAATAGTGGAGGG - Intergenic
991597768 5:68323165-68323187 GGTCACAGGACAATAGTGGAGGG + Intergenic
992374317 5:76172978-76173000 GGTCATGGGACAATAGTGGAGGG - Intronic
992469404 5:77041875-77041897 GGTCATGGGACAATAGTGGAGGG + Intronic
992544105 5:77794373-77794395 GGTCATGGGACAATAGTGGAGGG + Intronic
992978533 5:82141155-82141177 GGTCATGGGACAATAGTGGAGGG - Intronic
993496798 5:88616747-88616769 GGTCACAGGACAATAGTGGAGGG - Intergenic
995772922 5:115691176-115691198 GGTCACAGGACAATAGTGGAGGG - Intergenic
996116168 5:119621967-119621989 GGCCACCATACAATAATAAAGGG - Intronic
997321482 5:132982455-132982477 GGTCATGGGACAATAGTGGAGGG + Intergenic
997336114 5:133109706-133109728 GGTCATGGGACAATAGTGGAGGG - Intergenic
997565108 5:134881250-134881272 GGTCACAGGACAATAGTGGAGGG + Intronic
997874582 5:137537057-137537079 GGTCACAGGACAATAGTGGAGGG + Intronic
998431514 5:142074727-142074749 GGTCATGGGACAATAGTGGAGGG + Intergenic
999180829 5:149669594-149669616 GGTCACAGGACAATAGTGGAGGG + Intergenic
1000244912 5:159441407-159441429 GGACCAGAGACAATAATGGCTGG + Intergenic
1000985958 5:167860974-167860996 GGTCATGGGACAATAGTGGAGGG - Intronic
1001077652 5:168642717-168642739 GGTCATGGGACAATAGTGGAGGG + Intergenic
1001366721 5:171148320-171148342 GGTCATGGGACAATAGTGGAGGG - Intronic
1001393843 5:171403069-171403091 GGTCATGGGACAATAGTGGAGGG + Intronic
1002116333 5:176963079-176963101 GGTCATGGGACAATAGTGGAGGG - Intronic
1002341243 5:178517959-178517981 GGTCATGGGACAATAGTGGAGGG + Intronic
1002626051 5:180530630-180530652 GGCCATAGGACAATAGTGGAGGG + Intronic
1002658182 5:180770738-180770760 GGTCACAGGACAATAGTGGAGGG + Intergenic
1004388613 6:15190502-15190524 GGTCATGGGACAATAGTGGAGGG - Intergenic
1005063160 6:21796193-21796215 GGTCACAGGACAATAGTGGAGGG + Intergenic
1005159155 6:22837811-22837833 GGTCACAGGACAATAGTGGAGGG - Intergenic
1005606548 6:27484164-27484186 GGTCATGGGACAATAGTGGAGGG + Intergenic
1005865585 6:29933672-29933694 GGTCATGGGACAATAGTGGAGGG - Intergenic
1005981375 6:30839588-30839610 GGCCATGAGAACATCATGGATGG - Intergenic
1006004634 6:30992631-30992653 GGTCATAGGACAATAATGGAGGG + Intergenic
1006040110 6:31245234-31245256 GGTCATGGGACAATAGTGGAGGG - Intergenic
1006128136 6:31853346-31853368 GGTCATGGGACAATAGTGGAGGG + Intergenic
1006141221 6:31931326-31931348 GGTCACAGGACAATAGTGGAGGG + Intronic
1006209586 6:32384251-32384273 GGTCACAGGACAATAGTGGAGGG + Intergenic
1006231753 6:32594260-32594282 GGTCATGGGACAATAGTGGAGGG + Intergenic
1006281623 6:33059013-33059035 GGTCACAGGACAATAGTGGAGGG + Intergenic
1006290347 6:33130544-33130566 GTCCAGGGGACAAAAATGGAAGG - Intergenic
1006351789 6:33526080-33526102 GGTCATGGGACAATAGTGGAGGG - Intergenic
1006492797 6:34399058-34399080 GGTCATGGGACAATAGTGGAGGG - Intronic
1007063293 6:38963759-38963781 GGTCATGGGACAATAGTGGAGGG + Intronic
1007651615 6:43425921-43425943 GGTCATAAGACAATAGTGGAGGG - Intergenic
1007673977 6:43579972-43579994 GGTCATGGGACAATAGTGGAGGG + Intronic
1007751749 6:44075451-44075473 GGCCCGGAGAAAAGAATGGAGGG + Intergenic
1008111949 6:47505093-47505115 GGTCATGGGACAATAGTGGAGGG + Intronic
1008482747 6:52003550-52003572 GGCCACAGGACAATATTGGTGGG - Intronic
1009049214 6:58258510-58258532 GGTCACAGGACAATAGTGGAGGG - Intergenic
1010030145 6:71265476-71265498 GGTCACAGGACAATAGTGGAGGG + Intergenic
1011404900 6:87009124-87009146 GGTCATGGGACAATAGTGGAGGG + Intronic
1011588579 6:88949043-88949065 GGTCATGGGACAATAGTGGAGGG - Intronic
1013191011 6:107803981-107804003 GGTCACAGGACAATAGTGGAGGG - Intronic
1013244143 6:108270866-108270888 GGTCACAGGACAATAGTGGAGGG - Intergenic
1013326345 6:109048026-109048048 GGTCATGGGACAATAGTGGAGGG - Intronic
1013679464 6:112508400-112508422 GGTCATGGGACAATAGTGGAGGG + Intergenic
1014530322 6:122551659-122551681 AGCCACGAGGAAAGAATGGAGGG + Intronic
1014556562 6:122847849-122847871 GGTCATGGGACAATAGTGGAGGG + Intergenic
1015070478 6:129087958-129087980 GGTCACGGGACAATAGTGGAGGG + Intronic
1015221056 6:130803241-130803263 GGTCACAGGACAATAGTGGAGGG - Intergenic
1015477088 6:133666115-133666137 GGTCATGGGACAATAGTGGAGGG - Intergenic
1015643400 6:135363111-135363133 GGTCACAGGACAATAGTGGAGGG + Intronic
1016476260 6:144432748-144432770 GGTCACAGGACAATAGTGGAGGG + Intronic
1016801988 6:148178212-148178234 GGTCACAGGACAATAGTGGAGGG + Intergenic
1017419946 6:154263308-154263330 GGTCACAGGACAATAGTGGAGGG + Intronic
1017830952 6:158127928-158127950 GGTCATGGGACAATAGTGGAGGG - Intronic
1017843124 6:158238490-158238512 GGTCATGGGACAATAGTGGAGGG + Intronic
1017851220 6:158308064-158308086 GGTCATGGGACAATAGTGGAGGG + Intronic
1018010030 6:159661162-159661184 GGTCACAGGACAATAGTGGAGGG - Intergenic
1018295611 6:162340069-162340091 GGTCATGGGACAATAGTGGAGGG - Intronic
1019439843 7:1040104-1040126 GGTCATGGGACAATAGTGGAGGG - Intronic
1019669445 7:2269445-2269467 GGTCATGGGACAATAGTGGAGGG - Intronic
1019714743 7:2533555-2533577 GGTCACAGGACAATAGTGGAGGG + Intergenic
1019953086 7:4389662-4389684 GGTCACAGGACAATAGTGGAGGG + Intergenic
1020157394 7:5737453-5737475 GGTCACAGGACAATAGTGGAGGG - Intronic
1020616136 7:10464786-10464808 GGTCATGGGACAATAGTGGAGGG + Intergenic
1020831942 7:13103603-13103625 GGTCACAGGACAATAGTGGAGGG - Intergenic
1020992967 7:15224645-15224667 GGACATGAGGCAATAAGGGAGGG - Intronic
1021872856 7:25020147-25020169 GGTCATGGGACAATAGTGGAGGG - Intergenic
1021992074 7:26148990-26149012 GGTCATAAGACAATAGTGGAGGG - Intergenic
1022274202 7:28839457-28839479 GGTCACAGGACAATAGTGGAGGG - Intergenic
1022393141 7:29961132-29961154 GGTCATGGGACAATAGTGGAGGG + Intronic
1023044337 7:36197825-36197847 GGTCATAAGACAATAGTGGAGGG - Intronic
1023160843 7:37293650-37293672 GGTCACAGGACAATAGTGGAGGG - Intronic
1024988806 7:55219139-55219161 GGTCATGGGACAATAGTGGAGGG + Intronic
1025808658 7:64857580-64857602 GGTCATGGGACAATAGTGGAGGG - Intergenic
1026042104 7:66876831-66876853 GGTCACAGGACAATAGTGGAGGG + Intergenic
1026783081 7:73283351-73283373 GGTCATGGGACAATAGTGGAGGG + Intergenic
1026861954 7:73796652-73796674 GGTCACAGGACAATAGTGGAGGG + Intergenic
1027087633 7:75275661-75275683 GGTCATGGGACAATAGTGGAGGG - Intergenic
1028227121 7:88265543-88265565 GGTCACAGGACAATAGTGGAGGG + Intergenic
1029375823 7:100176513-100176535 GGTCAGGAGACAATAAGGTAGGG - Intronic
1029468366 7:100740363-100740385 GGTCATGGGACAATAGTGGAGGG + Intronic
1030087823 7:105832043-105832065 GGCCATGTGACTATATTGGAAGG + Intronic
1030344441 7:108416506-108416528 GGCCAGGAGACAATCATGTAGGG + Intronic
1030706211 7:112696713-112696735 GGTCACAGGACAATAGTGGAGGG + Intergenic
1032570063 7:132986331-132986353 GGTCACAGGACAATAGTGGAGGG - Intronic
1032932340 7:136687896-136687918 GGGCAAGAGACAATATAGGAAGG - Intergenic
1033002242 7:137519255-137519277 GGCTCCCTGACAATAATGGATGG - Intronic
1033114380 7:138612327-138612349 GGTCATGGGACAATAGTGGAGGG - Intronic
1033219569 7:139519438-139519460 GGTCACAGGACAATAGTGGAGGG + Intergenic
1033294262 7:140115725-140115747 GGTCATGGGACAATAGTGGAGGG - Intronic
1034322753 7:150199537-150199559 GGTCATGGGACAATAGTGGAGGG - Intergenic
1035412723 7:158658084-158658106 GGTCACAGGACAATAGTGGAGGG - Intronic
1035507604 8:148909-148931 GGTCATGGGACAATAGTGGAGGG + Intergenic
1036096129 8:5726146-5726168 GGTCACAGGACAATAGTGGAGGG - Intergenic
1036536398 8:9656683-9656705 GGTCATGGGACAATAGTGGAGGG + Intronic
1039072041 8:33657598-33657620 GGTCATGGGACAATAGTGGAGGG + Intergenic
1040043260 8:42938779-42938801 GGTCACAGGACAATAGTGGAGGG + Intronic
1040785742 8:51160117-51160139 GGGCACAGGACAATAGTGGAGGG - Intergenic
1041071063 8:54126372-54126394 GGTCATGGGACAATAGTGGAGGG - Intergenic
1041286789 8:56271440-56271462 GGTCACAGGACAATAGTGGAGGG + Intergenic
1041513462 8:58675861-58675883 GGTCACAGGACAATAGTGGAGGG + Intergenic
1041676645 8:60546959-60546981 GGTCACAGGACAATAGTGGAGGG + Intronic
1041796216 8:61751935-61751957 GGTCATGGGACAATAGTGGAGGG + Intergenic
1042049402 8:64687060-64687082 GGTCATGGGACAATAGTGGAGGG - Intronic
1042139473 8:65663462-65663484 GGTCACAGGACAATAGTGGAGGG - Intronic
1042303942 8:67312168-67312190 GGTCATGGGACAATAGTGGAGGG - Intronic
1043104191 8:76087627-76087649 GGCAACACGATAATAATGGAAGG - Intergenic
1043709152 8:83393127-83393149 GGCAACAAGACAAAAATAGATGG + Intergenic
1043961428 8:86423287-86423309 GGTCACAGGACAATAGTGGAGGG + Intronic
1044224035 8:89700063-89700085 GGTCACAGGACAATAGTGGAGGG - Intergenic
1044661128 8:94592287-94592309 GGTCATGGGACAATAGTGGAGGG - Intergenic
1045298333 8:100891538-100891560 GGTCACAGGACAATAGTGGAGGG + Intergenic
1046416488 8:113921276-113921298 GGAAAAGTGACAATAATGGATGG - Intergenic
1046920638 8:119724635-119724657 GGCCAGGAGACAATACAGAAAGG - Intergenic
1047687730 8:127317812-127317834 GGTCATGGGACAATAGTGGAGGG - Intergenic
1047781820 8:128117878-128117900 GGTCACAGGACAATAGTGGAGGG + Intergenic
1047847580 8:128825044-128825066 GGTCATGGGACAATAGTGGAGGG + Intergenic
1047970619 8:130081276-130081298 GGTCACAAGACAATAAATGAGGG + Intronic
1048061356 8:130922272-130922294 GGTCACAGGACAATAGTGGAGGG + Intronic
1049739517 8:144230871-144230893 GGTCACAGGACAATAGTGGAGGG + Intronic
1050558436 9:6808625-6808647 GGTCATGGGACAATAGTGGAGGG - Intronic
1050744529 9:8859824-8859846 AGCCAAGAGACAATCATGCAGGG - Intronic
1051751472 9:20346626-20346648 GGCAAAGAGAGAGTAATGGAGGG + Intronic
1052942232 9:34138671-34138693 GGTCACAGGACAATAGTGGAGGG - Intergenic
1052974382 9:34400646-34400668 GGCCAAGAGAGAAGACTGGACGG - Exonic
1053048291 9:34937580-34937602 GGTCACAGGACAATAGTGGAGGG - Intergenic
1053255600 9:36614500-36614522 GGTCATGGGACAATAGTGGAGGG + Intronic
1053332991 9:37233755-37233777 GGTCAAGAGAAAATGATGGAGGG + Intronic
1053457702 9:38243521-38243543 GGTCATGGGACAATAGTGGAGGG - Intergenic
1053634436 9:39983075-39983097 GGTCATGGGACAATAGTGGAGGG + Intergenic
1054209451 9:62267622-62267644 GGTCATGGGACAATAGTGGAGGG - Intergenic
1055136851 9:72839654-72839676 GGTCATGGGACAATAGTGGAGGG + Intergenic
1055138455 9:72850486-72850508 GGACACAGGACAATAGTGGAGGG + Intergenic
1055413976 9:76063392-76063414 GGTCATGGGACAATAGTGGAGGG + Intronic
1055506783 9:76956201-76956223 GGTCACAGGACAATAGTGGAGGG - Intergenic
1055899233 9:81215709-81215731 TGCCACAAGACAATAACGCAAGG - Intergenic
1055948801 9:81711841-81711863 GGTCATGGGACAATAGTGGAGGG - Intergenic
1056084880 9:83137532-83137554 GGCAGCAAGACAATAATAGATGG + Intergenic
1056624576 9:88244159-88244181 GGTCACAGGACAATAGTGGAGGG + Intergenic
1056671025 9:88626958-88626980 GGTCATGGGACAATAGTGGAGGG - Intergenic
1057087691 9:92226868-92226890 GGTCACAGGACAATAGTGGAGGG + Intronic
1057154581 9:92830127-92830149 GGTCACAGGACAATAGTGGAGGG + Intergenic
1057629246 9:96706900-96706922 GGTCATGGGACAATAGTGGAGGG + Intergenic
1058019262 9:100069222-100069244 GGTCATAGGACAATAATGGAGGG - Intronic
1058659394 9:107256117-107256139 GGTCATGGGACAATAGTGGAGGG + Intergenic
1058661764 9:107273020-107273042 GGTCACAGGACAATAGTGGAGGG - Intergenic
1058723275 9:107778210-107778232 GGTCATGGGACAATAGTGGAGGG - Intergenic
1058972585 9:110097015-110097037 GGTCACAGGACAATAGTGGAGGG + Intronic
1059121438 9:111642541-111642563 GGTCATGGGACAATAGTGGAGGG - Intronic
1059211555 9:112515816-112515838 GGTCATGGGACAATAGTGGAGGG - Intronic
1059707646 9:116839939-116839961 GGTCACAGGACAATAGTGGAGGG + Intronic
1060065547 9:120497342-120497364 GGTCATGGGACAATAGTGGAGGG - Intronic
1060334870 9:122711873-122711895 GGTCACAGGACAATAGTGGAGGG - Intergenic
1060369490 9:123056543-123056565 GGTCATGGGACAATAGTGGAGGG + Intronic
1060651120 9:125328263-125328285 GGTCATGGGACAATAGTGGAGGG + Intronic
1060682657 9:125578362-125578384 GGTCACAGGACAATAGTGGAGGG - Intronic
1060687597 9:125625171-125625193 GGTCATGGGACAATAGTGGAGGG - Intronic
1060975240 9:127761398-127761420 GGCCAGGAAAGAATAATGGCTGG + Intronic
1061207560 9:129173709-129173731 GGCCCCGAGAAGATAAGGGAAGG + Intergenic
1061427000 9:130505955-130505977 GGTCACAGGACAATAGTGGAGGG + Intergenic
1061982514 9:134114845-134114867 GGTCATGGGACAATAGTGGAGGG + Intergenic
1062550871 9:137086038-137086060 GGCCAGGAGAGAATGAAGGAGGG + Intergenic
1062593957 9:137289079-137289101 GGTCATGGGACAATAGTGGAGGG - Intergenic
1203463674 Un_GL000220v1:67417-67439 GGTCACAGGACAATAGTGGAGGG + Intergenic
1185585110 X:1236956-1236978 GGTCATGGGACAATAGTGGAGGG - Intergenic
1186244684 X:7608064-7608086 GGTCACAGGACAATAGTGGAGGG + Intergenic
1186551052 X:10506313-10506335 GGATATGAGACAAGAATGGATGG + Intronic
1187184018 X:16967904-16967926 GGTCACAGGACAATAGTGGAGGG + Intronic
1187976225 X:24708448-24708470 GGTCATGGGACAATAGTGGAGGG + Intronic
1188477605 X:30603812-30603834 GGTCATGGGACAATAGTGGAGGG - Intergenic
1189506194 X:41613563-41613585 GGTCACAGGACAATAGTGGAGGG - Intronic
1189587104 X:42473473-42473495 GGTCATGGGACAATAGTGGAGGG + Intergenic
1189956114 X:46276574-46276596 GGTCATGGGACAATAGTGGAGGG - Intergenic
1189968100 X:46394730-46394752 GGTCACAGGACAATAGTGGAGGG + Intergenic
1190680733 X:52826249-52826271 GGTCATGGGACAATAGTGGAGGG + Intergenic
1190958052 X:55216556-55216578 GGTCCCAATACAATAATGGATGG - Intronic
1191617815 X:63188674-63188696 GGTCATGGGACAATAGTGGAGGG + Intergenic
1192387018 X:70680513-70680535 GGTCACAGGACAATAGTGGAGGG - Intronic
1192621738 X:72682856-72682878 GGTCATGGGACAATAGTGGAGGG - Intronic
1192969518 X:76217216-76217238 GGTCATGGGACAATAGTGGAGGG + Intergenic
1193782698 X:85723300-85723322 GGTCACAGGACAATAGTGGAGGG + Intergenic
1194992196 X:100556592-100556614 GGTCACAGGACAATAGTGGAGGG - Intergenic
1195010087 X:100724803-100724825 GGTCACAGGACAATAGTGGAGGG - Intronic
1195035873 X:100971792-100971814 GGTCATGGGACAATAGTGGAGGG + Intronic
1195851829 X:109291742-109291764 GGCCCCAATACAATAATAGATGG - Intergenic
1196404107 X:115346561-115346583 GGTCATGGGACAATAGTGGAGGG + Intergenic
1196910021 X:120475788-120475810 GGTCACAGGACAATAGTGGAGGG + Intergenic
1197186043 X:123588389-123588411 GGTCATGGGACAATAGTGGAGGG - Intergenic
1197438233 X:126458772-126458794 GGCCACAATACAATAATAGTGGG + Intergenic
1197492982 X:127141356-127141378 TGCAACAATACAATAATGGATGG + Intergenic
1199452469 X:147991721-147991743 GGTCATGGGACAATAGTGGAGGG + Intronic
1200280472 X:154773364-154773386 GGTCATGGGACAATAGTGGAGGG + Intronic
1200387355 X:155907336-155907358 GGTCATGGGACAATAGTGGAGGG + Intronic
1200666328 Y:6029949-6029971 GACCTCGATACAATAATAGATGG - Intergenic
1201335919 Y:12879483-12879505 GGTCACAGGACAATAGTGGAGGG - Intergenic
1201760660 Y:17534094-17534116 GACCACAATACAATAATGGCTGG - Intergenic
1201840893 Y:18371896-18371918 GACCACAATACAATAATGGCTGG + Intergenic
1201859041 Y:18574598-18574620 GGCCACGTGACACTAAAAGAGGG + Intronic
1201874281 Y:18745783-18745805 GGCCACGTGACACTAAAAGAGGG - Intronic