ID: 945043956

View in Genome Browser
Species Human (GRCh38)
Location 2:205765622-205765644
Sequence TGGGATAAGCAAGAGGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 393
Summary {0: 1, 1: 0, 2: 2, 3: 43, 4: 347}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945043956 Original CRISPR TGGGATAAGCAAGAGGAGGC AGG Intronic
900818449 1:4868372-4868394 GGGGAAAATGAAGAGGAGGCAGG - Intergenic
901276146 1:7992487-7992509 TGGGGAAAGGAAGAGGAGGTAGG - Intergenic
903581914 1:24377399-24377421 TAGGATGAGCAAGAGGAGAAGGG - Intronic
903841561 1:26245401-26245423 TAGGAAAGGCAAGAGGAGGCAGG - Intronic
904702882 1:32368570-32368592 TGTGAAAAGCAGGAGGAGGCAGG + Intronic
905275403 1:36814367-36814389 GGGGATAGGCAGGAGCAGGCAGG + Intronic
907389648 1:54150051-54150073 TGGGTCAAGGAAGAGGAGGGAGG - Intronic
907901525 1:58745942-58745964 GGGGATGCGCAAGAGGAGCCAGG - Intergenic
912650308 1:111432844-111432866 TGGGATAACTGAGAGGAGCCAGG - Intergenic
912670591 1:111620362-111620384 GGGGACATGCAAGAGGAGGAAGG - Intronic
913203871 1:116517673-116517695 TGGGAAGAGGCAGAGGAGGCGGG - Intronic
913417046 1:118620050-118620072 TGGCAGAAGCAAGAGGAAGTGGG - Intergenic
915313519 1:155016150-155016172 TGGGATGACCAGGAGGAGCCAGG + Intronic
915447699 1:155983495-155983517 GGGGAGCAGCATGAGGAGGCTGG - Intronic
915945063 1:160143820-160143842 TGGGATCAGCATGAGGAAGGAGG - Intergenic
916493645 1:165325941-165325963 TGGGGGAAGGAAGAGGAGGCAGG - Intronic
917243579 1:172975776-172975798 GGGGGTAAACAAGAGGAGGGTGG - Intergenic
917729934 1:177864735-177864757 TGGCCCAAGCAAGAGGAGCCTGG + Intergenic
918069049 1:181121722-181121744 TAGGAGAGGCCAGAGGAGGCAGG - Intergenic
918257210 1:182759494-182759516 AGGGATAAGAAAGAGTTGGCAGG - Intergenic
918385964 1:184007748-184007770 TGGGATAAGCTTGAGGACCCTGG - Intronic
919028415 1:192206896-192206918 TGGGATAAGTATTAGGAGGTGGG - Intergenic
919232323 1:194790122-194790144 TGGGATAAGCAGGAGGACAGAGG - Intergenic
919465427 1:197918356-197918378 GGGCATAAGCAATAGGAGGACGG + Intronic
919792671 1:201302338-201302360 TGTGAAGAGCAAGAGGAGGGAGG + Intronic
920308584 1:205034521-205034543 TGGTATGAGCTGGAGGAGGCAGG + Intergenic
920511329 1:206554544-206554566 TGGACTTAGGAAGAGGAGGCTGG - Intronic
922011797 1:221596225-221596247 TGCGATCAGCAGGAGGAGACAGG - Intergenic
922762135 1:228139883-228139905 TGACATAAGCGGGAGGAGGCGGG + Intergenic
922798671 1:228353874-228353896 GGGGACATGCAAGTGGAGGCTGG + Intronic
924131201 1:240910432-240910454 TGGGATAGGCAGGAGGAAGAGGG + Intronic
924645324 1:245872345-245872367 TGGGTGAAGCAGCAGGAGGCGGG - Intronic
1062996177 10:1869398-1869420 TGGGATGGACCAGAGGAGGCAGG + Intergenic
1063961040 10:11305547-11305569 TGGGATTAGGAAGAGAAGGAAGG + Intronic
1064193966 10:13230627-13230649 TCTGATGTGCAAGAGGAGGCTGG + Intronic
1065589994 10:27253734-27253756 TCTGATCAGCAGGAGGAGGCGGG + Intergenic
1066108666 10:32177652-32177674 TGGGAAAAGCAGGGGCAGGCAGG - Intergenic
1066220621 10:33334604-33334626 TGGGAAAAGGGAGAGGAAGCCGG - Exonic
1067791493 10:49291802-49291824 TGGGATAAGGAAAAGGAGCTAGG - Intergenic
1069291552 10:66786371-66786393 GGGTAGAAGCAAGAGGAGGAAGG - Intronic
1070516723 10:77214826-77214848 TGAGTAAAGCAGGAGGAGGCTGG - Intronic
1070919251 10:80173684-80173706 TGCTATTAGCAAGAGCAGGCAGG - Intronic
1071662744 10:87521424-87521446 AGGGAAGGGCAAGAGGAGGCAGG - Intronic
1071728865 10:88227892-88227914 TGAGACAAGCAAGCAGAGGCTGG - Intergenic
1072083089 10:92052898-92052920 GGCCATAAGCAGGAGGAGGCAGG + Intronic
1073156820 10:101354079-101354101 GGGGGGAAGGAAGAGGAGGCGGG + Exonic
1073676208 10:105649909-105649931 TGTGGTGAGCAAGAGGAGACAGG - Intergenic
1075100868 10:119505197-119505219 TGGGCTAAGCAGGAGGCCGCAGG + Intronic
1075480225 10:122774526-122774548 TGGAAGAGGAAAGAGGAGGCTGG - Intergenic
1076142727 10:128092736-128092758 TGATATGAGCAAGGGGAGGCGGG - Intergenic
1076157751 10:128216466-128216488 TGGCATAAGCCAGCAGAGGCAGG + Intergenic
1076387545 10:130068085-130068107 TGGGGCAGGCAACAGGAGGCTGG - Intergenic
1076445117 10:130509158-130509180 TGGGACTGGCAGGAGGAGGCTGG + Intergenic
1076448260 10:130533867-130533889 TTGGGGGAGCAAGAGGAGGCTGG - Intergenic
1076714155 10:132354795-132354817 TGGGAGAAACAAGAGGAGGCCGG + Intronic
1076732848 10:132446971-132446993 TGGGAGAAGCGGGAGGAGGAGGG + Intronic
1078945198 11:16058673-16058695 TGAGCCAAGCAAGAGAAGGCAGG + Intronic
1079083284 11:17428534-17428556 TGGGAGTAGCAAGGGGAGGCCGG + Intronic
1080230544 11:30014760-30014782 TGGAAAAATCAAGAGGAGACAGG - Intronic
1080820654 11:35802952-35802974 AGGGAAAGGCAGGAGGAGGCAGG + Intronic
1081686494 11:45046880-45046902 TGGGAGGAGGAGGAGGAGGCAGG - Intergenic
1081780121 11:45704654-45704676 TGGGAGAAGAAAGAGGAGGTGGG - Intergenic
1081857967 11:46315975-46315997 TCGGTTAAGCAAAAGAAGGCTGG + Intronic
1084894357 11:72254636-72254658 TGGGATGAGCTAGAGGAATCAGG + Intergenic
1085282571 11:75340765-75340787 AGGGTTAAGAAAGAGGAGCCTGG + Intronic
1085456658 11:76669279-76669301 TGGCCTGGGCAAGAGGAGGCAGG + Intronic
1087814272 11:102641253-102641275 TGAGACAAGGCAGAGGAGGCTGG + Intergenic
1088617607 11:111646593-111646615 GGGGATAAGAAGGAGCAGGCAGG - Intronic
1089390531 11:118098784-118098806 CTGGATAAGTAAGAAGAGGCAGG + Intronic
1089806296 11:121093797-121093819 TCTGATCAGCAGGAGGAGGCAGG - Intergenic
1090213932 11:124943574-124943596 TGGGATGTGGAAGAGGAGGAAGG + Intergenic
1091601060 12:1918057-1918079 TGGGAGGAGAAAGAGGAGGCCGG + Intronic
1093210920 12:16307972-16307994 TGAGGTGAGGAAGAGGAGGCTGG + Intergenic
1093785986 12:23192736-23192758 TGGGGGAAGGAAGAAGAGGCAGG - Intergenic
1095523510 12:43096530-43096552 AGGGAAAAGCAAGAGGAGAAAGG - Intergenic
1096744947 12:53720436-53720458 TGGGATATACAACAGGTGGCAGG + Intronic
1098002921 12:65963610-65963632 TCTGATAAGCAAGAGTGGGCGGG + Exonic
1100362308 12:93889989-93890011 TGGGGTGAGGAAGAGGAAGCTGG - Intronic
1100898405 12:99211489-99211511 TGAGCTAAGCAAGAGGAGATGGG - Intronic
1101883366 12:108641019-108641041 TGGGATACGCAAGAAGAGATGGG + Intergenic
1102230095 12:111256417-111256439 GTGGACAAGCGAGAGGAGGCAGG - Intronic
1102492310 12:113296744-113296766 AGGGTTAAGCCAGAGAAGGCTGG - Exonic
1103117349 12:118347637-118347659 TAGGATAAGCCAGAAGAGGTGGG - Intronic
1103350996 12:120283541-120283563 TGAGATAAGCCAGGGGAGGCTGG - Intergenic
1105277551 13:18944535-18944557 AGGGGTAAGGATGAGGAGGCTGG - Intergenic
1106793705 13:33182969-33182991 TGGGATATGCAACAGCAGCCTGG - Intronic
1106940722 13:34776113-34776135 TGGAATATGCAAGAGAAGGCTGG + Intergenic
1107596957 13:41973276-41973298 TGGGATGTGCCACAGGAGGCAGG - Intergenic
1108475019 13:50807402-50807424 TGAGAGAAGCAGGAGGAGGGAGG - Intronic
1108605978 13:52039018-52039040 TGGAATAACCAATAGGAGCCAGG + Intronic
1109881742 13:68487213-68487235 TTGCATAAGCCAGTGGAGGCAGG + Intergenic
1109995673 13:70121832-70121854 TGGGAAAAGCAAGAAGAAGGAGG + Intergenic
1110103240 13:71635715-71635737 TGGGATATGGAAGAGGGGGGAGG - Intronic
1110394321 13:75012135-75012157 TGGGATACCTGAGAGGAGGCAGG + Intergenic
1111396153 13:87672130-87672152 TGCGAGGAGCCAGAGGAGGCTGG + Intergenic
1111700714 13:91684418-91684440 TAAGATAAGCAAGAGTATGCCGG - Intronic
1112810628 13:103214478-103214500 TGGCATAAACAAGAGAAAGCTGG + Intergenic
1115224069 14:31085364-31085386 GGAGAGAAGCAAGAGCAGGCTGG + Exonic
1115645666 14:35367175-35367197 TGGGGTGGGCAAGGGGAGGCTGG - Intergenic
1116991738 14:51284522-51284544 AGAGATAAGTAAAAGGAGGCAGG - Intergenic
1117978701 14:61321695-61321717 GAGGAGAAGCAAGAGGAGGCGGG + Exonic
1120513380 14:85442208-85442230 AGGAATAAGCAAGAGCAGGAAGG + Intergenic
1120565533 14:86050999-86051021 AGGGAGAGGGAAGAGGAGGCGGG - Intergenic
1120589264 14:86355963-86355985 TGGGAGAAGGAGGCGGAGGCGGG - Intergenic
1120691399 14:87597362-87597384 GGGGATATGGAACAGGAGGCAGG - Intergenic
1121989336 14:98540051-98540073 TGGGGTGAGCTAGAGGAGGTGGG - Intergenic
1122356827 14:101127841-101127863 TGGAGCCAGCAAGAGGAGGCAGG - Intergenic
1123104884 14:105836742-105836764 TGGGACAAAGAACAGGAGGCAGG + Intergenic
1125521171 15:40348536-40348558 TGGGATCTGGAAGAGGAGACGGG - Intergenic
1126801660 15:52303547-52303569 TAGCTTAAGCAAGAGGTGGCTGG + Intergenic
1128403531 15:67311119-67311141 TGTGGTAAGCAAGGGGAGTCAGG + Intronic
1128690258 15:69719308-69719330 TATGATGAGCAAGTGGAGGCTGG + Intergenic
1129154745 15:73710797-73710819 TGTGAGAAGCTAAAGGAGGCTGG - Intronic
1129228102 15:74181465-74181487 TGGGAGAAGAAAGCTGAGGCAGG + Intronic
1129294066 15:74590020-74590042 TGGGAGAAGGAAGCTGAGGCTGG + Intronic
1129819442 15:78587568-78587590 TCAGATAAGCAAGAAGAGGCTGG + Intronic
1130970403 15:88727678-88727700 TGTGATAAGGATGAGGAAGCAGG + Intergenic
1131036513 15:89226005-89226027 TGGGACAGGCAAGTGGAGGCTGG + Intergenic
1131094662 15:89647769-89647791 AGGGCTAAACAAGAAGAGGCCGG - Intronic
1131109845 15:89758389-89758411 GGGGACAGGGAAGAGGAGGCTGG - Intergenic
1131860241 15:96645570-96645592 TGGCACAAGCAAGATGAAGCCGG - Intergenic
1132066910 15:98738742-98738764 TGGGATAGTCAAGAGAATGCTGG - Intronic
1132220292 15:100100253-100100275 TCGAAGAAGCAAGAGGAGGGAGG - Intronic
1132828255 16:1915571-1915593 TTAGAAAAGCAAGAGGAGGGTGG - Intronic
1133450376 16:5899053-5899075 TGGAATAAGAGAGGGGAGGCAGG - Intergenic
1133450631 16:5901034-5901056 TGGAATAATGGAGAGGAGGCAGG - Intergenic
1134475488 16:14570042-14570064 TGAAATAGGAAAGAGGAGGCCGG + Intronic
1134649599 16:15898200-15898222 AGGGAGAAGAAAGAGGAGGAGGG - Intergenic
1135327470 16:21536075-21536097 TTAGATAAGAAAAAGGAGGCCGG + Intergenic
1136075056 16:27811567-27811589 TGTGAAAAGCAGGAGGATGCTGG - Intronic
1136231339 16:28887401-28887423 TGGGAAGGGAAAGAGGAGGCAGG - Intronic
1136337822 16:29622095-29622117 TTAGATAAGAAAAAGGAGGCCGG + Intergenic
1136515589 16:30766336-30766358 TGGGATCAGCAACAGGATTCAGG - Intronic
1136607775 16:31348185-31348207 TGGGATAAGCTAGAGGAAGTGGG + Intergenic
1137481925 16:48858995-48859017 TGGGCTAAGCATGGGGAGGGGGG + Intergenic
1138200155 16:55082439-55082461 TCGGCTCAGCAAGAGCAGGCTGG + Intergenic
1139133377 16:64172928-64172950 AGAGATAAGAAAGAGCAGGCAGG - Intergenic
1139225130 16:65227378-65227400 TGGAACAAGCAACAGAAGGCAGG + Intergenic
1139708894 16:68761340-68761362 TGGGATAAACATGTGGGGGCAGG - Intronic
1141514549 16:84535055-84535077 TGGGAGAAGGAAGAGGAGTAAGG - Intronic
1141527137 16:84618546-84618568 TGGGATAGGCAAGAAGAGGGAGG - Intergenic
1141713983 16:85716520-85716542 GGGGAGAAGGAAGAGGAGGGAGG + Intronic
1141775773 16:86121797-86121819 AGGGACAAGCAGGAGGAGGAAGG - Intergenic
1141775785 16:86121837-86121859 CGGGACAAGCAGGAGGAGGGAGG - Intergenic
1141842412 16:86581741-86581763 TGTAATAAGAAAGAGGAGACTGG + Exonic
1141992443 16:87618289-87618311 TGGGCAGAGGAAGAGGAGGCAGG + Intronic
1142002237 16:87670528-87670550 AAGGATAACCAACAGGAGGCTGG - Intronic
1142040574 16:87891169-87891191 TTAGATAAGAAAAAGGAGGCCGG + Intronic
1142487871 17:258562-258584 TGGGATATGCCAGGGGAGGCAGG - Intronic
1142692263 17:1613731-1613753 TGAAATAGGCAAGAGGAGGCTGG - Intronic
1143325323 17:6094761-6094783 TGGCAGAAGCAAGAGAAGGAAGG + Intronic
1145252021 17:21301913-21301935 AGGGATCAGATAGAGGAGGCTGG + Intronic
1147034553 17:37670579-37670601 CGGGAGAAGCAGGAGGAGGGAGG + Intergenic
1148020186 17:44548216-44548238 TGGGAGAAGCAAGAGGGAGAAGG + Intergenic
1148053583 17:44780760-44780782 TGGGATATGCAAGAGGAAGTAGG + Exonic
1148644486 17:49211308-49211330 GGGGATAAGGCAGAGTAGGCTGG + Intronic
1150208273 17:63426055-63426077 TGGGAGCATCAAGAGGAGGCTGG - Exonic
1150454385 17:65294999-65295021 TTAAAGAAGCAAGAGGAGGCTGG + Intergenic
1151331935 17:73415127-73415149 GGGGAAGAGGAAGAGGAGGCTGG - Intronic
1151565692 17:74896589-74896611 TGGGAAAGGCAAGGGAAGGCAGG + Intergenic
1151592050 17:75051641-75051663 TGGGAGAGGCAAGAGGATGGGGG - Intronic
1152031248 17:77844902-77844924 TTGGAGAAGCATGGGGAGGCAGG - Intergenic
1153876913 18:9382199-9382221 TAGAAAAAACAAGAGGAGGCTGG + Intronic
1154011563 18:10579185-10579207 TGGGATAAGCAACAGCAGGAAGG - Intergenic
1155013873 18:21812424-21812446 TGGGATAAGAAAGTGAAGGGAGG + Intronic
1157384181 18:47247901-47247923 TGCCATAAGAAAGAGGATGCGGG - Intronic
1157670503 18:49524557-49524579 TGGGATCACCCAAAGGAGGCTGG + Intergenic
1159882172 18:73868572-73868594 TGGCTTTAGCAAGAGGAGGTAGG - Intergenic
1160479212 18:79222680-79222702 TGTCATAAGCACTAGGAGGCGGG - Intronic
1161112678 19:2478937-2478959 TGGGAGAAGTAGGAGGTGGCTGG - Intergenic
1162841320 19:13358538-13358560 TGGGATAAGAAAGAGGGGGGAGG + Intronic
1163057342 19:14730392-14730414 TGGGATAAGAGAGAAGGGGCTGG - Intronic
1163478942 19:17543179-17543201 TGGGACAAGGAGGAGGAGGTTGG + Intronic
1165069163 19:33245708-33245730 AGCCAAAAGCAAGAGGAGGCTGG - Intergenic
1165773201 19:38389971-38389993 AGGGATAAGCAGGAGGGGGAGGG + Intronic
1166730933 19:45058741-45058763 TGTGATAAGCCAGAGGAAGGAGG - Intronic
1166916077 19:46196833-46196855 TGGGAGAAGGAAGAAGAGGAGGG - Intergenic
1167217689 19:48175652-48175674 AGGGATATGAAGGAGGAGGCTGG + Intronic
1167276519 19:48543441-48543463 AGGGATGAGCAAGATGAGGGTGG + Intergenic
1168035270 19:53714284-53714306 TGGGATGAGCAAGAGCACGGAGG + Intergenic
1168036400 19:53723034-53723056 TGGGATGAGCAAGAGCACGGAGG + Intergenic
1168038002 19:53735690-53735712 TGGGATGAGCAAGAGCACGGAGG + Intergenic
1168039085 19:53743674-53743696 TGGGATGAGCAAGAGCACGGAGG + Intergenic
1168270397 19:55246744-55246766 GGGGATGAGGAAGACGAGGCTGG - Intronic
1168312534 19:55468134-55468156 TGGGATAGGGGAGAGGAGGCTGG - Intergenic
925040071 2:725722-725744 TGAGATAGGGAAGTGGAGGCAGG + Intergenic
925944893 2:8851804-8851826 TGGGCTGAGAAAGAGGAGGTGGG - Intergenic
927000533 2:18790146-18790168 TGCAATAAGAAAGAGGACGCTGG - Intergenic
927048009 2:19299374-19299396 TGGGAAGAGAAAGAGGAGGTTGG + Intergenic
930247927 2:49003873-49003895 GGGGATGGGCCAGAGGAGGCAGG - Intronic
931528019 2:63179501-63179523 TGGGAAGAGCAAGGGAAGGCTGG - Intronic
931683627 2:64773411-64773433 TGGGAAGAGGCAGAGGAGGCTGG + Intergenic
933322801 2:80798064-80798086 TGGCAAAAGCAATAGGAGGTGGG + Intergenic
933637286 2:84721908-84721930 TGGGGGAAGAGAGAGGAGGCAGG + Intronic
933995827 2:87669065-87669087 TGGTAGAGGCAGGAGGAGGCAGG + Intergenic
936045153 2:109181711-109181733 CTGGAGAAGAAAGAGGAGGCAGG - Intronic
936298030 2:111281847-111281869 TGGTAGAGGCAGGAGGAGGCAGG - Intergenic
937398969 2:121564926-121564948 TGGGATAAGCAGGAGAATGCAGG + Intronic
938821605 2:134966178-134966200 TGCAATAAGCATGAGGATGCAGG + Intronic
941019950 2:160397357-160397379 TGGGTTATGCTAGAGAAGGCAGG - Intronic
941166585 2:162089570-162089592 TGGCATAAGAAACAGGAGGTAGG - Intergenic
941579104 2:167272931-167272953 TGGGATAAGGAAGATGGGGGAGG + Intergenic
942486573 2:176446077-176446099 TGGGCTAGGCAAGAGGGAGCCGG - Intergenic
945043956 2:205765622-205765644 TGGGATAAGCAAGAGGAGGCAGG + Intronic
946237397 2:218332564-218332586 TGGGCAAAGCAGGAGAAGGCAGG - Intronic
946296205 2:218785588-218785610 TAGGATGAGGAAGAGGAAGCAGG + Intronic
947665933 2:231905257-231905279 TGGGGTTGGCAAGAGGAGACGGG + Intergenic
948136402 2:235639427-235639449 TGGGCAGAGGAAGAGGAGGCTGG + Intronic
948158135 2:235801103-235801125 TAGCAAAAGCAAGGGGAGGCTGG - Intronic
948295135 2:236855157-236855179 TGGGAGAAGGAGGATGAGGCAGG - Intergenic
1169391485 20:5194758-5194780 TGGGAAAAGGAAGGGGAGGGTGG - Exonic
1169845613 20:9988127-9988149 AGGGGTAAGGAAGAGGAGGGTGG + Intronic
1170054094 20:12179842-12179864 GGGGATAAGGAAGAGAAGGGAGG + Intergenic
1170830314 20:19833924-19833946 GGGGACAAGCAGGAGGGGGCAGG - Intergenic
1172274121 20:33670577-33670599 TAGGATGAGGAAGAGGGGGCAGG - Intronic
1173041399 20:39467082-39467104 TGAGAGGAGGAAGAGGAGGCTGG - Intergenic
1173365360 20:42380193-42380215 TGGGATAAGGAAACTGAGGCAGG - Intronic
1173997053 20:47346439-47346461 GGGGAGCAGCAGGAGGAGGCTGG - Intronic
1174486947 20:50867264-50867286 TGTCATAGGCCAGAGGAGGCTGG - Intronic
1174718582 20:52786455-52786477 TGGGATACGGAAGATGAAGCTGG + Intergenic
1175155294 20:56967287-56967309 ACGGAGAAGAAAGAGGAGGCTGG - Intergenic
1178470817 21:32891138-32891160 TGGGATCAGGAAGAGGAGGGAGG + Intergenic
1178793520 21:35722220-35722242 TGGGATAAGGGAGAGGGAGCTGG - Intronic
1178817994 21:35949298-35949320 TGGGATAGGGTGGAGGAGGCAGG - Intronic
1178908516 21:36655427-36655449 TGGGATAATCAAGAGGGATCAGG - Intergenic
1181529239 22:23507146-23507168 AGGGAAAAGCGAGAGGACGCAGG - Intergenic
1181581706 22:23832405-23832427 TGGGAGAAGCAAGGGCAGGCCGG - Intronic
1182422706 22:30256291-30256313 TGGGAGGAGGAAGAGGAGGAAGG + Intergenic
1182464260 22:30504818-30504840 TGGGATTAGAAATATGAGGCCGG + Intronic
1182496515 22:30712195-30712217 TTGGAGAAGAAAGAGGAGGAGGG - Intronic
1183131296 22:35839359-35839381 TGGCATAACCAAAAAGAGGCAGG + Intronic
1183307265 22:37089410-37089432 GGGGATAGGGGAGAGGAGGCTGG - Intronic
1183672675 22:39282465-39282487 AGGGACACGCAAGAGGGGGCTGG - Intergenic
1184199828 22:42960698-42960720 AGGGAAGAGAAAGAGGAGGCAGG + Intronic
1184408909 22:44315487-44315509 TGGGCTCAGTAGGAGGAGGCTGG - Intergenic
1185143370 22:49116388-49116410 TGAGAGGAGCGAGAGGAGGCCGG - Intergenic
950642799 3:14359356-14359378 TGGGGTAAGGAAGTTGAGGCAGG + Intergenic
950681822 3:14590611-14590633 GGAGAGAAGCAAGTGGAGGCAGG - Intergenic
952374375 3:32753565-32753587 TGGGAAAAGCTAGAGGAGCAAGG + Intronic
952670676 3:35963676-35963698 TGGAATAAGCAGGAGGAAGAAGG + Intergenic
955160181 3:56457805-56457827 TGGAATTAGCCAGAGGAGGGAGG - Intronic
956130997 3:66053817-66053839 TGGAATAAGAAAGAGGGGGCTGG - Intergenic
956602528 3:71037555-71037577 GGGGAGCAGCAAGAGGAAGCAGG - Intronic
956737619 3:72250195-72250217 GGGGAGAAGCAGGAGGAGGCTGG + Intergenic
959569555 3:107868333-107868355 TGGGATAAGGCAGAGGGGGGAGG - Intergenic
960274255 3:115709227-115709249 CTGCAAAAGCAAGAGGAGGCAGG - Intronic
961037871 3:123655302-123655324 GGAGAGAACCAAGAGGAGGCTGG - Intronic
961345538 3:126260954-126260976 GGGGAGAAGGAAGAGGAGGGAGG - Intergenic
963562276 3:146880844-146880866 TGGGAAAAGCCAGAGGAAACAGG + Intergenic
965677556 3:171213731-171213753 TGGGATCAGAAAGAAGAGGGTGG + Intronic
967947867 3:194818460-194818482 TGGGAGAAGGACGACGAGGCTGG - Intergenic
968617137 4:1582495-1582517 TGGGAAGACCAGGAGGAGGCTGG + Intergenic
968672158 4:1857431-1857453 GCGGAGAAGCAGGAGGAGGCAGG - Intergenic
969625729 4:8304414-8304436 TCTGCTAAGCCAGAGGAGGCTGG + Intronic
969863976 4:10061042-10061064 CGTTATTAGCAAGAGGAGGCAGG - Intergenic
970274619 4:14385141-14385163 TGGGAGAAGAAAAAGGAGGAGGG - Intergenic
970369780 4:15395147-15395169 TGGGAAAAGCAAGACAGGGCAGG + Intronic
970734409 4:19149186-19149208 TGGGAAAAGCAAGAGGACTCAGG + Intergenic
971640940 4:29132153-29132175 TGTGCAAAGCAAGAGAAGGCCGG - Intergenic
971937438 4:33170321-33170343 TGGGATTAGAAAGAGGAAGATGG + Intergenic
972385621 4:38562881-38562903 TGGGATTACCCAGAGGAAGCTGG + Intergenic
973212365 4:47631003-47631025 TGGGGTGAGCTAGAGGAGGAGGG + Intronic
974322117 4:60364768-60364790 TGGGATGATAAAGATGAGGCTGG - Intergenic
976632627 4:87254393-87254415 TGGAAGAAGCAAGAGAAGGTTGG - Intergenic
980178152 4:129371858-129371880 TGGGATGAGAGAGATGAGGCTGG + Intergenic
980988501 4:139718376-139718398 AAGGAGAAGCAAGGGGAGGCTGG + Exonic
981311174 4:143299458-143299480 TAGGATAAGCAAGAGGTCACAGG - Intergenic
983197445 4:164823049-164823071 TGAGATAAGGAGGAGGTGGCTGG - Intergenic
983666232 4:170188029-170188051 TGGGGTGAGGAAGAGTAGGCGGG + Intergenic
983734356 4:171039172-171039194 TTGGAAAAGCAAGAGGAGTTGGG - Intergenic
983738222 4:171090733-171090755 TAGGATAAGCAGGAGGGGGCTGG - Intergenic
985877750 5:2613183-2613205 TCTGAGACGCAAGAGGAGGCAGG - Intergenic
986624091 5:9707217-9707239 TGGGAGAAGAATGAGAAGGCAGG + Intronic
988153142 5:27413885-27413907 TGGGGAAAGGAAGAGGAGGAGGG - Intergenic
988208949 5:28177614-28177636 TGGGAGAGGCATGAGGAGGAGGG - Intergenic
989444992 5:41517232-41517254 TGGGGTTTGCAAGAAGAGGCTGG - Intergenic
990039062 5:51357395-51357417 TCAGATTATCAAGAGGAGGCAGG + Intergenic
990601170 5:57359971-57359993 TGGGTTGAAAAAGAGGAGGCAGG + Intergenic
990826354 5:59903475-59903497 AGGGATAAGACAGAGCAGGCAGG + Intronic
992325426 5:75655213-75655235 TGGGATAAGTGAGAGGGGCCGGG + Intronic
994252994 5:97558875-97558897 TTGGAGAAGGAAGAGAAGGCTGG + Intergenic
994525467 5:100901037-100901059 GGCGTTAAGGAAGAGGAGGCGGG - Intronic
994719910 5:103368531-103368553 TGGGATAACCAGGAGGAGAGGGG - Intergenic
995077181 5:107999695-107999717 GGATATAAGCAAAAGGAGGCAGG + Intronic
997211718 5:132080820-132080842 TGGGGCAGGGAAGAGGAGGCTGG - Intergenic
997450377 5:133977781-133977803 TGGGATGAGCAGGCTGAGGCAGG + Intronic
998909560 5:146944050-146944072 AGAGATAAGGATGAGGAGGCTGG - Intronic
999051805 5:148531205-148531227 TGGGAGAAGCCAGAGGTGGAAGG + Intronic
999738951 5:154534651-154534673 TGGGTTCAGCCAGGGGAGGCTGG + Intergenic
1000335362 5:160237935-160237957 TGGGAGAGCCCAGAGGAGGCAGG - Intronic
1000866510 5:166521192-166521214 AGAGATAAGCAAGAAGAGGTGGG + Intergenic
1000997375 5:167973335-167973357 TGGGATTACCAACAGGAGGTGGG - Intronic
1001587123 5:172840534-172840556 TGGGAGAAGCAATAGCAAGCAGG + Intronic
1001690160 5:173626909-173626931 TGAGAAAAGCAAGGGAAGGCAGG - Intergenic
1002406008 5:179032071-179032093 TGGGAAAAAGAAGAGGAGGAAGG - Intronic
1002532013 5:179852893-179852915 TGGGCTCAGGAAGTGGAGGCAGG - Intronic
1004288727 6:14347191-14347213 AGGGATGGGCACGAGGAGGCTGG - Intergenic
1004698799 6:18059177-18059199 GAGGATGAGCAAGAGGAGGAAGG - Intergenic
1005249167 6:23924761-23924783 TGAGATAAGCAGGAGCTGGCTGG - Intergenic
1006450971 6:34105535-34105557 TCGGATCAGGGAGAGGAGGCAGG - Intronic
1006939469 6:37742449-37742471 TGGTTTGGGCAAGAGGAGGCAGG - Intergenic
1007089475 6:39173170-39173192 TGGGAGAAGCTTGAGGAGTCTGG - Intergenic
1007361189 6:41357408-41357430 TGGGATAAGCAAAAGGTAGATGG + Intergenic
1010351540 6:74880911-74880933 TTGGATAAACACCAGGAGGCTGG + Intergenic
1011113111 6:83859984-83860006 TGGGATCAGAAAGAGGTTGCAGG - Intronic
1015181988 6:130370401-130370423 TGGGATGAGGAGGAGGAGGCTGG + Intronic
1016058367 6:139602673-139602695 TGAGATAAGGAATAGGAGGCAGG - Intergenic
1016989393 6:149918856-149918878 AGGGAGAAGGAAGAGGAGGGTGG + Intronic
1017004591 6:150020718-150020740 AGGGAGAAGGAAGAGGAGGGTGG + Intronic
1017019783 6:150130866-150130888 TGGGAGGAGCAGGAAGAGGCTGG + Intergenic
1017136500 6:151151816-151151838 GGGGAAAAGAAAGAGGAGTCTGG + Intergenic
1017297357 6:152813614-152813636 TTGGATAAGCAAAAGGATGCTGG + Intergenic
1017382323 6:153844940-153844962 TCAGATCAGCAGGAGGAGGCAGG - Intergenic
1018038053 6:159898568-159898590 AGGGAAAAGGAAGAGGAGGTAGG - Intergenic
1018865899 6:167746800-167746822 TGGCACAAGCCAGGGGAGGCTGG + Intergenic
1019520461 7:1458608-1458630 TGGGAGCAGCAGGAGGTGGCAGG - Intronic
1019768793 7:2870540-2870562 AGCGATGAGTAAGAGGAGGCAGG + Intergenic
1020406491 7:7841066-7841088 TGGGATTGGGAAGAGGAGACAGG + Intronic
1021316823 7:19157934-19157956 TCTGATAAGCAGGAGGAGGTAGG + Intergenic
1021405373 7:20261616-20261638 TGGGTTAAACAGGAGGAGTCAGG - Intergenic
1022021006 7:26399092-26399114 TGGGGAAGGAAAGAGGAGGCGGG - Intergenic
1022604207 7:31792373-31792395 TTGAATAAGCATGAGGAGGATGG + Intronic
1022833344 7:34090396-34090418 AGGGAGAAGCAATATGAGGCTGG - Intronic
1022952479 7:35351762-35351784 TGGGCTGAGCATGAGGAGGGAGG + Intergenic
1023409358 7:39874004-39874026 TGGGATAAGGAAGATGAGGAAGG - Intergenic
1024513409 7:50220952-50220974 TGGGGTAAGAAAATGGAGGCTGG - Intergenic
1025043574 7:55670024-55670046 TGGGATAAGGAAGATGAGGAAGG + Intergenic
1025136494 7:56418533-56418555 TGGGATAAGGAAGATGAGGAAGG + Intergenic
1025187394 7:56871591-56871613 AGGGGTAAGGAAGAAGAGGCCGG - Intergenic
1025188808 7:56881395-56881417 AGGGGTAAGGAAGAAGAGGCCGG - Intergenic
1025683128 7:63695525-63695547 AGGGGTAAGGAAGAAGAGGCTGG + Intergenic
1025684531 7:63705329-63705351 AGGGGTAAGGAAGAAGAGGCCGG + Intergenic
1025764876 7:64434629-64434651 TGGGATAGGGAAGAGCAGGGTGG - Intergenic
1026448310 7:70505238-70505260 TTGGATGAGAAAGAGAAGGCTGG + Intronic
1028150658 7:87367672-87367694 TTGACTAAGCAAGAGGAAGCGGG - Intronic
1033598308 7:142871739-142871761 TGGGATAATCAACAGGGGTCTGG - Exonic
1033981582 7:147171242-147171264 AGGCTGAAGCAAGAGGAGGCTGG - Intronic
1034346495 7:150388505-150388527 AGAGAGAAGAAAGAGGAGGCAGG + Intronic
1034902210 7:154914642-154914664 GGGGACCAGCAAGACGAGGCGGG + Intergenic
1035300044 7:157891223-157891245 GGGGATTACCAAGAGGAGCCTGG - Intronic
1035675581 8:1453268-1453290 GGGGAGAAGCAGGAGGAGCCTGG + Intergenic
1036452416 8:8880563-8880585 TGGGAGAAGGGCGAGGAGGCAGG - Intronic
1036507604 8:9369603-9369625 TGGCATTAGCTAGACGAGGCTGG - Intergenic
1037234828 8:16705845-16705867 TGGCAGAAGAAACAGGAGGCTGG + Intergenic
1038020759 8:23550412-23550434 AGGAATGAGCAAGAGGAGGCTGG + Intronic
1038115228 8:24546429-24546451 TGGGAGATGCAAGAAGAGGCTGG + Intergenic
1038355344 8:26824017-26824039 GGGGCTGAGCAAGAAGAGGCAGG - Intronic
1038401206 8:27286345-27286367 TGGGAGAGGGAAGAGGAGGCTGG - Exonic
1039406699 8:37319019-37319041 TGGGATGAGGAAGAAGGGGCAGG - Intergenic
1040518370 8:48153245-48153267 TGCAATTAGCAAGAGGAAGCAGG - Intergenic
1040861568 8:52005031-52005053 GGGGAAAAGCCATAGGAGGCTGG + Intergenic
1043379132 8:79684068-79684090 TCTGAGAAGCAGGAGGAGGCAGG - Intergenic
1044428998 8:92086822-92086844 TGGGATGAGAAGGAAGAGGCAGG - Intronic
1044822978 8:96170148-96170170 TGGGAGAAAGAAGAGGAGGCGGG - Intergenic
1044860144 8:96515006-96515028 TGGGTAAAGCAAGAGAATGCTGG + Intronic
1045198952 8:99959486-99959508 TGTGATAAGGGAGAGGAGGGAGG + Intergenic
1045475978 8:102553064-102553086 TGGAAAAAGCAATAGGAGGCCGG + Intronic
1045537729 8:103048057-103048079 TGGAATAAGGAAGAGAACGCTGG + Intronic
1045961189 8:107970570-107970592 TCAGATAAGCATGAGGATGCTGG + Intronic
1046899533 8:119509156-119509178 ATAGCTAAGCAAGAGGAGGCAGG + Intergenic
1048034660 8:130666088-130666110 TGGGAAAAGCAGGAGAAGGCAGG + Intergenic
1048370746 8:133774018-133774040 TGGGAGAAGGAAGGGGAGGGTGG + Intergenic
1050225669 9:3452198-3452220 TGGGCCAAGCTAGAGAAGGCTGG - Intronic
1050622776 9:7472281-7472303 TAGGCTGAGCTAGAGGAGGCTGG + Intergenic
1051093489 9:13437688-13437710 TTGCATAAGGAAGAGGAGTCAGG - Intergenic
1055269391 9:74540272-74540294 AGTGATAAGCTAGAGGAGGCAGG - Intronic
1055433906 9:76272881-76272903 TTGGAGAAGCAAGAAGAGGCAGG - Intronic
1055829016 9:80358707-80358729 TGGGAGAGGAAAGAGGAGGAGGG + Intergenic
1056031815 9:82561112-82561134 TGAAAAAAGCAAAAGGAGGCCGG + Intergenic
1056925510 9:90830879-90830901 TTTCATAAGAAAGAGGAGGCCGG - Intronic
1057006224 9:91562937-91562959 AGGCAAAAGCAAGAGGAGACAGG - Intergenic
1057898889 9:98932184-98932206 TGAGATAAGCCAGAGACGGCAGG - Intergenic
1058223730 9:102334974-102334996 TGGGATAAGCTAAAGGAAGGAGG - Intergenic
1058941443 9:109816385-109816407 TGGGATAAGATAGAGGAAGCTGG + Intronic
1060299745 9:122368255-122368277 TGGGACAAGCTGGAGAAGGCAGG + Intergenic
1060624339 9:125096592-125096614 TGGGGACAGGAAGAGGAGGCTGG - Intronic
1060643630 9:125259986-125260008 TGAAATAAGCAAGAGGAGGCCGG - Intergenic
1061116124 9:128613482-128613504 TGAGGTAAGCAAAGGGAGGCGGG + Exonic
1061678573 9:132231609-132231631 TGGGAAAAGCAAGAGAGGGTTGG - Intronic
1062714990 9:138005157-138005179 TGCCATGAGCATGAGGAGGCAGG - Intronic
1188665841 X:32819973-32819995 TGAGATAAGTAAGCAGAGGCTGG + Intronic
1189009623 X:37034255-37034277 TTGGTTAAGCAAGGGGAGGGGGG + Intergenic
1189038947 X:37521462-37521484 TTGGTTAAGCAAGGGGAGGGGGG - Intronic
1189213899 X:39306966-39306988 TGGGATAAGACAGAGGAGGGAGG + Intergenic
1189553341 X:42115541-42115563 TGGGACAAGCTAAAGGAAGCTGG + Intergenic
1191061206 X:56298514-56298536 TGTGGTAAGCAAGAGGTGCCTGG - Intergenic
1191931593 X:66379573-66379595 GGTAGTAAGCAAGAGGAGGCCGG - Intergenic
1192550718 X:72051570-72051592 TAGGAGAAGCAAGAGGAAGGAGG - Intergenic
1193724946 X:85027179-85027201 TGGCAGAAGCAAGAGAAGTCGGG + Intronic
1194849143 X:98851377-98851399 TGGGCTATGAAAGAGGTGGCTGG + Intergenic
1195066337 X:101241651-101241673 AGGTATCTGCAAGAGGAGGCAGG - Exonic
1195909164 X:109872076-109872098 TGGGAGAGGGAGGAGGAGGCAGG - Intergenic
1199785323 X:151100066-151100088 TAGGATAACCCAGAGGAAGCAGG + Intergenic