ID: 945049572

View in Genome Browser
Species Human (GRCh38)
Location 2:205810362-205810384
Sequence GAGGCCTACTGAAGTTCACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945049572_945049579 19 Left 945049572 2:205810362-205810384 CCCTGTGAACTTCAGTAGGCCTC No data
Right 945049579 2:205810404-205810426 TATTTTCACAGCTGCCCTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945049572 Original CRISPR GAGGCCTACTGAAGTTCACA GGG (reversed) Intergenic
No off target data available for this crispr