ID: 945049979

View in Genome Browser
Species Human (GRCh38)
Location 2:205814436-205814458
Sequence CAGCAACAATAGATGGCACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945049976_945049979 -3 Left 945049976 2:205814416-205814438 CCTCTCATTTCTCCATTCATCAG No data
Right 945049979 2:205814436-205814458 CAGCAACAATAGATGGCACAAGG No data
945049975_945049979 1 Left 945049975 2:205814412-205814434 CCAACCTCTCATTTCTCCATTCA No data
Right 945049979 2:205814436-205814458 CAGCAACAATAGATGGCACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945049979 Original CRISPR CAGCAACAATAGATGGCACA AGG Intergenic
No off target data available for this crispr