ID: 945051893

View in Genome Browser
Species Human (GRCh38)
Location 2:205831907-205831929
Sequence GAAACCAGGTGAGCAGAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945051893_945051895 -8 Left 945051893 2:205831907-205831929 CCTGGCTCTGCTCACCTGGTTTC No data
Right 945051895 2:205831922-205831944 CTGGTTTCTCACCCTCTAGCAGG No data
945051893_945051897 1 Left 945051893 2:205831907-205831929 CCTGGCTCTGCTCACCTGGTTTC No data
Right 945051897 2:205831931-205831953 CACCCTCTAGCAGGCTCACCGGG No data
945051893_945051900 15 Left 945051893 2:205831907-205831929 CCTGGCTCTGCTCACCTGGTTTC No data
Right 945051900 2:205831945-205831967 CTCACCGGGATTTGCTCATATGG No data
945051893_945051903 26 Left 945051893 2:205831907-205831929 CCTGGCTCTGCTCACCTGGTTTC No data
Right 945051903 2:205831956-205831978 TTGCTCATATGGTGATGACAGGG No data
945051893_945051896 0 Left 945051893 2:205831907-205831929 CCTGGCTCTGCTCACCTGGTTTC No data
Right 945051896 2:205831930-205831952 TCACCCTCTAGCAGGCTCACCGG No data
945051893_945051902 25 Left 945051893 2:205831907-205831929 CCTGGCTCTGCTCACCTGGTTTC No data
Right 945051902 2:205831955-205831977 TTTGCTCATATGGTGATGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945051893 Original CRISPR GAAACCAGGTGAGCAGAGCC AGG (reversed) Intergenic
No off target data available for this crispr