ID: 945051900

View in Genome Browser
Species Human (GRCh38)
Location 2:205831945-205831967
Sequence CTCACCGGGATTTGCTCATA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945051893_945051900 15 Left 945051893 2:205831907-205831929 CCTGGCTCTGCTCACCTGGTTTC No data
Right 945051900 2:205831945-205831967 CTCACCGGGATTTGCTCATATGG No data
945051894_945051900 1 Left 945051894 2:205831921-205831943 CCTGGTTTCTCACCCTCTAGCAG No data
Right 945051900 2:205831945-205831967 CTCACCGGGATTTGCTCATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945051900 Original CRISPR CTCACCGGGATTTGCTCATA TGG Intergenic
No off target data available for this crispr