ID: 945053827

View in Genome Browser
Species Human (GRCh38)
Location 2:205850524-205850546
Sequence TAGGGGCCTGCTCTTTGTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945053827_945053837 7 Left 945053827 2:205850524-205850546 CCCCAACAAAGAGCAGGCCCCTA No data
Right 945053837 2:205850554-205850576 GTAAGCTGGGACGGACATTCTGG No data
945053827_945053839 11 Left 945053827 2:205850524-205850546 CCCCAACAAAGAGCAGGCCCCTA No data
Right 945053839 2:205850558-205850580 GCTGGGACGGACATTCTGGAGGG No data
945053827_945053831 -7 Left 945053827 2:205850524-205850546 CCCCAACAAAGAGCAGGCCCCTA No data
Right 945053831 2:205850540-205850562 GCCCCTAAGGAAATGTAAGCTGG No data
945053827_945053836 -2 Left 945053827 2:205850524-205850546 CCCCAACAAAGAGCAGGCCCCTA No data
Right 945053836 2:205850545-205850567 TAAGGAAATGTAAGCTGGGACGG No data
945053827_945053840 21 Left 945053827 2:205850524-205850546 CCCCAACAAAGAGCAGGCCCCTA No data
Right 945053840 2:205850568-205850590 ACATTCTGGAGGGATAAAGATGG No data
945053827_945053833 -6 Left 945053827 2:205850524-205850546 CCCCAACAAAGAGCAGGCCCCTA No data
Right 945053833 2:205850541-205850563 CCCCTAAGGAAATGTAAGCTGGG No data
945053827_945053838 10 Left 945053827 2:205850524-205850546 CCCCAACAAAGAGCAGGCCCCTA No data
Right 945053838 2:205850557-205850579 AGCTGGGACGGACATTCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945053827 Original CRISPR TAGGGGCCTGCTCTTTGTTG GGG (reversed) Intergenic
No off target data available for this crispr