ID: 945054599

View in Genome Browser
Species Human (GRCh38)
Location 2:205857479-205857501
Sequence GACCAAGGGTGTTACAATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945054599_945054604 11 Left 945054599 2:205857479-205857501 CCACCATTGTAACACCCTTGGTC No data
Right 945054604 2:205857513-205857535 AGCTGCCCCTGAGCTGAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945054599 Original CRISPR GACCAAGGGTGTTACAATGG TGG (reversed) Intergenic
No off target data available for this crispr