ID: 945057127

View in Genome Browser
Species Human (GRCh38)
Location 2:205878910-205878932
Sequence GAATATCCAAGGCCCTTGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945057115_945057127 16 Left 945057115 2:205878871-205878893 CCTATGATGGAAAACTCCCTTGT No data
Right 945057127 2:205878910-205878932 GAATATCCAAGGCCCTTGTGGGG No data
945057118_945057127 0 Left 945057118 2:205878887-205878909 CCCTTGTGGCCAGGAACCCACTG No data
Right 945057127 2:205878910-205878932 GAATATCCAAGGCCCTTGTGGGG No data
945057121_945057127 -9 Left 945057121 2:205878896-205878918 CCAGGAACCCACTGGAATATCCA No data
Right 945057127 2:205878910-205878932 GAATATCCAAGGCCCTTGTGGGG No data
945057119_945057127 -1 Left 945057119 2:205878888-205878910 CCTTGTGGCCAGGAACCCACTGG No data
Right 945057127 2:205878910-205878932 GAATATCCAAGGCCCTTGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945057127 Original CRISPR GAATATCCAAGGCCCTTGTG GGG Intergenic
No off target data available for this crispr