ID: 945062876

View in Genome Browser
Species Human (GRCh38)
Location 2:205924178-205924200
Sequence CTTCTCCTAGAATCACAACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945062876_945062879 -7 Left 945062876 2:205924178-205924200 CCCAGTTGTGATTCTAGGAGAAG No data
Right 945062879 2:205924194-205924216 GGAGAAGAGAGCGAGCTCCTGGG No data
945062876_945062884 6 Left 945062876 2:205924178-205924200 CCCAGTTGTGATTCTAGGAGAAG No data
Right 945062884 2:205924207-205924229 AGCTCCTGGGCCTGGGGGAGCGG No data
945062876_945062881 -1 Left 945062876 2:205924178-205924200 CCCAGTTGTGATTCTAGGAGAAG No data
Right 945062881 2:205924200-205924222 GAGAGCGAGCTCCTGGGCCTGGG No data
945062876_945062880 -2 Left 945062876 2:205924178-205924200 CCCAGTTGTGATTCTAGGAGAAG No data
Right 945062880 2:205924199-205924221 AGAGAGCGAGCTCCTGGGCCTGG No data
945062876_945062890 23 Left 945062876 2:205924178-205924200 CCCAGTTGTGATTCTAGGAGAAG No data
Right 945062890 2:205924224-205924246 GAGCGGGATGACAGCCACAGGGG No data
945062876_945062888 21 Left 945062876 2:205924178-205924200 CCCAGTTGTGATTCTAGGAGAAG No data
Right 945062888 2:205924222-205924244 GGGAGCGGGATGACAGCCACAGG No data
945062876_945062882 0 Left 945062876 2:205924178-205924200 CCCAGTTGTGATTCTAGGAGAAG No data
Right 945062882 2:205924201-205924223 AGAGCGAGCTCCTGGGCCTGGGG No data
945062876_945062883 1 Left 945062876 2:205924178-205924200 CCCAGTTGTGATTCTAGGAGAAG No data
Right 945062883 2:205924202-205924224 GAGCGAGCTCCTGGGCCTGGGGG No data
945062876_945062878 -8 Left 945062876 2:205924178-205924200 CCCAGTTGTGATTCTAGGAGAAG No data
Right 945062878 2:205924193-205924215 AGGAGAAGAGAGCGAGCTCCTGG No data
945062876_945062889 22 Left 945062876 2:205924178-205924200 CCCAGTTGTGATTCTAGGAGAAG No data
Right 945062889 2:205924223-205924245 GGAGCGGGATGACAGCCACAGGG No data
945062876_945062885 7 Left 945062876 2:205924178-205924200 CCCAGTTGTGATTCTAGGAGAAG No data
Right 945062885 2:205924208-205924230 GCTCCTGGGCCTGGGGGAGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945062876 Original CRISPR CTTCTCCTAGAATCACAACT GGG (reversed) Intergenic
No off target data available for this crispr