ID: 945062881

View in Genome Browser
Species Human (GRCh38)
Location 2:205924200-205924222
Sequence GAGAGCGAGCTCCTGGGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945062877_945062881 -2 Left 945062877 2:205924179-205924201 CCAGTTGTGATTCTAGGAGAAGA No data
Right 945062881 2:205924200-205924222 GAGAGCGAGCTCCTGGGCCTGGG No data
945062876_945062881 -1 Left 945062876 2:205924178-205924200 CCCAGTTGTGATTCTAGGAGAAG No data
Right 945062881 2:205924200-205924222 GAGAGCGAGCTCCTGGGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945062881 Original CRISPR GAGAGCGAGCTCCTGGGCCT GGG Intergenic
No off target data available for this crispr