ID: 945063064

View in Genome Browser
Species Human (GRCh38)
Location 2:205925273-205925295
Sequence CTAGCAAATTTTTGTATTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945063064_945063070 3 Left 945063064 2:205925273-205925295 CCAAAAATACAAAAATTTGCTAG No data
Right 945063070 2:205925299-205925321 GTAGGCCACTTGGGAGGCTGAGG No data
945063064_945063075 26 Left 945063064 2:205925273-205925295 CCAAAAATACAAAAATTTGCTAG No data
Right 945063075 2:205925322-205925344 TGGGACGATCGCTGGAGCCCAGG No data
945063064_945063071 6 Left 945063064 2:205925273-205925295 CCAAAAATACAAAAATTTGCTAG No data
Right 945063071 2:205925302-205925324 GGCCACTTGGGAGGCTGAGGTGG No data
945063064_945063067 -7 Left 945063064 2:205925273-205925295 CCAAAAATACAAAAATTTGCTAG No data
Right 945063067 2:205925289-205925311 TTGCTAGTTGGTAGGCCACTTGG No data
945063064_945063068 -6 Left 945063064 2:205925273-205925295 CCAAAAATACAAAAATTTGCTAG No data
Right 945063068 2:205925290-205925312 TGCTAGTTGGTAGGCCACTTGGG No data
945063064_945063074 18 Left 945063064 2:205925273-205925295 CCAAAAATACAAAAATTTGCTAG No data
Right 945063074 2:205925314-205925336 GGCTGAGGTGGGACGATCGCTGG No data
945063064_945063076 29 Left 945063064 2:205925273-205925295 CCAAAAATACAAAAATTTGCTAG No data
Right 945063076 2:205925325-205925347 GACGATCGCTGGAGCCCAGGAGG No data
945063064_945063072 7 Left 945063064 2:205925273-205925295 CCAAAAATACAAAAATTTGCTAG No data
Right 945063072 2:205925303-205925325 GCCACTTGGGAGGCTGAGGTGGG 0: 328
1: 14757
2: 108975
3: 248211
4: 377146
945063064_945063069 -3 Left 945063064 2:205925273-205925295 CCAAAAATACAAAAATTTGCTAG No data
Right 945063069 2:205925293-205925315 TAGTTGGTAGGCCACTTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945063064 Original CRISPR CTAGCAAATTTTTGTATTTT TGG (reversed) Intergenic
No off target data available for this crispr