ID: 945063073

View in Genome Browser
Species Human (GRCh38)
Location 2:205925304-205925326
Sequence TCCCACCTCAGCCTCCCAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 16772
Summary {0: 311, 1: 810, 2: 3089, 3: 5438, 4: 7124}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945063073_945063076 -2 Left 945063073 2:205925304-205925326 CCACTTGGGAGGCTGAGGTGGGA 0: 311
1: 810
2: 3089
3: 5438
4: 7124
Right 945063076 2:205925325-205925347 GACGATCGCTGGAGCCCAGGAGG No data
945063073_945063075 -5 Left 945063073 2:205925304-205925326 CCACTTGGGAGGCTGAGGTGGGA 0: 311
1: 810
2: 3089
3: 5438
4: 7124
Right 945063075 2:205925322-205925344 TGGGACGATCGCTGGAGCCCAGG No data
945063073_945063077 4 Left 945063073 2:205925304-205925326 CCACTTGGGAGGCTGAGGTGGGA 0: 311
1: 810
2: 3089
3: 5438
4: 7124
Right 945063077 2:205925331-205925353 CGCTGGAGCCCAGGAGGTCAAGG 0: 13
1: 585
2: 4885
3: 16227
4: 42512

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945063073 Original CRISPR TCCCACCTCAGCCTCCCAAG TGG (reversed) Intergenic
Too many off-targets to display for this crispr