ID: 945063075

View in Genome Browser
Species Human (GRCh38)
Location 2:205925322-205925344
Sequence TGGGACGATCGCTGGAGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945063064_945063075 26 Left 945063064 2:205925273-205925295 CCAAAAATACAAAAATTTGCTAG No data
Right 945063075 2:205925322-205925344 TGGGACGATCGCTGGAGCCCAGG No data
945063073_945063075 -5 Left 945063073 2:205925304-205925326 CCACTTGGGAGGCTGAGGTGGGA 0: 311
1: 810
2: 3089
3: 5438
4: 7124
Right 945063075 2:205925322-205925344 TGGGACGATCGCTGGAGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945063075 Original CRISPR TGGGACGATCGCTGGAGCCC AGG Intergenic
No off target data available for this crispr