ID: 945063841

View in Genome Browser
Species Human (GRCh38)
Location 2:205931741-205931763
Sequence TCTGCCACACAGAAAAAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945063835_945063841 26 Left 945063835 2:205931692-205931714 CCTTACTGGTTGCAGGAGGGGAC No data
Right 945063841 2:205931741-205931763 TCTGCCACACAGAAAAAGGTGGG No data
945063837_945063841 4 Left 945063837 2:205931714-205931736 CCAATCAGAGGTACCTTCAATTT No data
Right 945063841 2:205931741-205931763 TCTGCCACACAGAAAAAGGTGGG No data
945063838_945063841 -9 Left 945063838 2:205931727-205931749 CCTTCAATTTCTCATCTGCCACA No data
Right 945063841 2:205931741-205931763 TCTGCCACACAGAAAAAGGTGGG No data
945063831_945063841 30 Left 945063831 2:205931688-205931710 CCAGCCTTACTGGTTGCAGGAGG No data
Right 945063841 2:205931741-205931763 TCTGCCACACAGAAAAAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945063841 Original CRISPR TCTGCCACACAGAAAAAGGT GGG Intergenic
No off target data available for this crispr