ID: 945064768 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:205939542-205939564 |
| Sequence | TGGCAAATAGCAGTGGTGGA CGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 945064768_945064776 | 12 | Left | 945064768 | 2:205939542-205939564 | CCGTCCACCACTGCTATTTGCCA | No data | ||
| Right | 945064776 | 2:205939577-205939599 | CCCGCTGACTTCCATCCCTCCGG | No data | ||||
| 945064768_945064778 | 22 | Left | 945064768 | 2:205939542-205939564 | CCGTCCACCACTGCTATTTGCCA | No data | ||
| Right | 945064778 | 2:205939587-205939609 | TCCATCCCTCCGGATCCAGCAGG | 0: 12 1: 72 2: 118 3: 157 4: 197 |
||||
| 945064768_945064780 | 23 | Left | 945064768 | 2:205939542-205939564 | CCGTCCACCACTGCTATTTGCCA | No data | ||
| Right | 945064780 | 2:205939588-205939610 | CCATCCCTCCGGATCCAGCAGGG | 0: 20 1: 71 2: 130 3: 138 4: 219 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 945064768 | Original CRISPR | TGGCAAATAGCAGTGGTGGA CGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||