ID: 945064768

View in Genome Browser
Species Human (GRCh38)
Location 2:205939542-205939564
Sequence TGGCAAATAGCAGTGGTGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945064768_945064776 12 Left 945064768 2:205939542-205939564 CCGTCCACCACTGCTATTTGCCA No data
Right 945064776 2:205939577-205939599 CCCGCTGACTTCCATCCCTCCGG No data
945064768_945064778 22 Left 945064768 2:205939542-205939564 CCGTCCACCACTGCTATTTGCCA No data
Right 945064778 2:205939587-205939609 TCCATCCCTCCGGATCCAGCAGG 0: 12
1: 72
2: 118
3: 157
4: 197
945064768_945064780 23 Left 945064768 2:205939542-205939564 CCGTCCACCACTGCTATTTGCCA No data
Right 945064780 2:205939588-205939610 CCATCCCTCCGGATCCAGCAGGG 0: 20
1: 71
2: 130
3: 138
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945064768 Original CRISPR TGGCAAATAGCAGTGGTGGA CGG (reversed) Intergenic
No off target data available for this crispr