ID: 945065736

View in Genome Browser
Species Human (GRCh38)
Location 2:205946402-205946424
Sequence AGCCACATCCTGTAACTTAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945065736_945065743 1 Left 945065736 2:205946402-205946424 CCCCTAAGTTACAGGATGTGGCT No data
Right 945065743 2:205946426-205946448 CTTCGTTGCCCCCAGGGGGATGG No data
945065736_945065749 20 Left 945065736 2:205946402-205946424 CCCCTAAGTTACAGGATGTGGCT No data
Right 945065749 2:205946445-205946467 ATGGAAACTTGAAGACTCAAGGG No data
945065736_945065742 -3 Left 945065736 2:205946402-205946424 CCCCTAAGTTACAGGATGTGGCT No data
Right 945065742 2:205946422-205946444 GCTTCTTCGTTGCCCCCAGGGGG No data
945065736_945065748 19 Left 945065736 2:205946402-205946424 CCCCTAAGTTACAGGATGTGGCT No data
Right 945065748 2:205946444-205946466 GATGGAAACTTGAAGACTCAAGG No data
945065736_945065739 -6 Left 945065736 2:205946402-205946424 CCCCTAAGTTACAGGATGTGGCT No data
Right 945065739 2:205946419-205946441 GTGGCTTCTTCGTTGCCCCCAGG No data
945065736_945065741 -4 Left 945065736 2:205946402-205946424 CCCCTAAGTTACAGGATGTGGCT No data
Right 945065741 2:205946421-205946443 GGCTTCTTCGTTGCCCCCAGGGG No data
945065736_945065740 -5 Left 945065736 2:205946402-205946424 CCCCTAAGTTACAGGATGTGGCT No data
Right 945065740 2:205946420-205946442 TGGCTTCTTCGTTGCCCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945065736 Original CRISPR AGCCACATCCTGTAACTTAG GGG (reversed) Intergenic