ID: 945069632

View in Genome Browser
Species Human (GRCh38)
Location 2:205977324-205977346
Sequence GCCGGCAGGCCCGCAAGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945069623_945069632 14 Left 945069623 2:205977287-205977309 CCCAGTGGGCATGGGCTCGGCAA No data
Right 945069632 2:205977324-205977346 GCCGGCAGGCCCGCAAGCCCTGG No data
945069619_945069632 26 Left 945069619 2:205977275-205977297 CCAGCGTGAGTTCCCAGTGGGCA No data
Right 945069632 2:205977324-205977346 GCCGGCAGGCCCGCAAGCCCTGG No data
945069629_945069632 -10 Left 945069629 2:205977311-205977333 CCCCACACTGGGAGCCGGCAGGC No data
Right 945069632 2:205977324-205977346 GCCGGCAGGCCCGCAAGCCCTGG No data
945069624_945069632 13 Left 945069624 2:205977288-205977310 CCAGTGGGCATGGGCTCGGCAAG No data
Right 945069632 2:205977324-205977346 GCCGGCAGGCCCGCAAGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945069632 Original CRISPR GCCGGCAGGCCCGCAAGCCC TGG Intergenic
No off target data available for this crispr