ID: 945073407

View in Genome Browser
Species Human (GRCh38)
Location 2:206013689-206013711
Sequence TAAAATGAAAATATGCAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 796
Summary {0: 1, 1: 0, 2: 9, 3: 70, 4: 716}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945073405_945073407 -6 Left 945073405 2:206013672-206013694 CCGGAATGGTGGAACTTTAAAAT 0: 1
1: 0
2: 0
3: 22
4: 201
Right 945073407 2:206013689-206013711 TAAAATGAAAATATGCAGCTGGG 0: 1
1: 0
2: 9
3: 70
4: 716
945073401_945073407 15 Left 945073401 2:206013651-206013673 CCTCAGTATCTTAGAAGTATGCC 0: 1
1: 0
2: 12
3: 77
4: 257
Right 945073407 2:206013689-206013711 TAAAATGAAAATATGCAGCTGGG 0: 1
1: 0
2: 9
3: 70
4: 716

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945073407 Original CRISPR TAAAATGAAAATATGCAGCT GGG Intronic
901103968 1:6741033-6741055 AATAATGAAATTATGCATCTTGG - Intergenic
902238263 1:15071617-15071639 AAATATGCAAATATGCAGCACGG + Intronic
902295459 1:15463752-15463774 TAAAATGCAAATATTTGGCTGGG + Intronic
903203332 1:21761592-21761614 TAAAATATAAAAATGAAGCTGGG + Intronic
904944161 1:34187139-34187161 GAAAATGAAAATATAGAGCCTGG - Intronic
905679343 1:39856321-39856343 TAAAATGAAAATAATCAGCTGGG + Intronic
905972385 1:42151970-42151992 TAAAATGAAAACAACCATCTGGG - Intergenic
905999543 1:42412422-42412444 TAAGATGAAAATACACAGGTGGG - Intronic
906737788 1:48149099-48149121 TAAAATAAAAATAGGCAAATGGG - Intergenic
907041570 1:51265427-51265449 TAAAATTAAAATATGCATTGTGG - Intronic
908384622 1:63629269-63629291 TTTAATAAAAATCTGCAGCTTGG - Intronic
908998115 1:70183847-70183869 TAAAAAGGAAATTTGGAGCTAGG - Intronic
909143474 1:71896910-71896932 ATAAATGAAAAAATGAAGCTTGG + Intronic
909340478 1:74525921-74525943 CAAAATGATATTATGTAGCTGGG - Intronic
909807157 1:79885561-79885583 TAAAATGAAAAGATGCCACATGG - Intergenic
909954562 1:81763287-81763309 TAAAAAAAAAATCTTCAGCTGGG + Intronic
910044553 1:82896386-82896408 AAAAATGGAAATATATAGCTAGG + Intergenic
911185869 1:94904584-94904606 TAAAAATAAAAAATTCAGCTGGG + Intronic
911317398 1:96371386-96371408 TAAAATGTAAAAATGCAGGCCGG - Intergenic
911332156 1:96537702-96537724 TAAAATTAAAATAAGAAACTGGG - Intergenic
911687792 1:100797126-100797148 TAAAATGTAAACAAGCAACTGGG - Intergenic
911698197 1:100918340-100918362 TAAAAGCAAAATATAGAGCTGGG + Intronic
911925500 1:103825653-103825675 TAAAATGAAAATATTCTGCTTGG + Intergenic
912563127 1:110564481-110564503 TAAAAGGAAAAAATCAAGCTGGG - Intergenic
914011416 1:143782173-143782195 TACAATAAAACTATTCAGCTGGG + Intergenic
914166417 1:145178961-145178983 TACAATAAAACTATTCAGCTGGG - Intergenic
914650037 1:149690813-149690835 TACAATAAAACTATTCAGCTGGG + Intergenic
915341878 1:155181077-155181099 GAAAATGAAAATAATTAGCTGGG + Intronic
915874128 1:159594442-159594464 AAAAATTAAAATATGCAGGTAGG - Intergenic
916642036 1:166740696-166740718 TAAAATAATAATTTGCATCTGGG - Intergenic
918312699 1:183296807-183296829 TAAAAAGCAAATATGGGGCTGGG - Intronic
918460600 1:184772798-184772820 TAAGATGAAAATATTCAGTAAGG + Intergenic
918635734 1:186772083-186772105 AGAAATGAAGATATGCAGTTAGG - Intergenic
919519218 1:198566499-198566521 TCAAAAGAAAACATACAGCTGGG - Intergenic
919714769 1:200764806-200764828 TAAAAAGAAAAGATGTGGCTGGG + Intronic
921474336 1:215588032-215588054 TCAAGTGAAAATCTGCAGTTTGG - Intronic
921497121 1:215855071-215855093 TAAAAAGAAATTAGGCAGATAGG - Intronic
922125279 1:222714873-222714895 TAAAATGAAAACATTGGGCTGGG - Intronic
922165646 1:223113628-223113650 TAAAATAAAAATATAGAGATGGG + Intronic
922502557 1:226108144-226108166 GAAAATGAAAATAAGAAGCTAGG - Intergenic
923114356 1:230920982-230921004 TCAAATGAAAGTATTCTGCTAGG + Intronic
923351739 1:233114190-233114212 TAAAATTACAATATGAAACTGGG + Intronic
923464312 1:234234585-234234607 TAAAAAAAAAATCTGTAGCTGGG - Intronic
924213405 1:241793884-241793906 TAAAATAGAATTATTCAGCTGGG + Intronic
924695907 1:246399317-246399339 TAAAAATAAAATATGGGGCTGGG - Intronic
1063006374 10:1974913-1974935 TAAAATGACTATACGTAGCTTGG + Intergenic
1063712822 10:8496055-8496077 GAAAATAAAAATATACAGCCGGG - Intergenic
1064026543 10:11853244-11853266 AAAAAAGAAAATATGCAAGTGGG - Intronic
1064526934 10:16266801-16266823 AAAAATGGAAATCTGCAGATGGG + Intergenic
1065045139 10:21740624-21740646 TAAAATGTATATATTCATCTTGG - Intronic
1065399488 10:25281261-25281283 TCAAATGAAAAAATACAGTTAGG + Intronic
1065753376 10:28909058-28909080 TACAATTAAAATTTGCAACTTGG + Intergenic
1065784438 10:29200559-29200581 TAAAATAAAAACAAGCATCTGGG - Intergenic
1066511045 10:36096444-36096466 TTACAAGAAAATATGCAGCATGG - Intergenic
1066525151 10:36270048-36270070 TAAAATCAAATAATGCAGATTGG + Intergenic
1067907272 10:50306423-50306445 TAAAATTTAAAAATGCATCTTGG - Exonic
1068352383 10:55864854-55864876 TAATTTGAAGATATGCAGCCAGG + Intergenic
1068623708 10:59215298-59215320 TAAAAGAAAAACATGCAGTTTGG + Intronic
1068961912 10:62875521-62875543 AACAATTATAATATGCAGCTAGG + Intronic
1070092380 10:73300700-73300722 TAAAATGAAAAAAATTAGCTGGG + Intronic
1071395889 10:85223807-85223829 AAAAATGAAAATTTTCTGCTGGG - Intergenic
1071766826 10:88676117-88676139 TAAATTGAAAATAAACTGCTTGG + Intronic
1071767570 10:88685751-88685773 TAAAATAAAAAAATGCTTCTTGG + Intergenic
1072091417 10:92131500-92131522 GAAAATAAAAATATTTAGCTTGG + Intronic
1073958851 10:108902906-108902928 TAAAATGAAAATGTGCATTAGGG + Intergenic
1074833550 10:117267203-117267225 TAAAATGAAAATACACTCCTTGG - Intronic
1074849841 10:117430930-117430952 TAAAATAAAAATAATTAGCTGGG - Intergenic
1074887162 10:117702992-117703014 CAAAATGAAACTGTGCTGCTTGG - Intergenic
1075071397 10:119322106-119322128 TAAAAATAAAATAAGTAGCTGGG - Intronic
1075237519 10:120744376-120744398 TAAAAGGAATAGAAGCAGCTGGG - Intergenic
1075385886 10:122055057-122055079 TAAAATGCAAAAATTTAGCTGGG + Intronic
1077647300 11:3937008-3937030 TAAAATTAATCTCTGCAGCTGGG + Intronic
1078497019 11:11827672-11827694 TAAAATAAAAATAAATAGCTGGG - Intergenic
1079574387 11:21985258-21985280 TAAAATGAAAGTATGAGCCTGGG + Intergenic
1080213924 11:29819443-29819465 TAGAATGAAAATAGACAGATAGG + Intergenic
1080311621 11:30899993-30900015 AAAAATGAAAATGTGCAGACAGG + Intronic
1080549239 11:33356437-33356459 TAGTATGCAAATATGCAACTTGG - Exonic
1080671250 11:34380593-34380615 GAAAATGAAAGTATAGAGCTTGG + Intergenic
1080777696 11:35401639-35401661 TAAAAAAATAGTATGCAGCTAGG - Intronic
1080806075 11:35655299-35655321 TGAAATGAAAATATTCAGAAGGG + Intergenic
1081790496 11:45779942-45779964 TAAAATTAAAAACTTCAGCTGGG + Intergenic
1081932809 11:46884306-46884328 TAAAATAAAAATATTCAGCCGGG + Intronic
1082036986 11:47652977-47652999 TAAAATGCAAACAATCAGCTGGG - Intergenic
1082714788 11:56598999-56599021 CAAAATGAAGAAATGTAGCTTGG - Intergenic
1083080445 11:60086907-60086929 TAAAATGAAAATTCGTGGCTGGG + Intergenic
1083366410 11:62144034-62144056 AAAAATGAACATAGCCAGCTGGG + Intronic
1083790665 11:64983277-64983299 CAAAAAGAAAATTAGCAGCTGGG - Intergenic
1084083598 11:66844493-66844515 TAAAATGGAAACATAGAGCTAGG + Intronic
1084528042 11:69709632-69709654 TAAAGTGAAAATATCGAGGTTGG + Intergenic
1084775337 11:71371034-71371056 GAAAACGAAAATCTCCAGCTGGG + Intergenic
1084832348 11:71779325-71779347 AAAAATTAAAATAATCAGCTGGG + Intergenic
1084854617 11:71974585-71974607 TAAAATGAAAATCTGATTCTTGG + Intronic
1084999539 11:73017864-73017886 TGAAATGAAAATAAGTACCTAGG - Intronic
1085646752 11:78228941-78228963 TAAAATGAACAAATCCAGATGGG - Intronic
1085669181 11:78445797-78445819 TAAAATGTTTATTTGCAGCTAGG + Intronic
1085917584 11:80908153-80908175 AAAAATGAAAATAAACAGCTAGG + Intergenic
1086461363 11:87008889-87008911 CATAATGAAAATATGTAGCCAGG + Intergenic
1087017688 11:93570480-93570502 TAAAAATAAAATATGGGGCTGGG - Intergenic
1087026207 11:93652451-93652473 TAAAATGCAAACATGCGCCTAGG + Intergenic
1087146080 11:94813061-94813083 TAAAAGGAAAATATAAGGCTAGG - Intronic
1087418929 11:97896250-97896272 GAAAATGAAAATATGCAAATAGG + Intergenic
1088421808 11:109656841-109656863 AAAAATGAAAAAATGCACCCAGG + Intergenic
1088859619 11:113787497-113787519 CAAAATGAAAATATTTACCTGGG - Intergenic
1090745409 11:129701256-129701278 TAAAAGGTAAATATGAGGCTGGG + Intergenic
1092450326 12:8595495-8595517 TAAAATGAAAGTTGGCAGCTGGG - Intergenic
1093285439 12:17254192-17254214 TAAAATAAAAATATTCTGCCTGG + Intergenic
1093437785 12:19156585-19156607 TATAATGAAAAATTGCTGCTGGG - Intronic
1093906374 12:24697140-24697162 TGAACTCAAAATATTCAGCTGGG + Intergenic
1094132506 12:27089559-27089581 TAGAATGAAAATACACAACTCGG - Intergenic
1094426547 12:30322358-30322380 AAAAATAAACATTTGCAGCTGGG - Intergenic
1094539909 12:31354652-31354674 TAAAATGTAAACATTTAGCTGGG + Intergenic
1094665813 12:32519640-32519662 TAAAATAAAAAAATAAAGCTGGG + Intronic
1094689120 12:32751361-32751383 TAAAAAGAAAATACGAGGCTGGG - Intronic
1096269906 12:50156763-50156785 AAAAAGGAAATTATGTAGCTGGG + Intronic
1096271864 12:50171815-50171837 TAAAATGAAGCTAACCAGCTGGG - Intergenic
1096355945 12:50941145-50941167 AAAAATGAAAAAATTCAGCTGGG - Intergenic
1096367606 12:51041811-51041833 TTACATTAAAATGTGCAGCTGGG - Intergenic
1096822397 12:54246924-54246946 TAAAATGAAAAGATACAGTTAGG - Intronic
1096833791 12:54335011-54335033 TAAAATAAAAAAAATCAGCTGGG + Intronic
1096983116 12:55740066-55740088 TAAAATGAAAAGCTGCAGGATGG + Intergenic
1097734014 12:63162246-63162268 GAAGATGAAAATATGAAGATGGG + Intergenic
1097908166 12:64942006-64942028 TAAAATGAAAAAATGAGTCTTGG + Intergenic
1098401253 12:70078651-70078673 AAAAAAGAGAATATGCAGATAGG - Intergenic
1098485600 12:71017735-71017757 TAAATTCAAGATATGCAACTAGG + Intergenic
1099807649 12:87540685-87540707 TAGAATTAAAATATACAGCTTGG - Intergenic
1100038854 12:90286575-90286597 TTAAATGTAAAGATGCAGATAGG - Intergenic
1100189499 12:92175667-92175689 TAAAGTGAAAACCTGCAGATTGG - Intergenic
1100486957 12:95038912-95038934 TAAAATGTAAATTTGCATATTGG - Intronic
1100727886 12:97428540-97428562 AAAAATGAAAATATGCATTAAGG - Intergenic
1101377921 12:104187019-104187041 AAAAATAAAAAAATGTAGCTGGG - Intergenic
1101644897 12:106622613-106622635 AAAAAAAAAAAAATGCAGCTTGG - Intronic
1101645201 12:106625015-106625037 CAAAATGAAAATGTGTTGCTCGG + Intronic
1101940007 12:109092898-109092920 TAAAATGAAAATGTGAAACTAGG - Exonic
1102017079 12:109655246-109655268 AAAAATTAAAAAATTCAGCTGGG - Intergenic
1102114468 12:110391929-110391951 TAAAATGCAAAAAAGTAGCTGGG + Intronic
1102797399 12:115700703-115700725 TGAAATGAACATATTCTGCTGGG + Intergenic
1103048958 12:117762568-117762590 TAAAAAGAATATGGGCAGCTGGG + Intronic
1103135060 12:118499756-118499778 AGAAATGAAAAAATTCAGCTGGG - Intergenic
1103686929 12:122739554-122739576 TGAAATTAAAATATGTGGCTGGG - Intergenic
1104310235 12:127648104-127648126 TGAAATGAAAAGATGCGTCTGGG + Intergenic
1104497218 12:129252202-129252224 TAAAACCAAAAGATGGAGCTGGG + Intronic
1105585078 13:21736245-21736267 TGAAGTGTAAATATGCAGCGAGG + Intergenic
1106203458 13:27565584-27565606 TAATATCATAAAATGCAGCTAGG + Intronic
1106560900 13:30845471-30845493 TAAAATGAAAAAAAGTAGCCAGG + Intergenic
1106573045 13:30946801-30946823 TAAAATGTCAATATGCAGGATGG - Intronic
1106626410 13:31425204-31425226 GAATATGAAAATATCCACCTTGG - Intergenic
1106641868 13:31593066-31593088 AAAAAGTAAAAAATGCAGCTGGG - Intergenic
1107315429 13:39126505-39126527 TAAAAGAAAAGTTTGCAGCTTGG - Intergenic
1107376334 13:39808553-39808575 TAAAATGAAAATATGAAGGTGGG - Intergenic
1107865940 13:44703384-44703406 TTAAATGAAAATATAATGCTGGG - Intergenic
1108387593 13:49914859-49914881 TGAAATGAAAATAAGCATTTGGG - Exonic
1108544523 13:51479444-51479466 CAAGATGTAAATATACAGCTAGG - Intergenic
1108729818 13:53223493-53223515 TGAAATGAAAAGATGCCTCTGGG + Intergenic
1109116516 13:58394837-58394859 TAACATGCAATTTTGCAGCTTGG + Intergenic
1109281054 13:60356240-60356262 TAAAAATACAAAATGCAGCTGGG + Intergenic
1109315107 13:60740727-60740749 AAAAAAGAAAATTTGCAGCCTGG - Intergenic
1109444972 13:62424586-62424608 TAAAATGAAAAGATTAGGCTAGG + Intergenic
1109486336 13:63026229-63026251 TAAAATGAAAATATTTATTTTGG - Intergenic
1109586209 13:64408080-64408102 AAAAATGAAATTATGCAGCCTGG + Intergenic
1109899608 13:68748853-68748875 TAAAATGAAAATATGTAGATAGG - Intergenic
1109943444 13:69401708-69401730 AAAAATATAAATATGCAGCAAGG + Intergenic
1110301333 13:73931150-73931172 GAAAATTAAAATATGTGGCTAGG - Intronic
1110518022 13:76439433-76439455 TAAAATGCTAATATGGAGGTAGG - Intergenic
1110527894 13:76560765-76560787 TAAAATGCAAATATGGAGAGAGG - Intergenic
1111089617 13:83426670-83426692 TTAAAAGAAAATATGCAAGTGGG - Intergenic
1111467251 13:88630793-88630815 AAAAATTAAAATTTGCAGCTGGG + Intergenic
1111632888 13:90865862-90865884 TAAACTGAAAACAAGCAGATGGG + Intergenic
1111699524 13:91668918-91668940 TAAAGTGAAAATAGGCATCAGGG + Intronic
1114643294 14:24239059-24239081 TAAAAGGAAAAGATGCTGATTGG + Exonic
1115837064 14:37418592-37418614 TAAAAAGAAAATATGTATTTTGG + Intronic
1115990521 14:39145266-39145288 TAAAATGCAAATATGTGGCTGGG + Intergenic
1116271563 14:42775853-42775875 GGAAATGAAAATATGCAGACAGG + Intergenic
1116501530 14:45629516-45629538 TAAATAGAAAATATACAGATTGG + Intergenic
1116894884 14:50306342-50306364 TAAATTAAAAAAATACAGCTGGG - Intronic
1117051246 14:51861550-51861572 CAAAATAAAAAAGTGCAGCTGGG + Intronic
1117570012 14:57038347-57038369 TGAAATAAAAATATGCTTCTTGG - Intergenic
1117966123 14:61208487-61208509 GAAAATGGTAATATCCAGCTTGG - Intronic
1119604675 14:76004836-76004858 TAAAATGAAAAAAATCAGTTGGG - Intronic
1120338679 14:83190750-83190772 TAAAATTAAGATATACAGATGGG - Intergenic
1120617042 14:86719887-86719909 GAAAGAGAAAATATGCAGTTGGG - Intergenic
1120679885 14:87468149-87468171 TAATATGAAAATATGTGGCTGGG - Intergenic
1120800251 14:88680265-88680287 GAAAATGACAATATGCTGTTTGG - Intronic
1121034252 14:90686982-90687004 AAAAAAAAAAATAGGCAGCTGGG - Intronic
1122595994 14:102892708-102892730 TAAAATGTAAATATACTGCAAGG + Intronic
1122669117 14:103356373-103356395 CAAAATGAAAGTAAACAGCTTGG + Intergenic
1122818835 14:104330021-104330043 TAAAATGAAAAGAAGCTTCTGGG + Intergenic
1123144017 14:106110561-106110583 TAAAATGAACAAAGGCAGCAAGG + Intergenic
1123501460 15:20887008-20887030 TAAAATGAGAATACACATCTGGG - Intergenic
1123558713 15:21460707-21460729 TAAAATGAGAATACACATCTGGG - Intergenic
1123577897 15:21690892-21690914 CAGAATTAAAACATGCAGCTGGG + Intergenic
1123594942 15:21897988-21898010 TAAAATGAGAATACACATCTGGG - Intergenic
1123614522 15:22133374-22133396 CAGAATTAAAACATGCAGCTGGG + Intergenic
1123988508 15:25665923-25665945 TAAAATGAAAACCTGCCTCTGGG - Intergenic
1123998919 15:25738342-25738364 TAAAAAGCAGATATCCAGCTAGG + Intronic
1124034079 15:26038166-26038188 TAAAATAAAAATAGGCAGTCTGG - Intergenic
1124052742 15:26213689-26213711 GAAAATGAAAAAATGTAGTTGGG + Intergenic
1124516550 15:30371513-30371535 GAAAAAGAAAATATGCAGTCAGG + Intronic
1124726368 15:32159218-32159240 GAAAAAGAAAATATGCAGTCAGG - Intronic
1124733152 15:32217156-32217178 TAATATGAAAATGTGCTTCTGGG - Intergenic
1125129746 15:36269686-36269708 TAAAAACAAAAAATGTAGCTGGG - Intergenic
1125371974 15:38987525-38987547 TAACCTGAAAATATTTAGCTGGG - Intergenic
1125458164 15:39881836-39881858 AAAAATGTGAATATGCAACTGGG + Intronic
1125688884 15:41580590-41580612 GAAAATGCAAATATTCAGCTGGG + Exonic
1125955994 15:43791682-43791704 TTAAATGTGAACATGCAGCTTGG - Intronic
1125992771 15:44126190-44126212 TAAAATGACACAATCCAGCTTGG + Intronic
1126166409 15:45657819-45657841 TAAAATGCAAGTGTCCAGCTGGG - Intronic
1126200908 15:45984835-45984857 TAAAATAAAAAAAAGCAGTTGGG + Intergenic
1126581241 15:50244461-50244483 AAAAATTAAAAAATGTAGCTGGG - Intronic
1127778273 15:62286777-62286799 AGAAATGAAAATATATAGCTGGG - Intergenic
1127894958 15:63289841-63289863 AAAAATTAAAAAATTCAGCTGGG + Intronic
1128291832 15:66484041-66484063 TCAAATGAAAATGTACAGCCAGG - Intronic
1128332935 15:66767948-66767970 AAAAAAAAAAAGATGCAGCTTGG - Intronic
1128367860 15:67017396-67017418 AAAAAAGAAAAGATGCAGCTGGG + Intergenic
1128396733 15:67233945-67233967 TAAATTGAAAATACTCTGCTGGG + Intronic
1128670077 15:69568011-69568033 TAAAAATAAAAAATTCAGCTGGG + Intergenic
1128807874 15:70546640-70546662 TGAAATGAAAATACACAGATAGG + Intergenic
1128910841 15:71512933-71512955 GAAAATGAAAACATACATCTTGG + Intronic
1129084661 15:73076204-73076226 AAAAATGAAAATATTCATCGTGG - Intronic
1129280802 15:74483471-74483493 AAAAATAAAAATATTTAGCTGGG + Intergenic
1129715951 15:77850998-77851020 TAAAATGAGACTCTGCAGTTCGG - Intergenic
1130843431 15:87723151-87723173 TAAAATTAAAAGGAGCAGCTGGG - Intergenic
1131362929 15:91810199-91810221 AAAAATGTAAATATGCAGAATGG + Intergenic
1131371363 15:91884822-91884844 ATATATGAAAATATGCAGCATGG - Intronic
1131581009 15:93643389-93643411 TAAAATGAAAATAAAAAGCTGGG + Intergenic
1131947413 15:97640289-97640311 TAAAATGAAAATCTTCAATTTGG - Intergenic
1202967061 15_KI270727v1_random:187866-187888 TAAAATGAGAATACACATCTGGG - Intergenic
1202986767 15_KI270727v1_random:425138-425160 CAGAATTAAAACATGCAGCTGGG + Intergenic
1132610661 16:814344-814366 TAAAATGCAAAAATGTAGCCAGG + Intergenic
1133159634 16:3902045-3902067 AAAAAAGTAAATATGTAGCTAGG - Intergenic
1133400634 16:5484008-5484030 AAAAATAAAAATAAACAGCTGGG + Intergenic
1134028804 16:10975420-10975442 TCAAAGTAATATATGCAGCTAGG - Intronic
1134535523 16:15023896-15023918 TCAAATGAAAGTATGCCGGTTGG + Intronic
1135742461 16:24987789-24987811 TAAAATGAAAAAATGAAGCATGG + Intronic
1135754773 16:25087824-25087846 TAAAATGAAAAAATGAAGCATGG + Intergenic
1135998599 16:27272497-27272519 TAAAATAAAAACAGGCAGCCGGG + Intronic
1137011366 16:35324037-35324059 TAAAATAAAAATAATTAGCTGGG + Intergenic
1137015694 16:35372139-35372161 TAAAATAAAAAAATTTAGCTGGG + Intergenic
1137490106 16:48925421-48925443 TAAGATGAAAATATTGATCTTGG + Intergenic
1138938935 16:61765954-61765976 TAAAATTGAAATATGCAGAGAGG - Intronic
1139769432 16:69261911-69261933 TAAAAAGAAAATATGAGGCAGGG + Intronic
1139860519 16:70016887-70016909 TCAAATGAAAGTATGCTGGTTGG - Intergenic
1140313225 16:73868826-73868848 TGACATAAAAATATGGAGCTTGG - Intergenic
1140330926 16:74056059-74056081 AAAAAGGCAAATATGAAGCTGGG + Intergenic
1140780784 16:78294530-78294552 TAAAATGGAAATCTGCATCAAGG - Intronic
1141452159 16:84111903-84111925 AAAAAAAAAAAAATGCAGCTGGG + Intronic
1142365757 16:89648728-89648750 AAAAATGAAAAAAATCAGCTGGG + Intronic
1143575269 17:7788861-7788883 TAAATTAAAAATATGTAGATGGG + Intronic
1143947495 17:10605878-10605900 TAAAATAAAAATATGTAAATGGG - Intergenic
1144390429 17:14788511-14788533 AAAAATGTAAATAAGCAGTTTGG - Intergenic
1144417443 17:15064500-15064522 CAAACTGAAAATATTCAGGTGGG - Intergenic
1144428107 17:15164322-15164344 CAAAGTCAAAATATGCGGCTGGG + Intergenic
1145112253 17:20174342-20174364 TATACTGTAAATATGCAGTTAGG + Intronic
1145829032 17:27900055-27900077 AAAAATTAAAATATTTAGCTGGG + Intergenic
1145995294 17:29101607-29101629 TTATATGAAATTAAGCAGCTGGG - Intronic
1146336115 17:31972122-31972144 TAAAATTAAAAAAATCAGCTGGG + Intronic
1147053345 17:37814727-37814749 TAAAAAGAGAATATTCGGCTGGG - Intergenic
1147226247 17:38979994-38980016 TAAAAAGAAAATATTCTGCTGGG - Intergenic
1147704740 17:42418524-42418546 TAAAATGGAAATACGGGGCTGGG - Intronic
1148926724 17:51093291-51093313 TAAAAAGCAAATATGCAGAAAGG + Intronic
1148947816 17:51280650-51280672 TAAAAAGAAAAAAAGTAGCTGGG + Intronic
1149010349 17:51850205-51850227 TTCTATGAAAATATGCAGCATGG + Intronic
1149675450 17:58456961-58456983 AAAAATGAAAAAAGGCAGCTGGG + Intronic
1149697102 17:58624636-58624658 TTAAATGAAAATATGAAGGCTGG - Intronic
1150073179 17:62169822-62169844 TAAAATAAAAATAGCCACCTGGG + Intergenic
1151831752 17:76556877-76556899 CAAAATAAAAATAATCAGCTGGG + Intergenic
1151847393 17:76666828-76666850 CAACCTGAAAATATGCAGATTGG - Intergenic
1153191392 18:2543647-2543669 TTCAATGAAACTATGCAGCAGGG - Intronic
1154046854 18:10914309-10914331 TAAAAGGAAAATATATAGCATGG + Intronic
1154469940 18:14690553-14690575 TAAAAAGAAAATAATTAGCTGGG + Intergenic
1155124881 18:22863608-22863630 TAAAATGAAAAATTTCTGCTAGG - Intronic
1155593978 18:27461051-27461073 TAAAATGAAAATATATTGCTAGG - Intergenic
1155918380 18:31578150-31578172 GAAAATGAACAAATGCAGGTGGG + Intergenic
1156368421 18:36450630-36450652 TAAAATAAAAATAATTAGCTGGG + Intronic
1156395406 18:36695045-36695067 TCAAAAGAATATTTGCAGCTGGG + Intronic
1156896100 18:42247449-42247471 TATAGTGAACATATGCACCTAGG + Intergenic
1157001265 18:43528509-43528531 TAAAAAAAAAAAAAGCAGCTGGG + Intergenic
1158586838 18:58746312-58746334 TAAAAGTAGAATATGGAGCTGGG - Intronic
1158603914 18:58878092-58878114 TAAAATGACAAAAAGTAGCTAGG + Intronic
1159337211 18:67083857-67083879 TAAAAAGAAAAAAAGCAGCCAGG - Intergenic
1159909394 18:74130769-74130791 TCAACTGTAAATATTCAGCTTGG - Intronic
1160682784 19:419458-419480 GAAAAGGAAAACATGCAGATGGG + Intronic
1161537039 19:4825998-4826020 TAAAATAAAAATAATTAGCTGGG + Intronic
1161540797 19:4850237-4850259 TTAAATAAATACATGCAGCTGGG - Intronic
1162048798 19:8019492-8019514 TAAAATTAAAATAAATAGCTGGG + Intronic
1162269244 19:9600551-9600573 TAAAAAAAAAATAGGCTGCTGGG + Intergenic
1162302685 19:9852981-9853003 GAAAATGGAAAAATTCAGCTGGG + Intergenic
1162391388 19:10392095-10392117 TAAAATTTAAATTTCCAGCTGGG - Intronic
1162444879 19:10716725-10716747 TAAAATAAAAATAATTAGCTGGG + Intergenic
1163565373 19:18048093-18048115 AAAATTGAAAAAATGTAGCTGGG - Intergenic
1163740824 19:19010842-19010864 TAACAGAAAAATATTCAGCTGGG + Intronic
1164462322 19:28459443-28459465 TTAAAAGAAAAAATCCAGCTGGG + Intergenic
1164867438 19:31616451-31616473 CAAGATGAAAATATGGAGTTCGG + Intergenic
1164928777 19:32155317-32155339 TAAAATGAAAGTTTGAGGCTGGG + Intergenic
1165411278 19:35663575-35663597 TAAAATGAAAAAATTCAAATGGG - Intergenic
1166937624 19:46344016-46344038 AAAAATGAAAATAATTAGCTGGG - Intergenic
1166952625 19:46439896-46439918 TAAAATGTAAATTCCCAGCTGGG + Intergenic
1167255619 19:48426519-48426541 AAAAAAGAGAATATTCAGCTAGG - Intronic
1167814059 19:51863874-51863896 TATAATGTAATTATACAGCTAGG - Intronic
1167939744 19:52937070-52937092 TATAATGTAAATGTGTAGCTGGG - Intronic
925121392 2:1421379-1421401 TAAGATGTAACTCTGCAGCTAGG + Intronic
925706996 2:6695217-6695239 TAAAATGCAAATAATCAGCCGGG + Intergenic
926148304 2:10410386-10410408 AGAAATGTAAACATGCAGCTGGG - Intronic
926412487 2:12618754-12618776 TAACAGTAAAAAATGCAGCTGGG - Intergenic
926572975 2:14550332-14550354 TAAAATTAAAATATGCCTCCAGG + Intergenic
928992469 2:37248617-37248639 TAAAAAGTAAACATGCGGCTGGG + Exonic
929806288 2:45148677-45148699 TCAAAAGAAAATATACAGATGGG + Intergenic
930118547 2:47740852-47740874 AAAAATGAAAAAATTCAGCTGGG - Intronic
930647739 2:53929584-53929606 AAAAAAAAAAATAAGCAGCTAGG - Intronic
930841777 2:55855348-55855370 AAAAATGAATATATGCAAGTGGG + Intergenic
931034581 2:58225036-58225058 TAAAATGAATAAATGAACCTGGG + Intronic
931474573 2:62574429-62574451 TAAAGAGTAAATAGGCAGCTAGG - Intergenic
931563255 2:63587617-63587639 TAAAAGGAAGATATGATGCTCGG - Intronic
931707230 2:64957110-64957132 AAAAATGAAAATATTCATCCTGG - Intergenic
931759158 2:65401269-65401291 TAAAATGGAAATAAGGGGCTGGG - Intronic
931778500 2:65560258-65560280 AAAAATAAAAATAAACAGCTGGG - Intergenic
931784793 2:65609057-65609079 AAAAATGAAAATAGCCAGCAAGG - Intergenic
932116703 2:69056832-69056854 TAAAATAAAAAAATTTAGCTGGG - Intronic
932808729 2:74806084-74806106 CAAAGTGAAAATGTGAAGCTTGG + Intergenic
932814040 2:74847523-74847545 TAAAATTAAAAAAATCAGCTGGG + Intronic
933429364 2:82155935-82155957 TAAAAAGAAAATATTCATATTGG + Intergenic
933503445 2:83146330-83146352 TAAAGTGAAAATATGTAGATAGG + Intergenic
933867812 2:86538658-86538680 TCAAATGAAAATAATCAGCTTGG - Intronic
934567909 2:95350733-95350755 TACAATGATAATGTACAGCTGGG - Intronic
934728853 2:96643508-96643530 TAAAATGACAAAAATCAGCTGGG - Intergenic
935391649 2:102559377-102559399 CAAAATGAGATTTTGCAGCTAGG - Intergenic
935485673 2:103650649-103650671 TAAAATTAAGATATGTGGCTGGG + Intergenic
936374089 2:111926124-111926146 TAAAATGAAAGTCTGGGGCTGGG - Intronic
936689446 2:114869136-114869158 CAAAATAAAAATATGCAATTGGG + Intronic
936729421 2:115361919-115361941 TAATATGAAAATTTGGAGTTGGG - Intronic
936858689 2:116990379-116990401 TAAAAACAAAATATGCAGTAAGG - Intergenic
937846937 2:126589453-126589475 TAAAAAGACAATTTGCAGATTGG + Intergenic
938300235 2:130205613-130205635 AAAAATGTAAAAATGCGGCTGGG - Intergenic
938450041 2:131410203-131410225 TAAAAAGTAAATAAACAGCTTGG + Intergenic
938456487 2:131468882-131468904 AAAAATGTAAAAATGCGGCTGGG + Intronic
938643393 2:133306327-133306349 TAAACTGAAAAAATGCAACATGG + Intronic
939348050 2:140993770-140993792 TAAAATGATAATATGAAGGATGG + Intronic
940004102 2:148995859-148995881 AAAAATGAATGGATGCAGCTGGG + Intronic
940199366 2:151133097-151133119 TAAAAAGAAAATATTCAGCCAGG + Intergenic
940523122 2:154777066-154777088 TAAATTGGAAAGATGCAGTTGGG + Intronic
940543174 2:155047628-155047650 TAAAATGAAAATATCCAAAATGG - Intergenic
940570033 2:155419624-155419646 TAAAAAAAAAAAATTCAGCTGGG + Intergenic
940919621 2:159292493-159292515 TAAAATAACAATCTGCAACTTGG - Intergenic
940931092 2:159432742-159432764 TAAAATGAAAATAACCTGATTGG + Exonic
941282164 2:163565886-163565908 TAGAATTAAAATATCCATCTTGG - Intergenic
941781427 2:169449825-169449847 GAAAATACAAATATTCAGCTGGG + Intergenic
941871091 2:170386642-170386664 GGAAATGAAAATTTTCAGCTTGG + Intronic
941925410 2:170889359-170889381 TAAAACGTGAATATGCTGCTGGG - Intergenic
942265522 2:174220662-174220684 TAAAATGCAAATACTCATCTTGG - Intronic
942556037 2:177173303-177173325 AAAAAGGAAAATATCCAACTGGG + Intergenic
942865809 2:180673452-180673474 TAAAATGATCATGTGCAGCTAGG - Intergenic
942877554 2:180819582-180819604 TAAAATGAAAGTAGGGATCTTGG + Intergenic
943340582 2:186676065-186676087 TAAAATGATAATATTAAACTAGG - Intronic
943440833 2:187925476-187925498 TAAAATCAAAACATGTGGCTAGG - Intergenic
943494335 2:188601331-188601353 TAAAATGAAACAATGTAACTAGG + Intergenic
943587774 2:189760628-189760650 TAAAATGCAAAAAATCAGCTGGG + Intronic
943765160 2:191652880-191652902 TAAAATAAAACTAGACAGCTAGG + Intergenic
944120594 2:196236322-196236344 TTAAAAGAAAATATGCAGTCAGG - Intronic
944348631 2:198700534-198700556 TAAAATAAAAAAAGGCAGGTGGG + Intergenic
944666612 2:201964231-201964253 GGAAATGAAAACCTGCAGCTGGG - Intergenic
944876837 2:203971064-203971086 TTAAATGAAAATTTGCAGCTGGG - Intergenic
945000566 2:205345873-205345895 TAAAAAAAGAAGATGCAGCTGGG + Intronic
945005388 2:205399648-205399670 TAAAAAAAGAAGATGCAGCTGGG - Intronic
945073407 2:206013689-206013711 TAAAATGAAAATATGCAGCTGGG + Intronic
945133720 2:206602902-206602924 AAAAATGAAAACATTCTGCTAGG + Intronic
945457708 2:210068169-210068191 TAAATAAAAAATATGCAGCCGGG - Intronic
945460112 2:210097272-210097294 TAAAATGAAAATTTATAGCATGG - Intronic
945692794 2:213062468-213062490 TAAAATTAAAATATACACTTTGG - Intronic
946332459 2:219018132-219018154 GAGAATGAAAATATGCAGGTGGG - Intronic
946655685 2:221944057-221944079 TAAAATGTAAATATGAGTCTTGG - Intergenic
946683997 2:222248622-222248644 TAAAATGAAAAAGTACTGCTGGG - Intronic
946714796 2:222541966-222541988 CAAATTGTAAATGTGCAGCTCGG + Intronic
947559544 2:231135920-231135942 TAAAATGAAATTTTGCAGTAAGG - Intronic
948410056 2:237752406-237752428 AAAAAAGAAAAAATGCTGCTGGG + Intronic
1168993327 20:2113349-2113371 TAAAATAAAAATATGAAACTAGG + Intronic
1169237344 20:3941777-3941799 GAAAATAAAAAGATGAAGCTGGG + Intronic
1169281354 20:4269535-4269557 TAAAATAAAAAGCTGAAGCTGGG - Intergenic
1169871446 20:10252973-10252995 TTAAATAAAAATATGCATTTGGG + Intronic
1170118670 20:12888643-12888665 TAAAATAAAAATAATTAGCTGGG + Intergenic
1170644528 20:18185494-18185516 CAAAAATAAAATATGTAGCTAGG - Intronic
1170948195 20:20910864-20910886 TAAAATGAAAAGAATCAGCTGGG + Intergenic
1171464211 20:25316452-25316474 TAAAATGAAAAGAGACGGCTGGG - Intronic
1171569033 20:26228623-26228645 CTAAATGATGATATGCAGCTTGG + Intergenic
1172299398 20:33838632-33838654 TTAAATGAAATTCTGCAGCCTGG + Intronic
1172406332 20:34692539-34692561 TAAAATGAAAAAATTTAGCCGGG - Intergenic
1172649846 20:36495150-36495172 TAAAAATAAAACATGCAGCTGGG - Intronic
1173058640 20:39640398-39640420 TAAAATAAAAATTTGCGGCTGGG + Intergenic
1173169246 20:40709994-40710016 AAAAATGTTAATATTCAGCTGGG - Intergenic
1173552523 20:43942718-43942740 AAAAAAGAAAACAAGCAGCTTGG + Intronic
1173681897 20:44888109-44888131 AATAATGAAAATAAGCATCTGGG + Intronic
1174009360 20:47437149-47437171 AAAAATAAAAATATGGGGCTGGG + Intergenic
1174176175 20:48646385-48646407 AAAAATGAAAACAATCAGCTGGG + Intronic
1174857179 20:54057485-54057507 TAGAGTGAAAACATGAAGCTTGG - Intronic
1175105541 20:56612222-56612244 AAAAAAGAAAGTAAGCAGCTGGG + Intergenic
1175415979 20:58801256-58801278 TAAAATAAAAAGTGGCAGCTGGG + Intergenic
1176608572 21:8854878-8854900 TTAAAAAAAAATATTCAGCTGGG - Intergenic
1176724058 21:10415183-10415205 TAAAAAGAAGAGTTGCAGCTGGG - Intergenic
1177089527 21:16749759-16749781 TAGAGTGACAATATGCAGCATGG - Intergenic
1177147331 21:17420772-17420794 AAAATTTAAAATATGCTGCTGGG - Intergenic
1177182148 21:17756007-17756029 AAAAATAAAAATAAGCAGCCTGG - Intergenic
1177334907 21:19710960-19710982 TAAAAAGAAAATATGAGACTGGG + Intergenic
1177450497 21:21259128-21259150 GAAAATGAGGATGTGCAGCTTGG + Intronic
1177495540 21:21885327-21885349 TAAAAAAAGAAAATGCAGCTGGG - Intergenic
1177502717 21:21978943-21978965 AAAAATGAAAATAAGCAACCTGG - Intergenic
1178236855 21:30853118-30853140 TAAAATGTAAAAATGGTGCTGGG + Intergenic
1178884273 21:36473110-36473132 TAAAATGAAATTCTGCAGGGTGG - Intronic
1178980105 21:37256861-37256883 AAAAATGTAAATATGGAGTTGGG + Intronic
1178984243 21:37289402-37289424 TTAAATAAATATAGGCAGCTGGG - Intergenic
1179051829 21:37895066-37895088 AAAATGGAAAATATGGAGCTGGG - Intronic
1179837645 21:44047723-44047745 TAAAATGAAAATATGCTAAGTGG - Intronic
1180256248 21:46630150-46630172 TAAAATAAAAATAAACAGCAAGG - Intergenic
1180281896 22:10707023-10707045 CTAAATGATGATATGCAGCTTGG - Intergenic
1180358656 22:11864693-11864715 TTAAAAAAAAATATTCAGCTGGG - Intergenic
1180379610 22:12127638-12127660 TTAAAAAAAAATATTCAGCTGGG + Intergenic
1181289996 22:21784396-21784418 GAAAATGAAAATAAGCAGCCAGG + Intronic
1181598133 22:23931313-23931335 TAAATTTAAGATATGCAGCTTGG + Intergenic
1182239916 22:28907600-28907622 TCAAATCTAAATATGCTGCTGGG - Intronic
1182628567 22:31666669-31666691 TAAAATTAAAAAATGAGGCTGGG - Intergenic
1183161981 22:36120506-36120528 AAAAATTAAAAAATTCAGCTGGG + Intergenic
1183237064 22:36626931-36626953 TAAAATGAGGATAACCAGCTTGG - Intronic
1183875034 22:40772932-40772954 TTAAAATAAAATATGCAGCCAGG - Intronic
1183909338 22:41066739-41066761 TGAAATGCAATTGTGCAGCTTGG + Intergenic
1203239138 22_KI270732v1_random:38184-38206 CTAAATGATGATATGCAGCTTGG - Intergenic
949352853 3:3142839-3142861 TAAAAAGAAAATATGTAAATAGG - Intronic
949761971 3:7480991-7481013 TAATATGAAAGTATGCAAGTGGG + Intronic
949850788 3:8418207-8418229 TAAAAGAAAAATATGTTGCTCGG - Intergenic
950160396 3:10756430-10756452 TAAAATGAGGATATGCATCAGGG + Intergenic
951244949 3:20330418-20330440 TAAAAGGAAACTATACGGCTGGG + Intergenic
951260952 3:20507786-20507808 GAAAATGAAAATATGGTGCATGG - Intergenic
951265239 3:20557647-20557669 CAAAAAGAAAACATGCAGGTAGG - Intergenic
951269458 3:20607337-20607359 TAAAATCAAAATATGAAGTGAGG + Intergenic
951608452 3:24463645-24463667 TTAAAATAAAATATGCTGCTTGG + Intronic
951800736 3:26593187-26593209 TAAAATGAATATATACAGCATGG - Intergenic
951916092 3:27802415-27802437 GAAAAAGAAAATGTGGAGCTAGG - Intergenic
952043538 3:29289297-29289319 GTAAATAAAAATATGCAGTTGGG - Intronic
952278270 3:31898894-31898916 TAAAATTAAAATATTCAACTGGG + Intronic
952281637 3:31929039-31929061 TAAAAAGGAAACATCCAGCTAGG + Intronic
952317912 3:32247754-32247776 AAAAGAGAAAATATTCAGCTGGG - Intronic
952429710 3:33211187-33211209 TACAAAGAAAACATACAGCTGGG - Intronic
952909765 3:38173275-38173297 TAAAATGAAAATAGTCAAATAGG + Intronic
953368664 3:42368788-42368810 TTAAATGATAATATACAGATGGG - Intergenic
953475324 3:43201098-43201120 TAAAATAACAATAATCAGCTGGG - Intergenic
953736564 3:45498995-45499017 TAAAATAAACATTTACAGCTGGG + Intronic
954186703 3:48922526-48922548 AAAAAAGAAAGTATTCAGCTGGG - Intronic
954435732 3:50494969-50494991 TTAAATAAAAATATCCAGCCGGG - Intronic
954664029 3:52241256-52241278 TAAAATGAAACTATGATTCTTGG - Intergenic
954744021 3:52776734-52776756 AAAAATAAAAATAATCAGCTGGG + Intergenic
955141035 3:56270325-56270347 TAAAATGGAAATTTGCTGTTTGG - Intronic
955433029 3:58870172-58870194 TAACATGAAGATATCCAGCGAGG - Exonic
955566051 3:60247821-60247843 TTAAATGAAAGAATGCAGTTAGG + Intronic
955643543 3:61112279-61112301 TAAAATGAAAATCTGTGCCTGGG + Intronic
956132971 3:66071528-66071550 TAAAATGAAAAAAATTAGCTGGG + Intergenic
957109812 3:75939706-75939728 CTAAATGATGATATGCAGCTTGG - Intronic
957266672 3:77975293-77975315 TATTATGAAAATATGAAGATCGG + Intergenic
957516161 3:81254213-81254235 TAGAATAAAAATATGAGGCTGGG + Intergenic
957560381 3:81813661-81813683 CAAAATGCAAAGATCCAGCTTGG + Intergenic
957589657 3:82179599-82179621 TATTATAAAGATATGCAGCTGGG - Intergenic
957645792 3:82923745-82923767 TTAAATGAAAAGATACAGATAGG + Intergenic
957655731 3:83071939-83071961 TAATATGAAAATATGTAAATTGG + Intergenic
957845569 3:85729901-85729923 TAAAGTGGAAATATTCAGCAGGG - Intronic
958076386 3:88685484-88685506 AAAAATGAATATGTGTAGCTGGG + Intergenic
958516492 3:95122753-95122775 TAAAATAAATGTATTCAGCTTGG + Intergenic
958606884 3:96369908-96369930 TAAAATAAAAAGCTGCAGTTGGG - Intergenic
958746554 3:98142523-98142545 TGAAGTGAAAATGTTCAGCTGGG - Intergenic
958800928 3:98754851-98754873 TAAAATTAAGATATGCACATTGG + Intronic
958983867 3:100757830-100757852 TAAAAAAAAAATTTGCATCTGGG + Intronic
959082312 3:101815341-101815363 TAAAATTAAAATTTGAAGATGGG + Intronic
959312464 3:104756583-104756605 TAAAATCAAAAGTTGCAGTTGGG - Intergenic
959465066 3:106675887-106675909 TAATTTGAAAATATGAACCTTGG - Intergenic
960016601 3:112897211-112897233 TGAAATGAAAATGTGGATCTGGG + Intergenic
960025546 3:113004772-113004794 TAAAATGAAAAAATGAGGTTAGG - Exonic
960066020 3:113373824-113373846 TAAAATGAAATTCTGTAGGTAGG - Intronic
960112302 3:113856832-113856854 AAAAAAAAAAATAGGCAGCTGGG - Intronic
960174662 3:114502460-114502482 TAAGATGAAAATCTCCAGCCTGG + Intronic
960230226 3:115217414-115217436 CAAAATAAAAAGATGTAGCTCGG + Intergenic
960250520 3:115446785-115446807 TAAAATGCTAATATGCAGTCAGG + Intergenic
960496287 3:118379182-118379204 TAAAAAGAAAACATGCATTTTGG - Intergenic
960585258 3:119315238-119315260 TAAAATGAAAATATTCTTGTTGG - Intronic
962016633 3:131447686-131447708 CAAAATAAAAATAGGCAGATAGG - Intergenic
962127489 3:132636520-132636542 TGTAATGAAAAGATGAAGCTAGG + Intronic
962380599 3:134895551-134895573 AAAAATTAAAATATGGTGCTAGG + Intronic
963873937 3:150452055-150452077 TAAAATAAAAAAATTCAGCCTGG - Intronic
964120639 3:153179639-153179661 TAGAATGAAAATCTGTAGCCAGG + Intergenic
964542710 3:157797436-157797458 TTTAATGAAAATATGTGGCTGGG - Intergenic
964827189 3:160841481-160841503 CAAACTGAAAATATACAGTTGGG - Intronic
964838715 3:160970436-160970458 AAAAAAAAAAATATTCAGCTTGG - Intronic
965064028 3:163821601-163821623 AAAAATGAAAATAGGCAAATAGG + Intergenic
965368230 3:167826034-167826056 AAAAATAAAAATATGCACTTTGG + Intergenic
965376624 3:167932338-167932360 TAAAATGAAAGTCAGAAGCTTGG - Intergenic
965450757 3:168834764-168834786 GGTAATGAAAATCTGCAGCTGGG + Intergenic
965577732 3:170235060-170235082 AAAAATTAAAATATCAAGCTGGG - Intronic
965753796 3:172004946-172004968 AAAAAGTTAAATATGCAGCTGGG + Intergenic
966394663 3:179490277-179490299 TACAATCAAAACATGCAGCCAGG + Intergenic
966413400 3:179665879-179665901 TAAAGTTTAAATATCCAGCTGGG - Intronic
966678381 3:182613865-182613887 AAAAATGAAAATATACATTTTGG - Intergenic
967366904 3:188697374-188697396 TAATATGCAAATATGACGCTTGG - Intronic
967763864 3:193256022-193256044 TAAAAAGTAAATAACCAGCTGGG + Intronic
968173111 3:196526274-196526296 AAAAATCAAAATATGCGGCCAGG + Intergenic
968945522 4:3661524-3661546 CAAAATGAAAATATTCACCAGGG + Intergenic
969538225 4:7769797-7769819 TACCATGAAAATGGGCAGCTCGG + Intronic
970936795 4:21581179-21581201 CAAAATGAAAACAAGCACCTTGG + Intronic
971778719 4:31003172-31003194 TTAAATGAAAGTATGCTTCTGGG - Intronic
972125609 4:35761098-35761120 GACAATGATAATGTGCAGCTGGG - Intergenic
972246898 4:37254736-37254758 AAAGATGAAAAACTGCAGCTTGG + Intronic
972733865 4:41820859-41820881 TAAAATGAAACCTTACAGCTAGG + Intergenic
972823719 4:42732216-42732238 GAAAATCAAAATTTGAAGCTTGG - Intergenic
973086517 4:46069201-46069223 TATGATGAAATTATGCACCTAGG - Intronic
973646327 4:52954486-52954508 TAACTTGAAAATATTCAGTTGGG + Intronic
974708687 4:65558729-65558751 TAAAATGAAAATAAGAATTTGGG - Intronic
974758278 4:66242038-66242060 TAAAATTAAAATATACCACTAGG - Intergenic
974875068 4:67693917-67693939 TAAAAAGAGAAAATACAGCTGGG + Intronic
976354433 4:84100266-84100288 TATAATGCAAATATGCGGCATGG + Intergenic
976650068 4:87424560-87424582 TAAAATAAGAATATGCACCAAGG - Intronic
977090224 4:92664182-92664204 CAAAAGGAAAATCTGGAGCTGGG - Intronic
977213574 4:94250440-94250462 TGAAATTTCAATATGCAGCTAGG - Intronic
977679351 4:99781884-99781906 TCATATGCAAATATGTAGCTTGG + Intergenic
977835763 4:101644703-101644725 TAAAACTAAAATATACAGCTGGG + Intronic
978336043 4:107670445-107670467 AAATAAGAAAATATGCAGCATGG + Intronic
978474063 4:109105824-109105846 TAAAAGGAAAAGCTGCTGCTTGG - Intronic
978575695 4:110188058-110188080 TAAAATAAAAATATGTGGGTTGG - Intronic
979176723 4:117674218-117674240 TAACATGAAAAGGTGCAGTTTGG + Intergenic
980147160 4:129001692-129001714 TAAACTGAAAATATTAAGCTAGG + Intronic
980765187 4:137293475-137293497 TAACCTGAATAGATGCAGCTGGG + Intergenic
981203737 4:142014963-142014985 TAAAATGTAAAAAATCAGCTGGG + Intergenic
981359310 4:143829044-143829066 TAAAATGAAAACATGAATCCCGG + Intergenic
981473140 4:145160271-145160293 TAAAATTAAAATCTGGAGCTAGG - Intronic
981599604 4:146470985-146471007 TAAAATGACAATATATAGTTGGG - Intronic
981705636 4:147656451-147656473 CAAAATGAAAAAATTTAGCTGGG - Intronic
981803271 4:148682607-148682629 TTAAATGAAAAGGTGCTGCTTGG + Intergenic
981856072 4:149294414-149294436 TAAAAAGAAACTGTGCAGTTGGG - Intergenic
982695411 4:158593219-158593241 TAAAATGAGAATCTCCAGGTGGG + Intronic
982993406 4:162309246-162309268 TAAATTTAATATATGAAGCTAGG - Intergenic
983594227 4:169448507-169448529 TAAAATGAAGATATGAAGGAAGG + Intronic
983708170 4:170683896-170683918 TAAAATTAAAAAATTTAGCTGGG + Intergenic
984001316 4:174249718-174249740 TAAAATTAAAATATGTGTCTTGG - Intronic
984075523 4:175173079-175173101 TCAAAAGAAAACATACAGCTGGG - Intergenic
984557891 4:181237063-181237085 TCAAAAGAAAATATTGAGCTGGG - Intergenic
984581879 4:181519111-181519133 TAGACTGGAAATCTGCAGCTGGG + Intergenic
984798690 4:183691560-183691582 AAAAATGAAAATCTGCTACTTGG + Intronic
985111787 4:186554312-186554334 TAAAACGAAAATATTGATCTTGG + Intronic
985288113 4:188357765-188357787 TATAAAGAAATTATGCAACTTGG - Intergenic
985298535 4:188461014-188461036 TAAAATTAAAAGATACGGCTGGG - Intergenic
985832693 5:2246543-2246565 TAAAATAAAGATATGGAGATAGG - Intergenic
986083417 5:4417659-4417681 AAAAAAAAGAATATGCAGCTTGG + Intergenic
987729478 5:21749903-21749925 GAAAATGAGAATATGCAACTGGG + Intergenic
987786121 5:22501176-22501198 TTAACTGAAAATATGCACCATGG + Intronic
987958303 5:24768723-24768745 TTAAAAGAAGATATGCAGCTGGG - Intergenic
988371216 5:30370310-30370332 TAAAATGAAAATATTAAGCTAGG - Intergenic
988644523 5:33079608-33079630 TAAAATAAAAATAGTCAGATAGG + Intergenic
988677151 5:33443788-33443810 TAAAAAGAAAAATTGCGGCTGGG - Intronic
988890815 5:35615310-35615332 TACAATAAAAATATACACCTAGG + Intergenic
989303627 5:39925583-39925605 TAAAAAGATAATATGCATTTAGG + Intergenic
989679572 5:44013157-44013179 AAAAATGGAAATATGCCGCTCGG - Intergenic
990439921 5:55834018-55834040 CAAAATGAAAATATGGGGCTTGG + Intergenic
990534569 5:56707529-56707551 AAAAATACAAATAAGCAGCTGGG - Intergenic
991622921 5:68565135-68565157 AAAAATGAAACAATGAAGCTAGG + Intergenic
991709650 5:69395983-69396005 TAAAATATGACTATGCAGCTGGG - Intronic
991709785 5:69397435-69397457 TGAAATATAACTATGCAGCTGGG - Intronic
992252652 5:74890691-74890713 AAAAAAGAAAATATGAGGCTGGG - Intergenic
992468940 5:77035245-77035267 TAAAATAAAAATCTGTAGATAGG - Intronic
992986824 5:82238899-82238921 CAGAATTAAAATATGCATCTTGG + Intronic
993213137 5:84980280-84980302 TGATAGGAAAACATGCAGCTGGG - Intergenic
993234475 5:85286079-85286101 TAAAATGCACACATGCGGCTGGG + Intergenic
993724894 5:91355935-91355957 TAAAATGAAAAAATACAGCCTGG - Intergenic
994254196 5:97573406-97573428 TACACTGAAAATAAGCAGTTTGG - Intergenic
994924755 5:106100553-106100575 TAAAATAAAAAAATTCAGCCTGG + Intergenic
994956843 5:106544087-106544109 TAAAATGAAAAGAGCCAGCTGGG + Intergenic
995087876 5:108136139-108136161 TAAAAGAAAAATATGCAGATAGG + Intronic
996388250 5:122932471-122932493 TAAAATAAAAATAAACAGGTAGG + Intronic
996716296 5:126590587-126590609 TTAAAAAAAATTATGCAGCTGGG + Intronic
996845731 5:127896739-127896761 GAAAATGAAAAGAATCAGCTGGG - Intergenic
997389220 5:133499962-133499984 TAAAAAGGAAATATGCGGCATGG - Intronic
997461528 5:134055721-134055743 TAAAAACAAAATAAGCAGCCGGG - Intergenic
997474549 5:134135112-134135134 TAAAATAAAAATAACTAGCTGGG - Intronic
997689752 5:135819786-135819808 TTAAATGAAAATATACAAATTGG + Intergenic
997933900 5:138094240-138094262 TAAAAGGAAAATATGCTTTTGGG + Intergenic
998248547 5:140532595-140532617 TAAAAAGAAACTCTGAAGCTGGG - Intronic
998309208 5:141110334-141110356 CACAATGAAAATTAGCAGCTTGG + Intronic
998474482 5:142408874-142408896 TAAAATGAATTTATTCAGGTGGG + Intergenic
998837617 5:146218052-146218074 TAAAATGAAAACATTCAGGCTGG - Intronic
1000550730 5:162659527-162659549 TAAAGGGAAAATGTGCAGATGGG + Intergenic
1000726346 5:164776221-164776243 GAAAGTTAAAATATGCAGTTGGG - Intergenic
1001050211 5:168408155-168408177 TAAAATGGGAATAATCAGCTGGG - Intronic
1001944534 5:175767653-175767675 AAAATTGAAAATTTGCAGCCTGG - Intergenic
1002809961 6:618572-618594 TACAATGAAAAAATTCATCTTGG + Intronic
1002846099 6:946531-946553 TATCATGAAAATAAGAAGCTGGG - Intergenic
1003223561 6:4184295-4184317 AGAAATGAAAAAATGCAGGTAGG - Intergenic
1004130759 6:12917347-12917369 TAAACTGAAGATCTGGAGCTAGG - Intronic
1004139797 6:13007182-13007204 TAAAATAAAATAAAGCAGCTGGG - Intronic
1004375281 6:15085726-15085748 TAAAATAAAAATAAATAGCTGGG + Intergenic
1004385956 6:15172902-15172924 TAAAATTAAAAAATACAGCTGGG + Intergenic
1004978986 6:21001356-21001378 TAAAATGATCATATGCAGTTAGG - Intronic
1004984169 6:21061331-21061353 GAAAATGAAAATATTCATTTAGG - Intronic
1005454108 6:26002273-26002295 TAAAATGGAAACATGCATTTTGG + Intergenic
1005686309 6:28256124-28256146 TAAAATAAAAATTGGGAGCTGGG + Intergenic
1005702732 6:28418825-28418847 AAAAAAAAAAAGATGCAGCTAGG + Intergenic
1005907238 6:30274134-30274156 TTAAATTTCAATATGCAGCTGGG + Intergenic
1007724007 6:43903442-43903464 TAAAATTAAAATAATTAGCTGGG + Intergenic
1008312595 6:49994841-49994863 TAAATTGAAACTGTGCAGGTAGG - Intergenic
1008776164 6:55040512-55040534 TAAAGTGAAAACATGGAGTTTGG + Intergenic
1009398068 6:63225416-63225438 TAAAATTAAAAAATGGAGGTTGG - Intergenic
1009511433 6:64554185-64554207 TAAGATGAAAATAAGAAGCCAGG - Intronic
1009799101 6:68510311-68510333 TAAAATGAAACTAACCAGCTAGG + Intergenic
1009811064 6:68667662-68667684 AAAAATAACAACATGCAGCTTGG - Intronic
1010068996 6:71721025-71721047 TAAAATGAAATTATTCATGTGGG - Intergenic
1010227980 6:73509316-73509338 TAAAAGCACAATATGCAGCCTGG - Intergenic
1010688872 6:78884843-78884865 TATAATGAAAGTATGAAGTTAGG - Intronic
1011441719 6:87394233-87394255 TAAAATGAAAATTTTCAGCTGGG + Intronic
1011470807 6:87705623-87705645 AATGATGAAAATATGCAGATAGG - Intergenic
1011485744 6:87839782-87839804 TCAAATGAAAATCTGCATCCTGG - Intergenic
1011726765 6:90217566-90217588 TGTAATGAAAATATGCCGCGTGG - Intronic
1011984304 6:93423491-93423513 TAAAATAACAAAATGTAGCTAGG + Intergenic
1012280264 6:97320073-97320095 TAAGATGAAAAAATGAAACTTGG + Intergenic
1012319224 6:97822328-97822350 TATCAAGAAAATATGCAGCTGGG - Intergenic
1012392104 6:98753574-98753596 TAAAATGTAAACATGCAAATAGG - Intergenic
1012818892 6:104059653-104059675 TAAAATGAAAATATGCCTCTTGG - Intergenic
1012867076 6:104631620-104631642 AAAAATAATAATATGCAGCTTGG + Intergenic
1013069933 6:106719530-106719552 TAAAAATAAAATATACAGCTGGG + Intergenic
1013484688 6:110585429-110585451 TAAAATAAGAATATTCAGCCAGG - Intergenic
1013515786 6:110884592-110884614 TAAAAAGAAAAAAGGCAGCTGGG - Intronic
1013631549 6:111990945-111990967 TAAAATGCAAATATACAAATAGG + Intergenic
1014775119 6:125499934-125499956 TACATTGAAAATCTGCTGCTTGG + Intergenic
1014920378 6:127207804-127207826 ATAAATGAGAATATGCAGTTTGG + Intergenic
1015154882 6:130081718-130081740 TAAAGAGTAAATATGCAGCCGGG - Intronic
1015351104 6:132221001-132221023 TAAACTGAAAATACACAACTAGG + Intergenic
1015490117 6:133815382-133815404 TAAAATCAAAATGTTCAGCACGG + Intergenic
1015547265 6:134374271-134374293 TAAGAGGAAAATATTCAGCTTGG + Intergenic
1015684338 6:135842782-135842804 TAAAATGAGGTTATGCAGGTGGG - Intergenic
1016150606 6:140737226-140737248 TAAAATGTAAATATTCTGCCTGG - Intergenic
1016228919 6:141777487-141777509 TAAAATAAAAAGATTCATCTGGG + Intergenic
1016248060 6:142011003-142011025 CAAAATGAAAATATTTTGCTAGG - Intergenic
1016276522 6:142359524-142359546 TGAGATGTAAATATGCAGTTTGG - Intronic
1016621530 6:146115512-146115534 TAAAATGAAATTTGGCAGTTAGG - Intronic
1017296861 6:152807587-152807609 GAATATGAAAAGATGCAGATGGG + Intergenic
1017367955 6:153667407-153667429 TAAAATGAAATCATGTGGCTAGG - Intergenic
1017527220 6:155252185-155252207 TTAAAAGAAGATATACAGCTGGG + Intronic
1017620112 6:156287823-156287845 TAAAATGCACATATGGGGCTGGG + Intergenic
1018005885 6:159621224-159621246 TAAACTCAGAATAGGCAGCTGGG + Intergenic
1018085332 6:160296581-160296603 AAAAATAAAAATATGAAGCAAGG - Intergenic
1018332870 6:162750254-162750276 TAAATTGCATATATGCATCTAGG - Intronic
1019068137 6:169319870-169319892 TAACATGGAAATGTGCAGATAGG - Intergenic
1019690542 7:2408536-2408558 TAAAATGAAAAGAAGCAGAAGGG + Intronic
1019795471 7:3044837-3044859 TAAAATGATGACATCCAGCTGGG - Intergenic
1020089586 7:5331433-5331455 TAAAATGTGAAAATGCAGGTGGG - Intronic
1020368260 7:7403719-7403741 CATAATGAAAATATTCATCTAGG + Intronic
1021030437 7:15726421-15726443 TGAAATGAAAATGTCCAGTTTGG + Intergenic
1021150114 7:17140341-17140363 TAAATTGAAAAAATGCAGATGGG + Intergenic
1021457400 7:20844608-20844630 TAAAAAGAAAAAATACATCTGGG + Intergenic
1022229451 7:28399758-28399780 TAAAATTAAAAAGTACAGCTGGG + Intronic
1022575704 7:31495043-31495065 TAAAATGAAAGCATGCAAGTGGG - Intergenic
1022693228 7:32678860-32678882 TTAAAAGAAAATATGTATCTTGG - Intergenic
1022766907 7:33423371-33423393 TAAAATGAAAATGTATACCTTGG + Intronic
1022984190 7:35634404-35634426 TAAAAGGAAACCATCCAGCTTGG + Exonic
1023377616 7:39574435-39574457 TAAAATGAAAAAAATCCGCTGGG + Intronic
1023402299 7:39799008-39799030 AAAAATGAAAGAAAGCAGCTGGG - Intergenic
1024341182 7:48262356-48262378 TGAACTAAAAATATGCAGATGGG - Intronic
1024440422 7:49409815-49409837 TAAATTAGAAATATGCAGCAGGG + Intergenic
1024647321 7:51381657-51381679 AAAAATGAAAGAAAGCAGCTGGG + Intergenic
1024779143 7:52826380-52826402 TAAAAAGAAAACATTCAGTTTGG - Intergenic
1024932733 7:54680702-54680724 GAAAATAAAAATAGGCAACTAGG - Intergenic
1025051156 7:55736163-55736185 AAAAATGAAAGAAAGCAGCTGGG + Intergenic
1025059954 7:55797671-55797693 AAAAATGAAAGAATGCAGCTGGG + Intronic
1025888105 7:65618296-65618318 GAAAATGAATATATGATGCTGGG + Intergenic
1025974973 7:66362461-66362483 TAAAATGAATATGTCCAGCCTGG + Intronic
1026261213 7:68757277-68757299 TTAAATTAAAATAAGCATCTGGG - Intergenic
1026324479 7:69296965-69296987 AAAAATGAAAATAATCAGCAGGG + Intergenic
1026982911 7:74537112-74537134 AAAAATACAAACATGCAGCTGGG + Intronic
1027167336 7:75844429-75844451 AAAAAAGAAAATTTGGAGCTGGG + Intronic
1027952403 7:84834242-84834264 TAAAATAAAAATATCCTTCTTGG + Intergenic
1028468559 7:91179505-91179527 TAAAAAAAAAAAATGCAGCCCGG + Intronic
1028593329 7:92521730-92521752 TAAAAATAAAAAATTCAGCTGGG - Intronic
1028779632 7:94720893-94720915 TTATATCAAAATATGCAGCATGG + Intergenic
1029112366 7:98219604-98219626 TCAAAAGAAGATATGCGGCTGGG + Intronic
1029214604 7:98937877-98937899 TAAAAATAAATAATGCAGCTGGG + Intronic
1029508909 7:100980953-100980975 TAATTTGAAAATATGCATCAGGG - Intronic
1030005815 7:105118757-105118779 TAAAAAGAAAAAAAGTAGCTGGG + Intronic
1030158433 7:106481564-106481586 TTAAATGAAAATATGAAGCTGGG - Intergenic
1030266344 7:107625970-107625992 TAAAAAAGAAAAATGCAGCTAGG + Intronic
1030930004 7:115511026-115511048 CAAAATATAAATATTCAGCTAGG + Intergenic
1031857419 7:126939268-126939290 TAAAATAAAAATATACTTCTAGG + Intronic
1032052810 7:128659389-128659411 AAAAATGAAAGAAAGCAGCTGGG - Intergenic
1032106939 7:129039957-129039979 TATGATGAAAATGTCCAGCTGGG + Intronic
1032283203 7:130522956-130522978 TAAAAAGAAAAAAATCAGCTGGG + Intronic
1033133531 7:138765908-138765930 GAAAATAAAAATAATCAGCTGGG - Intronic
1033202742 7:139387473-139387495 TAAAATAAAAATTTTCAGCCAGG - Intronic
1033310170 7:140255481-140255503 TAAATTGAAAATATTCGGCCGGG + Intergenic
1033344014 7:140513283-140513305 AAAAAAAAAAATATGTAGCTGGG + Intergenic
1033493412 7:141867893-141867915 AAAAAAGAAAATATGCACCATGG + Intergenic
1033634263 7:143194842-143194864 TAAAAAGAAAATATAGAGGTGGG - Intergenic
1033675404 7:143536550-143536572 TGAAATTAACATATGCAGTTGGG - Intergenic
1033696433 7:143792888-143792910 TGAAATTAACATATGCAGTTGGG + Intergenic
1034031337 7:147768310-147768332 TAAAATGAAAATTTGTAAATCGG + Intronic
1034754933 7:153607411-153607433 TAAAATGGAATTTTGGAGCTGGG - Intergenic
1035868176 8:3107949-3107971 TAATATGAACATTTGAAGCTTGG - Intronic
1035869377 8:3120550-3120572 TAAAATGACAATGTGCAGGCTGG + Intronic
1036109401 8:5880666-5880688 TAAAATGAAGATTAGTAGCTGGG + Intergenic
1036192337 8:6681242-6681264 TAAAATGAAATTCTTCTGCTGGG - Intergenic
1036763088 8:11526066-11526088 TAAAAACAAAAGCTGCAGCTGGG - Intronic
1036792298 8:11729272-11729294 CAAAAAGAAAAAATGCAGCTGGG + Intronic
1036969208 8:13335072-13335094 TAAAATGTATACCTGCAGCTTGG - Intronic
1037047853 8:14332044-14332066 TAAAATAAAAATATGTATTTGGG - Intronic
1037461091 8:19110055-19110077 AAAAATGAAAAAATACAGCCAGG - Intergenic
1037536067 8:19826061-19826083 AAAAATTTAAAAATGCAGCTAGG - Intronic
1039156227 8:34561443-34561465 TTAAATGATAATATTCAACTAGG - Intergenic
1039514705 8:38122902-38122924 TAAAATTAAAAAACCCAGCTAGG - Intronic
1039961291 8:42249920-42249942 TAAAAAAAAAAAATTCAGCTGGG + Intergenic
1040857433 8:51962322-51962344 TAAAGTGAAACCATTCAGCTCGG + Intergenic
1041061948 8:54043218-54043240 TCAAATGAAAATTTTCATCTAGG - Intergenic
1041346879 8:56908617-56908639 TAAAATTAAAATACGAAGCTGGG - Intergenic
1041794344 8:61730509-61730531 TAAAATGAAAACATTAAGCAGGG - Intergenic
1042228270 8:66532196-66532218 AAAAAAGAAAATATCCATCTAGG - Intergenic
1044778689 8:95721327-95721349 TAGAATGAAAACAAGCAGCTTGG + Intergenic
1044833270 8:96270679-96270701 TAAACTGAAAATATGCAGTATGG - Intronic
1045033474 8:98159560-98159582 AAAAATGTAAATATGCAGTTAGG + Exonic
1045052278 8:98338154-98338176 TAAAATAAAGAAATGCAGCTGGG + Intergenic
1045352997 8:101359710-101359732 TAAAATTTAAATTTGCAGCTGGG + Intergenic
1045378185 8:101596878-101596900 TAAAATGTAAACATGTAGTTTGG + Intronic
1045937530 8:107698088-107698110 TTAAATGAAATAATGCAGGTGGG - Intergenic
1046478069 8:114775355-114775377 TAAAATACAAATATGCAGATGGG + Intergenic
1046490089 8:114940443-114940465 TAAAATGATAATGTGTAGCATGG - Intergenic
1047582392 8:126230515-126230537 AAAAATAAAAATGTGCACCTCGG - Intergenic
1047944600 8:129862629-129862651 AAAAATAAAAAAATTCAGCTGGG - Intronic
1048200329 8:132368490-132368512 AAAAATAAAAATAAACAGCTGGG + Intronic
1048254037 8:132891663-132891685 TAAAGTGAAAATCTACAACTGGG - Intronic
1048705272 8:137146673-137146695 TAAAATGAAAAAGTGGGGCTTGG + Intergenic
1050668267 9:7966664-7966686 TAAAGTAAAAATTTGCAGGTAGG - Intergenic
1050788820 9:9440221-9440243 TAACTTGTAAATATTCAGCTTGG + Intronic
1051417119 9:16853569-16853591 CAAATTTAAAATTTGCAGCTGGG + Intronic
1051520607 9:17982912-17982934 TATAATGGTAATATGCAGCCAGG - Intergenic
1051657400 9:19396251-19396273 AAAAAAAAAAAAATGCAGCTTGG - Intergenic
1051702864 9:19843107-19843129 AAAAATAAAGATATGCAGCCAGG + Intergenic
1052455752 9:28695329-28695351 AAAAATGATAATATCCAGTTTGG + Intergenic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1052906307 9:33837383-33837405 TAAACTGAAAATAAGAGGCTGGG - Intronic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1054419170 9:64909503-64909525 TACAAAGAAAATTTGTAGCTGGG + Intergenic
1055462998 9:76537053-76537075 TGAAAAGAAAATGTGCAACTTGG + Intergenic
1055750698 9:79501737-79501759 TGAAATGAAAATAAGCCTCTAGG - Intergenic
1055879415 9:80981264-80981286 AAAAACGAAAATAAGCAGATGGG - Intergenic
1056401371 9:86230594-86230616 GAAAATAAAACTATCCAGCTGGG - Intronic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1057500242 9:95591356-95591378 AAAAAAGAAAAAAGGCAGCTGGG - Intergenic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1058005514 9:99909935-99909957 AAAAAAGAAGAAATGCAGCTGGG + Intronic
1058087788 9:100768041-100768063 TAAAATGAAAATACACTGATGGG - Intergenic
1058634019 9:107019102-107019124 CTAAGTAAAAATATGCAGCTTGG + Intergenic
1058761703 9:108140313-108140335 TAAAACAAGAATATGCAGATTGG + Intergenic
1058797959 9:108516738-108516760 AAAAATCAAAATATGAAACTAGG - Intergenic
1058837056 9:108866682-108866704 TTAATTTAAAATATGCAGCAGGG + Intergenic
1059070924 9:111135120-111135142 TAAGAACAAAAAATGCAGCTGGG - Intergenic
1059192151 9:112336167-112336189 TGAAATGAAATTATGAGGCTGGG - Intergenic
1059842075 9:118228996-118229018 GAAAAATAAAATATGCATCTAGG - Intergenic
1060307044 9:122422788-122422810 TAAACAGAAAATATACAGCAAGG - Intergenic
1060511475 9:124237708-124237730 TTAAATAAAAATATTGAGCTAGG + Intergenic
1060650204 9:125319211-125319233 TAAAATGAAAAAAATTAGCTGGG + Intronic
1062496618 9:136834771-136834793 TAAAATAAAAATGTGAGGCTGGG - Intronic
1185626368 X:1485296-1485318 TAAAATTCAAAAATGTAGCTGGG - Intronic
1185665961 X:1765873-1765895 TTAAAAAAAAAAATGCAGCTGGG + Intergenic
1185678405 X:1867597-1867619 CAATATGAAAATATGGGGCTGGG + Intergenic
1185722111 X:2390431-2390453 TAAAAAAAAAAAATGCAGCTGGG - Intronic
1186364243 X:8874670-8874692 TAAAATGAAATAATGGAGCCAGG - Intergenic
1186698936 X:12068607-12068629 TTAAATGAAACTATGGAACTAGG + Intergenic
1186917223 X:14236028-14236050 GAAACTGAAAATATGCATGTTGG - Intergenic
1188376956 X:29443017-29443039 TACAATGAAAATAGTCAACTAGG - Intronic
1188877400 X:35447017-35447039 TAAAAAGGAAATATGTAGATGGG + Intergenic
1189896984 X:45665771-45665793 TAAAATGAACCTATCCAGCTAGG + Intergenic
1190616914 X:52243276-52243298 TATAATAGAAATATGCAGTTTGG - Intergenic
1190758039 X:53417956-53417978 GAAAAGGAAACTAAGCAGCTAGG + Intronic
1190884333 X:54518253-54518275 TAAATATAAAATTTGCAGCTGGG + Intergenic
1191126591 X:56962193-56962215 TAAAATAAAAATATGGCTCTAGG + Intergenic
1192226035 X:69228609-69228631 TAAAATGATAATATTTAGATGGG - Intergenic
1193248084 X:79254014-79254036 TTAATAGAAAATATGCATCTTGG + Intergenic
1193886795 X:86992951-86992973 TGAAATAAAAATAGGAAGCTAGG - Intergenic
1193931093 X:87553127-87553149 AAAAATGATAATATTCAGTTTGG + Intronic
1193978342 X:88150847-88150869 TAAAATAAAAATATATAACTGGG - Intergenic
1194218791 X:91166693-91166715 TAAAATCACAACATGCAGCTGGG - Intergenic
1194388711 X:93289384-93289406 TAGAATAAAAATATGCACGTTGG + Intergenic
1194711602 X:97242758-97242780 TAAAATAAAAATTTGCAGTGGGG - Intronic
1195391922 X:104371154-104371176 AAAAATGAAAACATTCACCTTGG - Intergenic
1195670258 X:107463769-107463791 TAAAATGCAAATATGTCACTTGG + Intergenic
1195951915 X:110284150-110284172 TAAAATGAAACTAGACAGCAAGG + Intronic
1196267412 X:113666380-113666402 CAAAATGATAATGTGCAGATTGG + Intergenic
1196566917 X:117217942-117217964 TAAAAGGAAAATAGGGGGCTGGG + Intergenic
1197334580 X:125196921-125196943 TAAAATGTCTGTATGCAGCTGGG + Intergenic
1197335976 X:125209909-125209931 TTAAATGAAAATTTGGAACTAGG + Intergenic
1197647045 X:129029007-129029029 TAATATTAAAAAATGCGGCTGGG + Intergenic
1197824940 X:130579421-130579443 TAAAAAGCAAATATAAAGCTAGG + Intergenic
1197899341 X:131353264-131353286 TAAAATGTCAATATGCAAATTGG - Intronic
1198752624 X:139950708-139950730 AAAAAAGAACATATGTAGCTGGG + Intergenic
1198764506 X:140066880-140066902 AAAAATGAAAAAATACAGCTGGG - Intergenic
1198978064 X:142359866-142359888 TAAAATGAAAACTTTCAACTAGG + Intergenic
1199253114 X:145687687-145687709 TAAAATGGAAATTGCCAGCTAGG - Intergenic
1199311425 X:146325226-146325248 TACAATGAAAATTTGCAACCTGG + Intergenic
1199795079 X:151187010-151187032 TAAAATGAAAATATGAACCCTGG - Intergenic
1200555300 Y:4630448-4630470 TAAAATCACAACATGCAGCTGGG - Intergenic
1201257576 Y:12124322-12124344 TAAAACAAAAATAATCAGCTGGG + Intergenic