ID: 945076556

View in Genome Browser
Species Human (GRCh38)
Location 2:206045696-206045718
Sequence TTTAGGCTAGATCTCCTGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 82}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945076556_945076560 15 Left 945076556 2:206045696-206045718 CCCCTCAGGAGATCTAGCCTAAA 0: 1
1: 0
2: 0
3: 12
4: 82
Right 945076560 2:206045734-206045756 AGCACAGTAGAAATAAAGAATGG 0: 1
1: 0
2: 7
3: 52
4: 561

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945076556 Original CRISPR TTTAGGCTAGATCTCCTGAG GGG (reversed) Intronic
901825866 1:11860506-11860528 TTTAGGCAAGATCTGCTTAGAGG - Intergenic
904842603 1:33382895-33382917 TTTAGGCTAGATTTGGAGAGAGG - Intronic
906633688 1:47393468-47393490 ATGAGGCCAGCTCTCCTGAGGGG + Intergenic
912495664 1:110089673-110089695 GCTAGGCTAGGTCTCCTGAGAGG - Intergenic
915811401 1:158916094-158916116 CTTAGGCTAGACCTTCTCAGAGG - Intergenic
916212982 1:162373546-162373568 TTGACGGTAGATCTTCTGAGGGG - Exonic
918863645 1:189865407-189865429 TTTATTCTATATTTCCTGAGAGG + Intergenic
1062824358 10:557337-557359 TTTAGGGCAGCTCTGCTGAGTGG - Intronic
1064767961 10:18694264-18694286 ATTAGGCTAGCTCCACTGAGAGG + Intergenic
1072232269 10:93423893-93423915 TCTAGGATATAGCTCCTGAGTGG - Intronic
1078878716 11:15425851-15425873 TTTAGTCTGGTTCTCCTGATTGG + Intergenic
1079091325 11:17482299-17482321 TTTAGGCAAGCTCTGCTCAGGGG - Intergenic
1079469098 11:20761249-20761271 TTGAGGCTATAGTTCCTGAGGGG - Intronic
1084497575 11:69513841-69513863 TTGAGGCAAGATCTCCAGATGGG - Intergenic
1085345103 11:75763545-75763567 TTCAGGCCAGATCCCCTGTGAGG + Intronic
1086749512 11:90473577-90473599 TTTAGACTAGGTCTCCAAAGTGG - Intergenic
1087907488 11:103715659-103715681 TTCAGGCTGAATCTCATGAGGGG - Intergenic
1088294809 11:108281231-108281253 TTAAAGCTAGATTTTCTGAGTGG + Intronic
1089209969 11:116793033-116793055 TTTGGGCTTGCTCTCCTCAGAGG - Intergenic
1089368966 11:117940505-117940527 TTTGTGCTAGATCTTCTGAGGGG - Intergenic
1107484838 13:40815901-40815923 TTTAGGCTAGGTCTTCTGATTGG - Intergenic
1110597340 13:77333830-77333852 TTTAGGCAACATCTCCTCTGTGG + Intergenic
1112569583 13:100581615-100581637 TTTAGGCTTCATCTCCTTAAGGG - Intronic
1112969342 13:105240454-105240476 TTTATGTTAGATTTCCTGAGTGG - Intergenic
1113164642 13:107425305-107425327 TTTAGGCTAGATTCACTGATGGG - Intronic
1113235616 13:108269753-108269775 TTCAGGATAACTCTCCTGAGGGG + Exonic
1115903731 14:38183936-38183958 TGTAAGCTAGATCTCTTGAGGGG + Intergenic
1124556697 15:30732534-30732556 TTTAGGATAGATTTCTTGGGAGG + Intronic
1124674581 15:31673203-31673225 TTTAGGATAGATTTCTTGGGAGG - Intronic
1125188826 15:36965908-36965930 TTCAGGCTATATCTCACGAGGGG + Intronic
1125248901 15:37676738-37676760 TTTAGGAAAGGGCTCCTGAGAGG + Intergenic
1129492393 15:75941126-75941148 ATTTGGATAGATCTCCAGAGAGG + Exonic
1131034427 15:89211949-89211971 TTAAGGCTTGAGGTCCTGAGGGG + Intronic
1140964432 16:79951176-79951198 TTCTGGCTGGATTTCCTGAGGGG - Intergenic
1142343697 16:89540273-89540295 TTTACTCTAGCTCTCCTAAGAGG - Intronic
1149922697 17:60674313-60674335 TTTGGGCTTGATCAGCTGAGTGG - Intergenic
1151238485 17:72739056-72739078 TTTGTGCTTGATCTCCTGCGGGG + Intronic
1152474438 17:80508869-80508891 TGAAGGCAAGAGCTCCTGAGTGG + Intergenic
1159099166 18:63939224-63939246 TTTAGGCTTGACCTACTGACTGG + Intergenic
927004067 2:18829318-18829340 TCTTGGCAAGATCTCCTAAGTGG - Intergenic
930016117 2:46971625-46971647 TTCAGGTTTTATCTCCTGAGTGG - Intronic
933532879 2:83532876-83532898 TGTTAGCTTGATCTCCTGAGAGG + Intergenic
935722487 2:105991670-105991692 TTTAGACTAGACCTCCCAAGTGG - Intergenic
937392384 2:121501082-121501104 TTTAGGCAAGATCTCCAGTGTGG + Intronic
940737198 2:157466929-157466951 TTCAGGCCAGATTCCCTGAGGGG - Intronic
942857019 2:180561433-180561455 GTTGGTCTAGATCTCCTGAGTGG - Intergenic
945076556 2:206045696-206045718 TTTAGGCTAGATCTCCTGAGGGG - Intronic
945185634 2:207136816-207136838 TTTAGGATAGATTTTCTGACTGG - Intronic
947506058 2:230709287-230709309 TTTAGTAGAGATCACCTGAGTGG + Intergenic
1169995483 20:11551556-11551578 TATTGGCTAAATCTCCTGAAAGG - Intergenic
1170808358 20:19653889-19653911 ATTAGTCTGGATCTTCTGAGAGG - Intronic
1175768587 20:61608158-61608180 TCTAGGCTAGAACTCCGCAGCGG - Intronic
1177415122 21:20782680-20782702 TTTAGCCTAAATCTCCTAAGTGG + Intergenic
1177665373 21:24150215-24150237 TTTTGGCTATATATTCTGAGTGG + Intergenic
1178280200 21:31275680-31275702 TTTCGTCTAGCTCTTCTGAGTGG + Intronic
955038803 3:55294265-55294287 CTTAGCCTAGGTCTACTGAGTGG + Intergenic
956043693 3:65173080-65173102 ATTAGGCTATATGTCCTGGGGGG - Intergenic
957556882 3:81773674-81773696 ATTAAGCTCCATCTCCTGAGCGG - Intergenic
958519198 3:95161825-95161847 TTTAGGGTATATATCTTGAGGGG + Intergenic
960262190 3:115580627-115580649 TTTAAGCTATACCTCCTGATGGG + Intergenic
963688146 3:148463927-148463949 TTTGGTCTAGGTCTCCTGATAGG - Intergenic
970262065 4:14235858-14235880 TTTAGGGGTGATCTCCAGAGAGG - Intergenic
974668010 4:64990856-64990878 TGTAGCCTAGATCTTCTTAGTGG + Intergenic
976306859 4:83568720-83568742 GATAGGCTCGATCTCCTGACAGG + Intronic
979047909 4:115893478-115893500 GTTGGTCTAGATCTCCTGACCGG - Intergenic
982087937 4:151855211-151855233 ATTAGGCTAGATCTACACAGAGG - Intergenic
982595772 4:157381411-157381433 TTTATGTAAGATCTCCAGAGTGG + Intergenic
987413313 5:17635900-17635922 TTCAGGTTTGATTTCCTGAGTGG - Intergenic
987661351 5:20882124-20882146 TTTAGTCTCGATTTCCTGACAGG - Intergenic
988762234 5:34323201-34323223 TTTAGTCTAAATTTCCTGACAGG + Intergenic
990173840 5:53085144-53085166 TTCAGACTGGATCTCCTAAGTGG - Intronic
993549812 5:89259832-89259854 TTTATGCAACGTCTCCTGAGAGG + Intergenic
996153131 5:120064419-120064441 TTTAGGATAGAGTTTCTGAGTGG - Intergenic
998985595 5:147752829-147752851 TTTTGGCTAGAACAACTGAGTGG + Intronic
1010380822 6:75223026-75223048 TTTAAGCTACATCCCATGAGGGG - Intergenic
1011939307 6:92823512-92823534 ATAAGGCTAGACCTACTGAGCGG + Intergenic
1017322468 6:153109916-153109938 TTTAGGTTAGATCTCATGTTTGG - Intronic
1029222753 7:99003355-99003377 TTTAGGATCTATCTCCTGGGTGG + Intronic
1030956498 7:115858888-115858910 TTTAGACCAGCTCTCCTGAAAGG + Intergenic
1031375919 7:121025793-121025815 TAGAGGTTATATCTCCTGAGGGG - Intronic
1034936402 7:155203352-155203374 GTGAGGCCAGACCTCCTGAGGGG + Intergenic
1036824801 8:11967722-11967744 ATTAGGCTGGGTCTCCTGAGGGG + Intergenic
1038075093 8:24063820-24063842 TCTAGGCTAGATCTCAGGACTGG + Intergenic
1045347149 8:101303494-101303516 TTTAGGTTACGTCCCCTGAGTGG - Intergenic
1046193482 8:110830303-110830325 TTAGGGTTACATCTCCTGAGGGG - Intergenic
1046799785 8:118413170-118413192 TTTAGGCTACATTTGCTGAGTGG - Intronic
1049457189 8:142699585-142699607 TTTTGGCTCTATCTCCTGAGTGG - Intergenic
1050800752 9:9609915-9609937 TTTAGGCTAATACTCCTGATTGG + Intronic
1052150517 9:25109304-25109326 TGTATCCTAGATCTCCTAAGTGG + Intergenic
1052270559 9:26624207-26624229 TTTATCCTAGAGCTCCAGAGAGG + Intergenic
1055410653 9:76025862-76025884 ATTTGGTTAGAACTCCTGAGGGG - Intronic
1188021666 X:25165350-25165372 TTTAGTGTAGATTTCCTGGGAGG - Intergenic
1189581063 X:42406949-42406971 GTTAGGTTAGACCTCCTGAATGG - Intergenic
1191190113 X:57657661-57657683 AAAAGGCTAAATCTCCTGAGTGG - Intergenic
1192133617 X:68576037-68576059 TTTAGGGTAGATCTCATGGTAGG + Intergenic