ID: 945077702

View in Genome Browser
Species Human (GRCh38)
Location 2:206056750-206056772
Sequence CCCTTGCCCCAGGTGGAGAG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 338
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 310}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945077694_945077702 7 Left 945077694 2:206056720-206056742 CCAATTCGGTTTCCAGGTAGTGG 0: 1
1: 0
2: 8
3: 89
4: 187
Right 945077702 2:206056750-206056772 CCCTTGCCCCAGGTGGAGAGAGG 0: 1
1: 0
2: 0
3: 27
4: 310
945077698_945077702 -5 Left 945077698 2:206056732-206056754 CCAGGTAGTGGAGAGGGACCCTT 0: 1
1: 0
2: 0
3: 4
4: 102
Right 945077702 2:206056750-206056772 CCCTTGCCCCAGGTGGAGAGAGG 0: 1
1: 0
2: 0
3: 27
4: 310

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945077702 Original CRISPR CCCTTGCCCCAGGTGGAGAG AGG Exonic
900649177 1:3722672-3722694 CCCCTGTGCCAGGTGCAGAGAGG - Intronic
901513949 1:9732794-9732816 TCCTCGGCCCAGGTTGAGAGGGG - Intronic
901777541 1:11570698-11570720 CCCTTGCCTGGGGTGGGGAGTGG + Intergenic
901810787 1:11765919-11765941 CCCGGGTGCCAGGTGGAGAGGGG + Exonic
902391981 1:16112274-16112296 CCCCAGCCCCAGGGGGAGATGGG - Intergenic
903956480 1:27029592-27029614 CCCTTCCCTCAGGTGTGGAGCGG + Intergenic
904145131 1:28384605-28384627 CCCTTGCGCCTGGTGGAGTTGGG - Intronic
904769157 1:32871189-32871211 CCCTTTCCCAGGGTAGAGAGAGG + Intronic
905309732 1:37041097-37041119 TCCCTGCCCCAGGTCCAGAGGGG + Intergenic
906445744 1:45896544-45896566 TTCTTGCCCCAGGTGTAGGGTGG + Intronic
908458550 1:64327417-64327439 CCCTGGGCCCAGGTGGTGAATGG - Intergenic
912127246 1:106554513-106554535 CCCTTGGGCCTGGTGGAGATTGG + Intergenic
912370711 1:109172019-109172041 CCCCTGGCCAAGGTGGAGGGTGG + Intronic
913319128 1:117576385-117576407 CCCTTCCCCCAAGTGGTCAGTGG + Intergenic
915105711 1:153534074-153534096 CCCAGGTCCCAGGTGGAGTGGGG - Intergenic
915467663 1:156106694-156106716 ACCTTCCCCCAGGTGGTGAGGGG + Intronic
916497079 1:165356067-165356089 CACCTGCCCCAGGTCGAGAAGGG + Intronic
920399538 1:205668527-205668549 CCCTGTCCCCAGGAGGACAGGGG - Intronic
920509487 1:206540364-206540386 CCCTTTCCTCTGCTGGAGAGAGG + Intronic
920695861 1:208180927-208180949 CCCCTGCCCAAGTTTGAGAGGGG + Intronic
921754225 1:218834786-218834808 AGCCTGCCCCAGTTGGAGAGAGG + Intergenic
923232430 1:231999602-231999624 CCCTTGCCCCTGGTGGGGCAGGG - Intronic
1064954165 10:20888617-20888639 CTCCTGCTCCAGGGGGAGAGGGG + Intronic
1065703086 10:28444348-28444370 CCCCTGCCCCAGAAGGAGAATGG + Intergenic
1065995497 10:31055931-31055953 CCCCTGCCCCAGGTAGTAAGGGG + Intergenic
1066497368 10:35955267-35955289 ATATTGCCCCAGGTGTAGAGGGG - Intergenic
1067792473 10:49298578-49298600 CCCTTCCCAGAGGTGGAGAGGGG + Intergenic
1069889638 10:71644911-71644933 CCCTTGCCCCAAGTGCAGGCAGG + Intronic
1071886998 10:89962151-89962173 CCCTTATTCCTGGTGGAGAGGGG - Intergenic
1072565880 10:96616176-96616198 CCCATGCCCCAGGTGTAGCAGGG - Intronic
1073206003 10:101769759-101769781 ACCTTGCCCCAGCTGGTGGGCGG - Intergenic
1073417357 10:103395633-103395655 CCCATCTCACAGGTGGAGAGAGG - Intronic
1073794120 10:106969764-106969786 CGATTGTTCCAGGTGGAGAGAGG - Intronic
1073879022 10:107958585-107958607 CCCTTGACCCTGGGGGACAGAGG - Intergenic
1075463271 10:122632596-122632618 CCCCTGCCCCAGATGGAGTGGGG - Intronic
1075560631 10:123465825-123465847 CCCTTGCACCATGTGAAGACAGG + Intergenic
1079121465 11:17688224-17688246 CCCCTGCTTCAGGAGGAGAGGGG - Intergenic
1079237784 11:18702030-18702052 CCCCAGCCCCAGGAGGAGAGAGG - Exonic
1083312124 11:61789300-61789322 CCCTTGCCCCAGGAGCACAGGGG - Intronic
1083718801 11:64593846-64593868 CCATTCCCCCGGGTGGAGAGTGG - Intronic
1083838516 11:65288838-65288860 CGTTTGCCCCAGATGGAGGGAGG - Intronic
1084087624 11:66861833-66861855 CCCGCCCCCCAGGTGGAGAAAGG - Intronic
1085784887 11:79440339-79440361 CCCCTGGCCCAGGAGGAGGGAGG - Intronic
1086570778 11:88281752-88281774 CCCTTCCTCCTGGTGGAGACAGG - Intergenic
1087815901 11:102658575-102658597 CCCTTGCCCTAGGTAAAGGGAGG + Intergenic
1089591752 11:119546369-119546391 CCCTTGCCCCAGGCTGCCAGGGG + Intergenic
1089645269 11:119874783-119874805 CTCTGACTCCAGGTGGAGAGGGG - Intergenic
1090266526 11:125356723-125356745 CCCTGGCCCCACCTGGAGTGGGG - Intronic
1090405744 11:126474993-126475015 CCCTTACCCCAGGAGGAGCTGGG + Intronic
1090633251 11:128669243-128669265 TCCTTGCAGAAGGTGGAGAGGGG + Intergenic
1091807052 12:3364345-3364367 CCCTGGCCCCAGCTGAGGAGGGG - Intergenic
1097188829 12:57209935-57209957 CCCTGGGACCTGGTGGAGAGGGG + Intronic
1097687002 12:62700416-62700438 GCTTTGCCACAGGTGGAGACAGG - Intronic
1098893536 12:76032316-76032338 GGCTTGCCACGGGTGGAGAGAGG + Exonic
1099574396 12:84362125-84362147 CCCTTGCCCCAGGCTGCAAGGGG + Intergenic
1101091127 12:101286872-101286894 CCCTTATACCAGGTGTAGAGAGG - Intronic
1101816725 12:108151352-108151374 CCCTTGATGCAGGTGGAGAGGGG + Intronic
1102248486 12:111369673-111369695 CCCTGGCTCCAGGTGAAGAGAGG + Intergenic
1102421084 12:112803312-112803334 CCTTTCTCCCAGATGGAGAGAGG + Intronic
1102548495 12:113674030-113674052 CCACTGCCGCAGGTGGAGGGAGG - Intergenic
1102591519 12:113959831-113959853 CTGTTGCCCAAGGAGGAGAGAGG - Intronic
1104751520 12:131243011-131243033 CACTTGCCCCTGAAGGAGAGTGG - Intergenic
1104881554 12:132074928-132074950 CCTTTGCCCCAGGCTGCGAGGGG - Intronic
1105040216 12:132955836-132955858 CCCTTGGCCCCAGGGGAGAGGGG - Intronic
1106553455 13:30790760-30790782 CCCTGGCAGCAGGTGGAGAGTGG + Intergenic
1106865327 13:33958350-33958372 CCCATGCCCCAGGAGCAGTGAGG + Intronic
1107016245 13:35709823-35709845 ACCTTACCCAAGGTGGAAAGAGG - Intergenic
1109481255 13:62957123-62957145 CTCTTGCCCCTGCTGGAGTGCGG - Intergenic
1111747682 13:92290997-92291019 CGCTGGCCCCAGGTAGTGAGGGG + Intronic
1111908570 13:94284174-94284196 CCCAGGCCCCAGGCGGACAGAGG - Intronic
1112656037 13:101453604-101453626 TCCTTCCTCCAGGTGGACAGAGG - Intronic
1113610623 13:111642398-111642420 CCCTTTCCTCAGGTGGAGCTGGG + Intronic
1113649573 13:112026420-112026442 CCCTTCGCCCAGGAGCAGAGGGG + Intergenic
1113923579 13:113928314-113928336 CCTTTGCCCCAGGAGGGGCGGGG + Intergenic
1114602433 14:23967513-23967535 GCAATCCCCCAGGTGGAGAGAGG - Intronic
1114606802 14:24004639-24004661 GCAATCCCCCAGGTGGAGAGAGG - Intronic
1114612103 14:24049587-24049609 GCAATCCCCCAGGTGGAGAGAGG - Intergenic
1116677153 14:47920330-47920352 CCCTTGCCCCATGTGGATCCAGG + Intergenic
1119400338 14:74358464-74358486 CCTTTGCCCAAGGTGGGGACCGG - Exonic
1119677793 14:76568970-76568992 CCCTGGCCCCAGGTGAGGGGAGG + Intergenic
1121313177 14:92946053-92946075 CCAATGACGCAGGTGGAGAGAGG + Intronic
1122194464 14:100074726-100074748 GTCTTTCCCAAGGTGGAGAGGGG - Intronic
1122312582 14:100806549-100806571 CCCCTGCCCCAGGCGGGGAGAGG - Intergenic
1122537412 14:102475289-102475311 CCCTTGCCCAGGGTGCAGAAAGG + Intronic
1122776669 14:104119909-104119931 CCCCTGACCCAGGTGGAGGATGG + Intergenic
1122800749 14:104228424-104228446 ACTTTGCCCAAGGTGGCGAGAGG + Intergenic
1122870996 14:104639026-104639048 CCCTGACCACAGATGGAGAGTGG + Intergenic
1124162215 15:27282896-27282918 CACTGGCCCCAGGTAGGGAGGGG + Intronic
1125507322 15:40274310-40274332 CCCTTGCCTCAGGAGGAATGGGG - Intronic
1126110965 15:45174496-45174518 CCCTTGCCCAAGCAGGGGAGAGG + Intronic
1126415639 15:48415160-48415182 TCCCTGCCCCAGGAGAAGAGTGG + Intronic
1126689105 15:51274083-51274105 CCTTTGCACCAGGTAGAGAGTGG + Intronic
1128707769 15:69850377-69850399 TCCTTGCCCCTGGTGGGGAGGGG - Intergenic
1129150466 15:73684728-73684750 CCCTTTCCTCGGGTTGAGAGGGG + Intronic
1129270799 15:74418299-74418321 CCCTTCCCCCAGGTGAATATCGG - Exonic
1129274230 15:74434622-74434644 CCCCTTCCCCAAGTAGAGAGGGG + Intergenic
1129832616 15:78680663-78680685 CCCTTGCACCTGCTGGAAAGCGG + Intronic
1129873216 15:78955011-78955033 CCCATGACCCAGCTGAAGAGTGG - Intergenic
1130229205 15:82083651-82083673 TTCTTGCCCCAGGTGGAGACTGG + Intergenic
1130280575 15:82517094-82517116 CCCTTGCACCTGCTGGGGAGGGG + Intergenic
1130471946 15:84233277-84233299 CCCTTGCACCTGCTGGGGAGGGG + Intergenic
1130479440 15:84347848-84347870 CCCTTGCACCTGCTGGGGAGGGG + Intergenic
1130492330 15:84440281-84440303 CCCTTGCACCTGCTGGGGAGGGG - Intergenic
1130966498 15:88701255-88701277 CCCCTGGGCCAGGTGGAGGGAGG - Intergenic
1135003993 16:18801936-18801958 CCGTTGCCTCAGGCGGAGGGCGG + Intergenic
1135188725 16:20336939-20336961 CCCTTTCCTCATGAGGAGAGGGG - Intronic
1135337905 16:21619455-21619477 CACTTGCCCAAGCTGGAGTGCGG + Intronic
1135579744 16:23615339-23615361 CCATTGCCCAAGCTGGAGTGTGG + Intronic
1136545080 16:30949974-30949996 CCCTTGGGCCCGCTGGAGAGTGG - Intronic
1136601855 16:31297640-31297662 CCCTTGCCCAGGGGGGTGAGTGG + Exonic
1136610646 16:31363061-31363083 CCCTTGCCCAGGGGGGTGAGTGG + Exonic
1136663820 16:31790906-31790928 CCCATCCCCCAGGTGCAGACGGG - Intronic
1137547722 16:49415940-49415962 GCTTTTTCCCAGGTGGAGAGAGG - Intergenic
1137591222 16:49695148-49695170 CTCTTGCCCAAGCTGGAGTGCGG + Intronic
1138116003 16:54361222-54361244 CCCAAACCCCATGTGGAGAGGGG - Intergenic
1138263940 16:55645824-55645846 CCTTTGTCCCAAGTTGAGAGTGG - Intergenic
1141469051 16:84226120-84226142 CCCTTGCCACAGGCAGAGCGAGG + Intronic
1142593993 17:1020822-1020844 CACCTGCCCCAGGGGGTGAGAGG - Intronic
1142646245 17:1315649-1315671 CCATTGCCCCAGTTGGAGGCAGG + Intergenic
1142846903 17:2685798-2685820 CCCTTCCCCCGGGTGGAGGAGGG + Intergenic
1142978942 17:3660497-3660519 CTCTGGCCCCAGGAGCAGAGTGG - Intronic
1143371092 17:6439973-6439995 CCCTTGCCTCCGTTGGGGAGGGG - Intergenic
1143537199 17:7548736-7548758 CCTTTCCCCCAGGTGCAGGGAGG - Intergenic
1144766895 17:17737977-17737999 CCCTGGCCCCAGAAGGAGGGAGG + Intronic
1145118705 17:20236138-20236160 CCCCTCTCCCAGGTGGAGGGGGG + Intronic
1145303373 17:21655501-21655523 ACCAGGCCCCAGGTAGAGAGTGG + Intergenic
1145346668 17:22046339-22046361 ACCAGGCCCCAGGTAGAGAGTGG - Intergenic
1146054395 17:29573941-29573963 CCCTGGCTCCAGGTGGGGAAGGG + Exonic
1146080149 17:29772717-29772739 TCCTAGCTCCAGGAGGAGAGAGG - Intronic
1146646486 17:34580278-34580300 CCCTTGCCCCAGCCGCCGAGCGG + Intergenic
1147051701 17:37800018-37800040 CCATTGCCTCAGGTGGAGTAGGG + Intergenic
1147254462 17:39173953-39173975 CCCCACCCCCAGGTGGAGGGTGG + Exonic
1147867808 17:43565032-43565054 CCCATGGCCCAGATGCAGAGAGG - Intronic
1147964869 17:44189216-44189238 CACATGCCCCAGGTGGAGGACGG - Exonic
1148142188 17:45336826-45336848 CCCTTTCCTGAGATGGAGAGCGG - Intergenic
1148695837 17:49557532-49557554 CACTTGCAGCAGGTGGAAAGTGG - Intergenic
1148794610 17:50191028-50191050 TCCTTGGCCCAGGTGGAGGCAGG - Intronic
1150716150 17:67574177-67574199 CAGTTGCCCCAGGTGGAGAATGG - Intronic
1151192121 17:72406289-72406311 CCTTTGCACCAGGTTGAGTGGGG - Intergenic
1151499525 17:74480088-74480110 CACTTGTCCCAGGTGGGGACAGG + Intronic
1152149069 17:78587743-78587765 CACTTGCCTCAGGTGGGCAGAGG - Intergenic
1152288133 17:79424160-79424182 CCCTCTCCCCAAGTGCAGAGCGG + Intronic
1152447550 17:80354646-80354668 CCCATGGCCCGGATGGAGAGAGG - Intronic
1152504689 17:80741155-80741177 CCCGTGACCCAGCAGGAGAGTGG + Intronic
1152579565 17:81160049-81160071 CACCTGCCCCAGGGGGAGTGAGG - Intronic
1152612262 17:81321691-81321713 TCGGTGCCCCAGGTGGACAGAGG - Intronic
1152847124 17:82608062-82608084 CCATTGCCCAAGCTGGAGTGTGG - Intronic
1152944608 17:83192144-83192166 CCCCTGGCCCTGGGGGAGAGGGG - Intergenic
1153864009 18:9245421-9245443 CTGTAGCCCCAGCTGGAGAGTGG - Intronic
1157625188 18:49045131-49045153 CCCTTGTCCCAGGTTGGGTGGGG + Intronic
1157688761 18:49664135-49664157 CCCTTGCCCCGGATGCAGTGTGG + Intergenic
1160947181 19:1649058-1649080 CCGTTCACCCAGGTGGAGAATGG + Intronic
1160962635 19:1730329-1730351 CCATCGGCCCAGGGGGAGAGGGG + Intergenic
1161016414 19:1985849-1985871 GCCCTGGCCCAGGTGGTGAGCGG - Exonic
1161238692 19:3210205-3210227 CCCCAGCCCCAGGTTCAGAGAGG + Intergenic
1161624851 19:5320288-5320310 TCCCTGCCCCAGTGGGAGAGGGG + Intronic
1161981878 19:7634154-7634176 CCCTAGCCCCAGGTGGGAACAGG + Intronic
1162495702 19:11022205-11022227 CCTATGCTCCAGGTGCAGAGTGG + Intronic
1163148506 19:15398193-15398215 CACTTGGCCCAGGTGGGGACCGG + Intronic
1163291818 19:16384038-16384060 CCCATGGCCCAGGTGGTAAGGGG - Intronic
1163455991 19:17405963-17405985 CAGTTTCCCCAGGTGGAGACCGG - Intronic
1164279933 19:23760202-23760224 TCCTGGCCCCATGTGGAGATAGG - Intergenic
1166159052 19:40938076-40938098 CACTGGCCCCAGCTGGAGGGAGG - Intergenic
1166288202 19:41845274-41845296 CCCGTGCCCCAGGGAGCGAGTGG - Intronic
1167271890 19:48510711-48510733 CCCTTGGCAGAGGTGCAGAGTGG + Intronic
1168036331 19:53722628-53722650 TCGTTTCCCCAGCTGGAGAGCGG + Intergenic
925189962 2:1874819-1874841 CCGTTGCCCTAGGTGGAAATGGG - Intronic
925521028 2:4746053-4746075 CCCTTGCCCCGAGGGGAGAGGGG - Intergenic
926103752 2:10137467-10137489 CCTTTGCCCCAGGTGACAAGGGG - Intergenic
926404552 2:12537936-12537958 CCCTTGCTCAAGTTGCAGAGAGG + Intergenic
926999683 2:18780869-18780891 CCCTTGGCTCAGGTGAAAAGTGG + Intergenic
927204607 2:20599227-20599249 TCCTGGCCCCAGGGGGAGTGAGG + Intronic
927226045 2:20767160-20767182 CCCCTGCCCCAGGCTGTGAGGGG + Intronic
929775591 2:44929116-44929138 CCCCAGCCCCAGCTGGACAGGGG - Intergenic
930026934 2:47034712-47034734 GCCTTGCCCACTGTGGAGAGGGG - Intronic
931221755 2:60295034-60295056 CCCTGGTCCCAGGTGGGCAGGGG - Intergenic
931353557 2:61514148-61514170 CTATTGCCCCAGCTGGAGTGTGG - Intronic
932566812 2:72916077-72916099 CCCTTGGGCGAGGTGGGGAGGGG - Intergenic
932606047 2:73166364-73166386 CCCTTTCCCCAGCTGAGGAGTGG - Intergenic
932667758 2:73710715-73710737 GCCTTCCCCAGGGTGGAGAGTGG + Intergenic
933224952 2:79737310-79737332 CCGTTGCCCAGGCTGGAGAGTGG - Intronic
933648018 2:84828060-84828082 CCATTACCCCAGGGGGAGAAGGG + Intronic
933926380 2:87094087-87094109 CCCTTTCCCCAGCTGAGGAGTGG + Intergenic
935427170 2:102932165-102932187 CCCTCACCGCAGATGGAGAGAGG + Intergenic
936269929 2:111041701-111041723 GCCCTCCCCCAGGTGGACAGTGG - Intronic
936947510 2:117943775-117943797 TCCTAACCCCAGGTGGAGAGTGG - Intronic
937126520 2:119478344-119478366 CCCTCGCCCCAGGAGGCCAGGGG + Intronic
937410348 2:121669639-121669661 CCCTGGCCCAAGCTGGAGAATGG - Intergenic
937975244 2:127578254-127578276 CACATTCCCCAGGTGGAGAATGG - Exonic
941645788 2:168039638-168039660 CCTTTGCCAGAGGTGGAGGGAGG + Intronic
943820502 2:192315092-192315114 CCCTTGCCCCAGGCTGCGAGGGG - Intergenic
945077702 2:206056750-206056772 CCCTTGCCCCAGGTGGAGAGAGG + Exonic
946239198 2:218343623-218343645 CCCTTGTCCCAGGCTGAGCGTGG - Intronic
946372517 2:219289692-219289714 CTCTTGCGCCAGAAGGAGAGAGG + Exonic
946391477 2:219419153-219419175 CTCCTGCCCCATGTGGAGAAAGG + Intronic
947605187 2:231481530-231481552 TCCCTCCCTCAGGTGGAGAGAGG + Intronic
947752750 2:232541280-232541302 CCTGTGCCCCATGTGGATAGGGG - Intronic
948190626 2:236055568-236055590 CCCTGGCCCCAGCCGCAGAGCGG + Intronic
948421764 2:237864352-237864374 CCCTGGCCCCAGGCCGGGAGGGG + Intronic
948487168 2:238288448-238288470 GCCCTGTCCCAGGTGGAGAGTGG - Exonic
948669927 2:239561731-239561753 CCCTTGCCCCTGGGGGACACAGG + Intergenic
948790464 2:240374071-240374093 CCCTGGACCCAGGTGGACTGGGG + Intergenic
948830670 2:240596949-240596971 TCCTTGCCCCAGGGAGGGAGGGG + Intronic
1168955349 20:1830551-1830573 CCCTTCCCCCAGCTGCATAGAGG - Intergenic
1168966105 20:1898951-1898973 CCTTTGCGACAGATGGAGAGGGG + Intronic
1169064365 20:2686050-2686072 CCCTTGTCCCGGGTGAAGTGGGG - Intergenic
1169235099 20:3924465-3924487 CCCTTGCCCCAGCTGGAACACGG - Intronic
1169702001 20:8457206-8457228 ACCATGTCCCAGGTAGAGAGGGG - Intronic
1170945940 20:20891112-20891134 CCCCTGCCCCAGGGGGAGCTGGG - Intergenic
1172032826 20:31993797-31993819 CCCTTACCCTAGGTGGAAGGTGG + Intronic
1172600652 20:36180347-36180369 ACCTTGCCCCAGGTGCACTGAGG - Intronic
1173337286 20:42123042-42123064 CCCATGTCCCAGGAGGAGAAAGG - Intronic
1174839671 20:53890110-53890132 CTCTTGCCCAAGCTGGAGTGCGG + Intergenic
1175948247 20:62568685-62568707 CCTTTGCACCTGGTGGGGAGAGG - Intronic
1176707390 21:10126219-10126241 CCCAAGCCCCAGGTAGAGATCGG - Intergenic
1177954725 21:27583619-27583641 CACTTGCCCAAAGTAGAGAGTGG + Intergenic
1178445136 21:32632981-32633003 CTCTTGCCCAAGCTGGAGTGCGG - Intronic
1180007089 21:45027851-45027873 TCCTTGCCCCCTGAGGAGAGGGG + Intergenic
1180127273 21:45801042-45801064 CCATTGCCAGAGTTGGAGAGTGG - Intronic
1180182800 21:46125341-46125363 CCCATGCACCGGGTGGAGGGCGG + Intronic
1180621435 22:17165173-17165195 CCTCTTCCCCAGGTAGAGAGAGG - Intronic
1182125246 22:27811160-27811182 TTCTTGGCTCAGGTGGAGAGAGG + Intergenic
1182927834 22:34143083-34143105 GCCTTCCAGCAGGTGGAGAGTGG - Intergenic
1183284251 22:36952490-36952512 CCCTGGCCACAGATGGGGAGTGG - Intergenic
1183617793 22:38955661-38955683 CCCTTGCCAAGGGTGGACAGGGG - Intronic
1185039522 22:48497235-48497257 ACCTTGCCCTGGGTGGAGGGAGG + Intronic
950253017 3:11482538-11482560 CCCTAGACCCAGGTGGAGCAGGG - Intronic
950522544 3:13505492-13505514 CCGCTGACCCAGGTGGGGAGAGG + Exonic
950581672 3:13866352-13866374 CCATTCCCACAGGTGGCGAGAGG - Intronic
951518503 3:23588721-23588743 CTCTTGCCCAACGTGGAGAAAGG - Intronic
952268972 3:31814052-31814074 CGTTTGCCCTAGGAGGAGAGAGG - Intronic
952459069 3:33505090-33505112 CCCTTGCCTCAGGTGGCTATGGG + Intronic
955047862 3:55376810-55376832 CCCTTGCCCCAACTGGTCAGTGG + Intergenic
956678947 3:71760025-71760047 CCCTTGCCCCTCAGGGAGAGAGG - Intergenic
957073044 3:75580532-75580554 TCCCTGCCCAAGGAGGAGAGAGG + Intergenic
960483139 3:118217738-118217760 CAGTTGCCTGAGGTGGAGAGTGG - Intergenic
961511085 3:127404153-127404175 CCCTGGTACCAGATGGAGAGGGG - Intergenic
961792425 3:129385762-129385784 GCCTTGCTCCAGGGGCAGAGTGG + Intergenic
962677201 3:137765639-137765661 CCCTTCCCCCTGGAAGAGAGAGG - Exonic
965661173 3:171043777-171043799 GCCTTGCACCTGGTGGACAGAGG - Intergenic
966877075 3:184328566-184328588 ACGTTGCCCCAGAAGGAGAGTGG + Intronic
968473864 4:793919-793941 ACCTGGACCCAGGTGGAAAGTGG - Intronic
969516218 4:7649513-7649535 CCATGGCCCTGGGTGGAGAGGGG + Intronic
970590110 4:17552681-17552703 CCACAGCCCCAGGTGGAGACCGG - Intergenic
972072458 4:35038528-35038550 CCCCTGCCCCAGGCTGCGAGGGG + Intergenic
972360950 4:38325167-38325189 CACCGGCCCCAGGTGGTGAGGGG - Intergenic
975374189 4:73623795-73623817 CGCTAGCCACAGGTGGAGAATGG - Intergenic
975386339 4:73764290-73764312 TCCTTGCACCAGGAAGAGAGAGG - Intergenic
977045026 4:92058726-92058748 CTGTTGCCCAAGCTGGAGAGAGG + Intergenic
980865904 4:138553253-138553275 CGCTTGCCCCAGGCAGTGAGGGG + Intergenic
981016383 4:139978529-139978551 CCCTTTACCCAGGAGGAGAAAGG - Intronic
981361457 4:143850393-143850415 CTCTGGCTCAAGGTGGAGAGGGG + Intergenic
981372203 4:143971387-143971409 CTCTGGCTCAAGGTGGAGAGGGG + Intergenic
981938233 4:150256195-150256217 CCGCTGCCCCGGGTGGTGAGCGG + Exonic
982745152 4:159099149-159099171 TCCTTGCCCCATGGGGAGGGGGG - Intergenic
983632257 4:169860919-169860941 CCATTGCCCCGGCTGGAGTGCGG - Intergenic
984314216 4:178105402-178105424 CCCTTGACCCAGGGGGATAATGG + Intergenic
985353258 4:189089531-189089553 CCCTTGCCCAGGCTGGAGTGCGG - Intergenic
985575849 5:673252-673274 CCCTTGTCTCAGGAAGAGAGAGG - Intronic
986348872 5:6858774-6858796 CCCTGGAGCCAGGAGGAGAGAGG - Intergenic
991052022 5:62283252-62283274 CCATTGCCCAATCTGGAGAGTGG + Intergenic
995631141 5:114134118-114134140 CCCTAGCACCAGGTGGGAAGTGG - Intergenic
998092590 5:139379996-139380018 CCCTTGCCCCAGCGGTAGACAGG + Exonic
1001058041 5:168465365-168465387 CCCTTGCCAAAGGGGGAGAAGGG + Intronic
1001954230 5:175837335-175837357 CCTTGGCTCCAGGTGAAGAGGGG - Intronic
1002136699 5:177112223-177112245 CCCTTGAGTAAGGTGGAGAGTGG - Intergenic
1002424770 5:179168430-179168452 CCCTGGCTCCAGGGGGCGAGCGG - Intronic
1002789736 6:428271-428293 CATTTGTCCCAGTTGGAGAGGGG + Intergenic
1006798138 6:36743810-36743832 CCCTGGCCCTAGCAGGAGAGTGG + Intronic
1006851566 6:37102493-37102515 CCCTTCCCCGAGGTGGAGACTGG + Intergenic
1007322740 6:41039125-41039147 CCCTTGGGGCAGCTGGAGAGGGG - Intronic
1015772499 6:136783599-136783621 ATCTTGCCCCAGGTGGAGCGGGG + Intronic
1016648836 6:146440761-146440783 CTCTTGCCCCACGGGGAGTGAGG - Intergenic
1017751477 6:157493357-157493379 CCCGGGCTCCAGGCGGAGAGGGG + Intronic
1018039740 6:159911369-159911391 CTGTTGCCCCAGCTGGAGTGCGG + Exonic
1018837316 6:167494697-167494719 CCCTGACCCCCGGAGGAGAGGGG + Intergenic
1018939848 6:168301849-168301871 CCCTTGTCCCAGGTGGAACTGGG + Intronic
1019285042 7:219166-219188 ACCTCGCCCCAGGTGGAGCCTGG - Intronic
1019576084 7:1738247-1738269 CCCCTCACCCAGATGGAGAGAGG - Intronic
1019601077 7:1884134-1884156 GCCCTGCCCCAAGTGGAGACTGG - Intronic
1019647244 7:2137612-2137634 CTCTAGCCCCAGGTGCAGACAGG + Intronic
1019698607 7:2461368-2461390 CCCCTGCCCCAGGTGTGGTGTGG + Intergenic
1019943345 7:4308286-4308308 GCGTTTCCGCAGGTGGAGAGAGG - Intergenic
1020234810 7:6347477-6347499 CTCTTGCCCAAGCTGGAGTGCGG - Intronic
1020404317 7:7814798-7814820 CCCATGCCTCAGGTGGAGTATGG + Intronic
1022111595 7:27235660-27235682 CCCTTGCCCCAGGTGCTGCCTGG - Intergenic
1023082553 7:36538994-36539016 CTCTTTTCCCAGGTGGGGAGAGG + Intronic
1023909287 7:44542045-44542067 CCCTGGGCCCAGGTGGAGCAGGG - Intergenic
1024818432 7:53298058-53298080 CCCTGACCTCAGGTGCAGAGAGG + Intergenic
1026804913 7:73423733-73423755 CACATGCCCCAGGCTGAGAGAGG + Intergenic
1028541855 7:91951359-91951381 CTGTTGCCCCAGCTGGAGTGTGG + Intronic
1029127400 7:98304084-98304106 CTCTGTCCCCAGGGGGAGAGTGG - Intronic
1029609931 7:101621471-101621493 CCCCAGCCCCATGTGCAGAGCGG + Intronic
1029662051 7:101968898-101968920 CCCTTTACCAATGTGGAGAGAGG - Intronic
1032148503 7:129406367-129406389 CCCTTTCCCCACCTGAAGAGGGG - Exonic
1033713431 7:143974298-143974320 CCCTTACCCAAGGGTGAGAGTGG - Intergenic
1034953301 7:155316112-155316134 CCGTTGCCACAGATGGGGAGAGG + Intergenic
1035351763 7:158252335-158252357 CCCGTGCCCAGGGTGGTGAGTGG + Intronic
1035461529 7:159041951-159041973 CCCGTTCCCCAGGTGGAGTTGGG - Intronic
1036802139 8:11800883-11800905 CCCTTGGCCGAGGTGGGGAGTGG + Intronic
1037703330 8:21295268-21295290 CCCTGGCCCAAGGTGGGGAGGGG + Intergenic
1038858523 8:31359901-31359923 ACCTTGCCCCAGGTGAACATGGG + Intergenic
1038939003 8:32283392-32283414 ACCTTGCCCCAGGTGACAAGTGG - Intronic
1039461627 8:37750115-37750137 CTCATGCCCAAGGTGGAGACAGG + Intronic
1042760727 8:72268965-72268987 CACTTTCACCAGGTGGATAGAGG + Intergenic
1042797876 8:72684418-72684440 CCCTTGAACCAGGGGCAGAGTGG + Intronic
1045261088 8:100574895-100574917 CCCTTGCCCAGGCTGGAGTGCGG - Intronic
1047389308 8:124437241-124437263 CCCTTGACCCAAGTGCAGTGAGG + Intergenic
1048326186 8:133441275-133441297 CCCCTCCCCCAGGTGGGCAGTGG - Intergenic
1048747876 8:137635501-137635523 TCCTTGACCCAGGTGGCAAGGGG - Intergenic
1049379167 8:142303429-142303451 CTCTTGGCCAAGGTGGGGAGAGG + Intronic
1050460746 9:5875432-5875454 CCCCTACCCTGGGTGGAGAGAGG + Intergenic
1050552214 9:6758271-6758293 CCCGTGCCCCACGCGGAGGGGGG - Intronic
1051358677 9:16262995-16263017 CCCCTGCCCCAGGCTGACAGGGG - Intronic
1051367634 9:16332439-16332461 CCATTGCCCAGGGTGGAGGGAGG + Intergenic
1051401285 9:16685691-16685713 CACTTGACCCAGGCAGAGAGAGG + Intronic
1052576565 9:30299377-30299399 CGCATGCCCCAGGTAGTGAGGGG + Intergenic
1056515375 9:87344550-87344572 CATTTTCCCCAGATGGAGAGTGG - Intergenic
1057122175 9:92586372-92586394 CCCTTGCCCCAGGCAGGCAGGGG - Intronic
1057164785 9:92916973-92916995 CACTTGCCCCAGGAGGAGGTGGG + Intergenic
1057333813 9:94140987-94141009 CCCCCGGCCCAGCTGGAGAGAGG - Intergenic
1057597134 9:96424087-96424109 ACCTTTCCACAGATGGAGAGAGG - Intergenic
1060553019 9:124494658-124494680 CTCTGGCCCCAGGTGGGCAGTGG - Intronic
1060553028 9:124494692-124494714 CTCTGGCCCCAGGTGGGGAGTGG - Intronic
1060553040 9:124494726-124494748 CTCTGGCCCCAGGTGGTGAGTGG - Intronic
1060553049 9:124494760-124494782 CCCTGGCCCCCAGTGGGGAGTGG - Intronic
1060553061 9:124494794-124494816 CTCTGGCCCCAGGTGGGGAGTGG - Intronic
1060553070 9:124494828-124494850 CTCTGGTCCCAGGTAGAGAGTGG - Intronic
1202792137 9_KI270719v1_random:95099-95121 CCCAAGCCCCAGGTAGAGATCGG - Intergenic
1189232056 X:39460250-39460272 CCCTCCCTCCAGGTGGAGGGAGG + Intergenic
1190115023 X:47620523-47620545 CCCTTGCCCAAGGTGGCAAGGGG + Intergenic
1192363803 X:70455055-70455077 CCCCTGACCCAGGAGGAGGGCGG + Intronic
1197503990 X:127278925-127278947 CTCTTGCCCAAGGTGGAATGCGG - Intergenic
1197533929 X:127663998-127664020 CCCTTGCACCAGTGGGAGTGGGG - Intergenic
1197870359 X:131058150-131058172 CCCTTGCCCCACGCGAAGGGAGG - Intergenic
1198169509 X:134091871-134091893 ACCATGCCACAGGTGGACAGCGG + Intergenic
1198275504 X:135094930-135094952 CAATGGCCCCAGGTGGAGAGAGG - Intergenic
1200097973 X:153673113-153673135 CCCTTGCCCCCGGCGGGGCGGGG - Intronic