ID: 945078278

View in Genome Browser
Species Human (GRCh38)
Location 2:206062657-206062679
Sequence CCAGAATTCAACATTTATAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 284
Summary {0: 1, 1: 0, 2: 3, 3: 15, 4: 265}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945078272_945078278 23 Left 945078272 2:206062611-206062633 CCATATTTCATCTTTAAAAGTAT 0: 1
1: 0
2: 3
3: 86
4: 802
Right 945078278 2:206062657-206062679 CCAGAATTCAACATTTATATAGG 0: 1
1: 0
2: 3
3: 15
4: 265
945078273_945078278 -1 Left 945078273 2:206062635-206062657 CCATAGATTACTTAGATTACCCC 0: 1
1: 0
2: 0
3: 4
4: 99
Right 945078278 2:206062657-206062679 CCAGAATTCAACATTTATATAGG 0: 1
1: 0
2: 3
3: 15
4: 265

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945078278 Original CRISPR CCAGAATTCAACATTTATAT AGG Intronic
900695198 1:4005375-4005397 GCAGAATTAAACATTTGAATAGG + Intergenic
901071828 1:6524076-6524098 CCAGATTTCAACATAAATAAGGG + Exonic
901705569 1:11070574-11070596 CTAGAATGCAACATTTTTGTAGG + Intronic
908304495 1:62798228-62798250 CTAGAATTCATCATTTATTGAGG + Intronic
909049408 1:70750576-70750598 CCAGTATTCAACATTCTTAAAGG - Intergenic
910065555 1:83146672-83146694 TCAGATTTCAACATATATTTTGG - Intergenic
910317717 1:85905954-85905976 CCAGCATTCAATATTTAGTTAGG - Intronic
911651212 1:100391053-100391075 CTTGAATTCCACAGTTATATAGG + Intronic
912181562 1:107225154-107225176 CCAGAACATAAGATTTATATAGG + Intronic
916887487 1:169084191-169084213 CCAGAATTCAGCATCTTTCTTGG - Intergenic
917644361 1:177015575-177015597 CTACAATTCCACATTTATTTAGG + Intronic
919496407 1:198275514-198275536 TCAGAGCTAAACATTTATATAGG + Intronic
919515294 1:198514830-198514852 CCAGAATTCAACTTTTAATAAGG - Intergenic
920631522 1:207657707-207657729 CCAGAGTTTATCATTTTTATTGG - Intronic
921819580 1:219601732-219601754 CCAGAATTTAACTTTGAGATTGG + Intergenic
922955616 1:229596743-229596765 CCAGAATTCATCAATTAAAATGG + Intronic
923209425 1:231789674-231789696 CCAGAATGAGACATTTATACAGG - Intronic
1063674201 10:8125270-8125292 GCAGAACAAAACATTTATATAGG + Intergenic
1063779166 10:9301350-9301372 CCAAAATACTACATTTTTATTGG + Intergenic
1063808650 10:9678310-9678332 CAAGAATTCTACATTTATATTGG + Intergenic
1063957185 10:11278054-11278076 CTAAAATGCCACATTTATATGGG + Intronic
1064776624 10:18785899-18785921 CCAAACTTCAACATTTTTTTGGG + Intergenic
1066520555 10:36213431-36213453 ACAAAATTCAATATTTTTATGGG - Intergenic
1068213240 10:53950306-53950328 CCTAAATTCAAAATTTATACTGG - Intronic
1068922276 10:62497395-62497417 CAAGAATTTAACATTTACCTGGG + Intronic
1071181940 10:82996542-82996564 TCAGAATTCAACATTTAGGCAGG + Intergenic
1074314032 10:112345863-112345885 CCAGAATTCATCTTTCTTATGGG - Intergenic
1075605649 10:123804246-123804268 GCTGAATTTAAAATTTATATAGG - Intronic
1078385275 11:10885545-10885567 CAGAAATTCAACATTTATTTGGG + Intergenic
1078704585 11:13729071-13729093 CCAGAATTGCACAGTTATACTGG - Exonic
1079869899 11:25784028-25784050 CAAAAATTCAACATATATTTGGG + Intergenic
1080311939 11:30904733-30904755 CCAGAATTCAGTTTTTAGATTGG - Intronic
1081172765 11:39889078-39889100 CCAATATTCAACATTTCTAAAGG + Intergenic
1081183039 11:40007414-40007436 TCAGATTTCAACATATAAATTGG + Intergenic
1081185632 11:40038990-40039012 CCAATATTCAACATTTCTAAAGG + Intergenic
1081225058 11:40511426-40511448 GCAGAATTGAACATTAATCTAGG + Intronic
1081504761 11:43704545-43704567 ACAGAATCCCACATTTGTATAGG + Intronic
1082323171 11:51102873-51102895 ACAGAGTTCAACATTCCTATAGG + Intergenic
1082395287 11:52151031-52151053 ACAGAGTTCAACATTCCTATAGG + Intergenic
1082448460 11:52919450-52919472 ACAGAATTCAACATTCCTATAGG + Intergenic
1082458154 11:53060569-53060591 ACAGAGTTCAACATTCCTATAGG + Intergenic
1082498645 11:53644397-53644419 ACAGAGTTCAACATTCCTATAGG + Intergenic
1082531484 11:54119513-54119535 ACAGAGTTCAACATTCCTATAGG + Intergenic
1082985824 11:59170614-59170636 CCAGTATTCAAAATTTAGTTGGG - Intergenic
1085005418 11:73084107-73084129 ACAGTAGCCAACATTTATATAGG - Intronic
1086956659 11:92940872-92940894 TCAGAATGCAACACTCATATTGG + Intergenic
1087729793 11:101766184-101766206 AGAGAATTCAACATTTATTCTGG - Intronic
1089973784 11:122715243-122715265 TCAGCATTTAACATTTATCTCGG - Intronic
1090774746 11:129953632-129953654 CCAGAATTCTAAATTTGAATTGG - Intronic
1091521684 12:1251347-1251369 ACAGGATTAAACATTTAAATAGG - Intronic
1093477511 12:19572695-19572717 CCAGAATTCAGAATATAAATAGG - Intronic
1093767977 12:22986695-22986717 ACAGAATTCCACATTTATTAAGG + Intergenic
1094870101 12:34593276-34593298 ACAGAATTCAACATTTCTTATGG + Intergenic
1095079083 12:37974922-37974944 ACAGAATTAAACATTTCTTTTGG + Intergenic
1095434341 12:42170919-42170941 CCACCATTCAACATTTAGAGCGG - Intronic
1096527627 12:52221037-52221059 TCATAATTCAATATATATATTGG - Intergenic
1097780465 12:63697372-63697394 CCAAAATTCAAAAGTTATACAGG - Intergenic
1098164101 12:67675310-67675332 CCAGAAAGAAACATTGATATAGG + Intergenic
1099173642 12:79395519-79395541 CCAGAGCTCAACATTTATTACGG + Intronic
1099732548 12:86524393-86524415 CCAATATTCAACATTTTTAGAGG - Intronic
1100114695 12:91290434-91290456 GCAATATTCAACATTTATCTTGG - Intergenic
1100676190 12:96870760-96870782 CCAGAGTTCAAAATTGTTATTGG - Intronic
1100780893 12:98024994-98025016 TCAGAATTCAACATTTTATTTGG - Intergenic
1101159104 12:101955540-101955562 CCAGGATTCATCATTAAGATGGG + Intronic
1101589710 12:106114779-106114801 AAAAAATTCAACATTTACATGGG + Intronic
1103289307 12:119831156-119831178 TTAGGATTAAACATTTATATGGG - Intronic
1105722074 13:23127023-23127045 GCAGGACTCAACATTTATAGTGG + Intergenic
1108257927 13:48628509-48628531 CTAGAATTCAAGATTTGGATGGG + Intergenic
1108910023 13:55537351-55537373 CCAGAAATAAACTATTATATTGG - Intergenic
1109491296 13:63103157-63103179 TCTGATTTCAACATTTAAATGGG - Intergenic
1110030763 13:70610077-70610099 CAAGGACCCAACATTTATATAGG - Intergenic
1110150465 13:72246298-72246320 CCTGATATCAACATGTATATTGG + Intergenic
1110310797 13:74047003-74047025 CAAGAAATTAACATATATATTGG + Intronic
1110878102 13:80535977-80535999 ACAAAATTCAACATTTTGATTGG + Intergenic
1111781301 13:92728989-92729011 CCAGGATTCAATATTCATACTGG + Intronic
1111941018 13:94606875-94606897 CCTGAATTCAAAACTTATCTGGG + Intronic
1112436659 13:99395464-99395486 CCAGATTTCTACAATTATAGTGG + Intergenic
1112851926 13:103716629-103716651 CCATAATTTAACCTTTATTTTGG - Intergenic
1114997234 14:28370174-28370196 CAAGAATGCAACACTTATATGGG - Intergenic
1115178989 14:30600074-30600096 CCAGTTTACAAAATTTATATAGG + Intronic
1115302509 14:31900529-31900551 CCAGAAATCCACATTCTTATAGG - Intergenic
1115793379 14:36905018-36905040 CTAGAATTTAACAATTATTTTGG - Intronic
1116213661 14:41981488-41981510 GCAGATTTCAGTATTTATATTGG - Intergenic
1117282597 14:54255475-54255497 CCAGAATTCTAGATTTTCATGGG + Intergenic
1117797751 14:59411274-59411296 CCAAAATTCAACATTCTTAAAGG + Intergenic
1118450240 14:65893881-65893903 CCAATATTCAACATTTTTAAAGG + Intergenic
1124838892 15:33223652-33223674 CCAGAATTCATTATTTTTAATGG - Intergenic
1126676126 15:51160570-51160592 CTAGAATTCCACATTTACAGTGG + Intergenic
1126717979 15:51542289-51542311 CCTGACTTCAACATATTTATGGG + Intronic
1127108629 15:55644513-55644535 CCAGAATTAAACTTTTCTGTTGG + Intronic
1127941437 15:63701321-63701343 TCATAATTGAACCTTTATATAGG - Intronic
1128858953 15:71048647-71048669 CAAGAATTTAACATTTATTTTGG - Intronic
1130186442 15:81688102-81688124 CCAGACTTCTACATTTGAATTGG - Intergenic
1133520443 16:6550848-6550870 CCAGAATTAAATATCTATTTAGG - Intronic
1135865197 16:26094452-26094474 CCAATATTCAACATTCATAAAGG + Intronic
1136943768 16:34620001-34620023 ACAGAGTTGAACATTTATTTTGG - Intergenic
1137680546 16:50340343-50340365 CCAGAATGAAACTTTTAAATGGG + Intronic
1141902474 16:87001129-87001151 TCAGAAATCAACCCTTATATTGG + Intergenic
1141918365 16:87117516-87117538 TCAAAATTCATCATTTATTTTGG + Intronic
1145074241 17:19838026-19838048 CCAGCCCTCATCATTTATATTGG + Intronic
1145870454 17:28269185-28269207 TCACAATTCAACCTTTAGATCGG - Intergenic
1147556703 17:41484105-41484127 CCAGAATTCAACAGTGTTGTGGG - Intergenic
1147938852 17:44031045-44031067 CTAGAAAACAACATTTGTATAGG + Intergenic
1154345287 18:13538683-13538705 CCAGAATACAAAAATTATCTTGG - Intronic
1154371490 18:13766618-13766640 ACAGAATTCAGAATTTAGATAGG + Intergenic
1159137498 18:64353208-64353230 CCATAATTGTACATCTATATGGG + Intergenic
1160335866 18:78038833-78038855 ACAGAATTCAAGAATTATCTGGG + Intergenic
1160428531 18:78795122-78795144 CTGGAATTAAACCTTTATATTGG - Intergenic
1163744326 19:19035969-19035991 ACAGAATACACGATTTATATGGG + Intronic
1163862018 19:19747680-19747702 CCAGAATTCCACGTTTACACTGG + Intergenic
1168710080 19:58494587-58494609 GCAGAACAAAACATTTATATAGG - Intronic
925654681 2:6133411-6133433 CTAGAATTCGACATTCATTTTGG + Intergenic
926021245 2:9497400-9497422 CCAGCAATCAGCATTTAAATGGG + Intronic
927465117 2:23331071-23331093 TCAGACTTCAAAATTTATAGGGG - Intergenic
928489046 2:31762166-31762188 CAAGATTTCAACATATAAATTGG + Intergenic
928892833 2:36224725-36224747 CCATAATTTTACTTTTATATTGG - Intergenic
930548827 2:52804995-52805017 ACAGAATTCTACTTTTATGTTGG - Intergenic
931032268 2:58190855-58190877 CTAAAATTCAACTTTTATTTTGG + Intronic
931451792 2:62373675-62373697 CCAGAAATCCAGATTTTTATGGG + Intergenic
931494725 2:62790970-62790992 CCAGAAACCCACATCTATATTGG - Intronic
931511231 2:62997725-62997747 CCAAAAATAAGCATTTATATGGG + Intronic
934773885 2:96925020-96925042 CCAGATTTCAGCATTTATTAGGG + Intronic
938090720 2:128432673-128432695 GAAAGATTCAACATTTATATCGG - Intergenic
939830613 2:147065773-147065795 TCAGAACTCAACAGTTCTATAGG + Intergenic
940431932 2:153602397-153602419 CCAGAAATCAAGATTTAGTTTGG + Intergenic
942474452 2:176302736-176302758 CCAAAAGTCAGCATTTTTATAGG + Intronic
943744732 2:191450099-191450121 CTAGAATTCAATATTTTTTTTGG + Intergenic
944090928 2:195910729-195910751 CAAGACTTCTAGATTTATATAGG - Intronic
944759702 2:202801801-202801823 CCACAATTCTACATTAAAATAGG + Intronic
944817593 2:203394060-203394082 TCAGAGTTCAACATTTACAAAGG - Intronic
945078278 2:206062657-206062679 CCAGAATTCAACATTTATATAGG + Intronic
945729355 2:213514306-213514328 CAAGAATGCAACATTTATTTAGG - Intronic
945809956 2:214536865-214536887 CAAGTATTAAACATTTATTTAGG - Intronic
1169647616 20:7831389-7831411 CAAAAATTGAACTTTTATATTGG + Intergenic
1169889989 20:10442094-10442116 CCAGATTTCAAATTTTATCTAGG - Intronic
1170320962 20:15097388-15097410 CCAAAATATAACATTTATCTTGG + Intronic
1170361993 20:15556307-15556329 CCTAAATCCATCATTTATATTGG - Intronic
1172288959 20:33761562-33761584 CCAGAAGTCCTCATTTAAATGGG + Intronic
1173377643 20:42502693-42502715 CCAGACATAAACATTTATGTTGG + Intronic
1177216418 21:18135561-18135583 CAAGAATTAAAAATTGATATAGG - Intronic
1177809284 21:25907852-25907874 CTAAATTTCAACATTTAAATTGG + Intronic
1177874754 21:26618442-26618464 CCAGAAATGAACATTTTTAAAGG - Intergenic
1178177676 21:30122712-30122734 CAGGAAGTCAACATTTATTTGGG + Intergenic
1182851119 22:33475168-33475190 CCAGTATTCATCTTCTATATGGG - Intronic
952021494 3:29026792-29026814 CCAAAATTCAACATTAAAAAAGG + Intergenic
953682112 3:45047407-45047429 CCAGAGTTTACCATTTAAATAGG + Intergenic
955359071 3:58257272-58257294 CAAGAATTGTACATTTTTATGGG + Intronic
957460228 3:80508507-80508529 CCATCATTCAACATTCATTTGGG - Intergenic
957460480 3:80512027-80512049 CCAGAAGTCACCATTATTATAGG + Intergenic
957579325 3:82050479-82050501 CCAGAATTCAAATTTTGAATTGG - Intergenic
957926297 3:86817191-86817213 CCCAACTTCAACATTTATAATGG + Intergenic
958260644 3:91376781-91376803 GCAAAATGCAAAATTTATATTGG - Intergenic
959002457 3:100980469-100980491 CCAGTATTCACTATTAATATGGG + Intronic
959734641 3:109644359-109644381 CCAGAATTTAATTTTTAAATTGG - Intergenic
961123007 3:124389798-124389820 CAAGAATTTAAGATTGATATGGG + Intronic
963100579 3:141599520-141599542 CCAGAATACAACATTGCTTTTGG - Intronic
964632309 3:158825084-158825106 CCACAGTTCAACATGTATTTGGG + Intronic
965190687 3:165524542-165524564 CCAGAATTAATCAAGTATATTGG + Intergenic
968390623 4:190026-190048 CAGGAATTCTATATTTATATAGG + Intergenic
969950543 4:10831057-10831079 TTAGAATTCCACATTTATCTGGG - Intergenic
970080211 4:12274940-12274962 ACAGAATGGAACATTTATTTTGG - Intergenic
970236888 4:13967885-13967907 CCATTATTCAACAATTATACTGG - Intergenic
970625085 4:17868355-17868377 ACTGAATTCAAAATTTTTATGGG + Intronic
971064835 4:23019527-23019549 CCAGAATTCCAGATTAATGTTGG + Intergenic
971382742 4:26114156-26114178 ACAGAATTAAACATGTATGTGGG + Intergenic
972446259 4:39146953-39146975 ACAGAATTGAACAAATATATTGG + Intergenic
972932827 4:44095062-44095084 CCAGGATTCATCATTTATTGGGG - Intergenic
974168992 4:58241782-58241804 TCAGAATTTTACATTTATTTTGG + Intergenic
975055301 4:69923241-69923263 CATGAATTAAACTTTTATATTGG - Intergenic
976076836 4:81308697-81308719 CCAGAATTTAATATTTGGATTGG + Intergenic
976347361 4:84020078-84020100 CCATAATTGAATAGTTATATAGG - Intergenic
977573039 4:98649342-98649364 CCAGAATAAGACATTTAAATGGG + Intronic
977790511 4:101095340-101095362 CCAGAATATAACATTTATTCTGG + Intronic
978036320 4:103999910-103999932 CCAAAATTCAAATTTAATATTGG - Intergenic
979431228 4:120634079-120634101 CCAGAAATCCACATGTATATAGG + Intergenic
982884128 4:160756692-160756714 CCTTTATTGAACATTTATATGGG + Intergenic
983271302 4:165565085-165565107 ACAGAATTCAACAAATATTTAGG - Intergenic
984108909 4:175584156-175584178 CCATAATTAAACATATATTTGGG - Intergenic
984434224 4:179687561-179687583 GCAGAATTCAGCATTATTATTGG + Intergenic
985019052 4:185668497-185668519 CAATAATTCAACAGTTATACTGG + Intronic
988339426 5:29950662-29950684 CCTGTATTTAATATTTATATTGG + Intergenic
989014018 5:36908036-36908058 CCAGAAATGAACAAATATATTGG - Intronic
989186279 5:38629897-38629919 CCAATATTCAACATTCATAAAGG - Intergenic
989560356 5:42843156-42843178 TCAGCGTTCAACATTTTTATTGG + Intronic
989751760 5:44903442-44903464 CCAGAATTTAAAATCTATTTTGG - Intergenic
990443348 5:55868708-55868730 CCAGCATTGAACATTTTTAATGG - Intronic
990812587 5:59745958-59745980 CCAGGTTTTAACATTTATACAGG - Intronic
991502710 5:67293058-67293080 CCACAATTCACCATTTATGCAGG + Intergenic
994423633 5:99556601-99556623 GAATAAGTCAACATTTATATTGG + Intergenic
994602937 5:101930007-101930029 GCAGACTTCAACATTTTTGTAGG + Intergenic
995321715 5:110841836-110841858 ACAGAATTCTCCATTTATTTTGG + Intergenic
995338666 5:111031553-111031575 CCAATATTCAACATTTTTAAAGG + Intergenic
995971694 5:117979779-117979801 GAAGAATTCAGTATTTATATGGG - Intergenic
996842276 5:127860461-127860483 CAAGAATTGAACATTTCTGTTGG - Intergenic
997776651 5:136614633-136614655 CAAAAATTCAACAATTATTTGGG + Intergenic
998828091 5:146126083-146126105 CCAGGATTCAACATTTGTATAGG - Intronic
1000141351 5:158406492-158406514 CCAAAATTCAAAATTTCTAAAGG - Intergenic
1001821464 5:174713550-174713572 CCAGGATTCCAGATTTCTATGGG + Intergenic
1003133346 6:3414253-3414275 CCAGAAATCTACATTGAAATAGG - Intronic
1003362538 6:5442272-5442294 CAGGAATTCTACATTTATATCGG + Intronic
1004399789 6:15277945-15277967 CCAGAGTTCACCTTTTTTATGGG - Intronic
1004838409 6:19555000-19555022 CCAGATTTCAAGATTTAGATTGG - Intergenic
1004963120 6:20814937-20814959 CCAGATCTCAACATATAGATGGG - Intronic
1005704053 6:28433957-28433979 CTATAAATCTACATTTATATAGG + Exonic
1006870211 6:37244475-37244497 CGAGACTTCAACATGTTTATAGG - Intronic
1007453275 6:41956683-41956705 CCAGAATCCAAGATGTATATAGG - Intronic
1007819416 6:44549886-44549908 CAAGAATGCATCATTTATTTGGG - Intergenic
1008994569 6:57643617-57643639 GCAAAATGCAAAATTTATATTGG + Intronic
1009566066 6:65312859-65312881 CCAGAATTTAACTTTGAGATTGG - Intronic
1011464377 6:87640179-87640201 CCAGGTTTCAACAGTTTTATTGG - Intronic
1011780364 6:90782580-90782602 CTGGAATTCAGCATTAATATGGG - Intergenic
1011905923 6:92367232-92367254 TCAAAATTCAACATATTTATAGG + Intergenic
1011962784 6:93112201-93112223 CCAGATTTCCATATTTTTATAGG + Intergenic
1012659390 6:101868070-101868092 CCAGAAGTCTCCATTTATAGAGG - Intronic
1012978428 6:105804888-105804910 CCAGATTCTTACATTTATATAGG - Intergenic
1014283596 6:119468975-119468997 CCAGAATTTAAAGTTTATTTGGG + Intergenic
1014319795 6:119912995-119913017 CCAGGCTTGAACATTTATATTGG + Intergenic
1014848498 6:126310398-126310420 TCAGAATTAAAAATTTATATTGG - Intergenic
1015050258 6:128831287-128831309 CCAATATTCAACATTCATAAAGG + Intergenic
1016627092 6:146184061-146184083 CAGGAATTCAATATTTAAATGGG + Intronic
1017743213 6:157425545-157425567 CCAAAATTCAGCATTTAGAAAGG - Intronic
1021181121 7:17507145-17507167 CTAGATTTCAACAATTTTATAGG - Intergenic
1022939042 7:35213447-35213469 CCAAAATTCAAAAGTTATACAGG - Intronic
1025535415 7:61941750-61941772 TCAGAGTTAAACATTTATTTTGG + Intergenic
1025604261 7:63027965-63027987 CCAGAAATCAACAATTTGATGGG + Intergenic
1027278552 7:76588081-76588103 TCAGATTTCAACATATATTTTGG + Intergenic
1027403061 7:77828646-77828668 TCAAAATACAAAATTTATATAGG + Intronic
1027778013 7:82491045-82491067 CCAAAATTCAACATTCTTAAAGG - Intergenic
1027928312 7:84496855-84496877 CAAGAATTCAACAAATATTTGGG + Intergenic
1028096061 7:86762671-86762693 CCAGAAGTCAACAGTTTGATTGG + Intronic
1028728796 7:94121033-94121055 CCAGAAGTCAACATTTAGATTGG + Intergenic
1030261309 7:107567122-107567144 CCAGAATGAAACATTTCTATGGG - Exonic
1030724403 7:112908792-112908814 TCAGAATTCAACTGTCATATAGG - Intronic
1031176971 7:118364877-118364899 CTAAAATTCAAAAATTATATTGG + Intergenic
1031197225 7:118630883-118630905 CCAGAATTCCACATGTATTCTGG - Intergenic
1034035755 7:147819413-147819435 ACAGAATTCATTATTTAGATGGG - Intronic
1034250190 7:149684260-149684282 CCAGAATTCAGCATGAAAATAGG - Intergenic
1038364533 8:26917574-26917596 CCAGATTTTTACATATATATGGG + Intergenic
1039927055 8:41944484-41944506 CCACAGTTCCACACTTATATTGG - Intronic
1041342162 8:56857396-56857418 CAAGAATTTATCTTTTATATGGG - Intergenic
1041551318 8:59104576-59104598 CTATAATTCAACATTTAAATTGG - Intronic
1042280572 8:67051999-67052021 AAGGAACTCAACATTTATATGGG + Intronic
1043341663 8:79247361-79247383 CCAGAATGCAATATTTGTTTCGG - Intergenic
1043649583 8:82574533-82574555 CCAGAATACAGGATTTAAATTGG + Intergenic
1044063535 8:87669515-87669537 CCAGACTAAAACATTAATATTGG + Intergenic
1046620959 8:116529137-116529159 ACAGAATTGAACATTCAGATAGG - Intergenic
1046711180 8:117513249-117513271 TCAGAATTCAGCCTTTATATAGG + Intergenic
1052172621 9:25420054-25420076 CAAGAATTCATCATAAATATGGG + Intergenic
1052564324 9:30128199-30128221 CCAGATTTTAAAATTTATCTTGG + Intergenic
1053726552 9:41007828-41007850 CTAGAGTCTAACATTTATATTGG + Intergenic
1054339391 9:63843968-63843990 CTAGAGTCTAACATTTATATTGG - Intergenic
1055887522 9:81081565-81081587 GCAGAAGTCTTCATTTATATTGG + Intergenic
1056424316 9:86461509-86461531 CCAATATTCAACATTTTTTTTGG + Intergenic
1058756642 9:108088823-108088845 TCAGGATTCGACATTTATTTTGG - Intergenic
1059389409 9:113989357-113989379 CCAGAAATGAACATTTTGATGGG + Intronic
1059666462 9:116450840-116450862 CTAGAATTAAATATTTATGTTGG - Intronic
1187706820 X:22017514-22017536 TCAGATTTCAAAATTTATAAAGG + Intergenic
1188046763 X:25434243-25434265 CCTGAATCCAACACTTACATGGG + Intergenic
1188611884 X:32110215-32110237 GCAGAATTAAACATTTAAAGTGG - Intronic
1188836142 X:34956711-34956733 GCAGAACTAAACAGTTATATTGG + Intergenic
1189617892 X:42802966-42802988 AAGGAATTCAACATTTATCTAGG + Intergenic
1189700462 X:43713496-43713518 CTAGTATTCCACATCTATATGGG - Intronic
1190640521 X:52479644-52479666 GCTGACTTCAAAATTTATATGGG - Intergenic
1190647151 X:52533221-52533243 GCTGACTTCAAAATTTATATGGG + Intergenic
1190649286 X:52553401-52553423 GCTGACTTCAAAATTTATATGGG + Intergenic
1190754896 X:53392840-53392862 CCAGAATTCAATAGATATTTAGG - Intronic
1190754963 X:53393853-53393875 CCAGAATTCAATAGATATTTAGG + Intronic
1191013225 X:55783250-55783272 CCAGGATTACACATTTATGTTGG - Intergenic
1191192950 X:57686074-57686096 CCAATATTCAACATTTTTAAAGG + Intergenic
1195496869 X:105546364-105546386 CGAGAATTCCATATTTATTTAGG + Intronic
1197532628 X:127648961-127648983 ACAGAATTCAACATGTACAAAGG + Intergenic
1198341993 X:135723615-135723637 ACAGATTTCAACATTGAGATCGG - Intergenic
1198346002 X:135759748-135759770 ACAGATTTCAACATTGAGATCGG + Intergenic
1198347905 X:135777032-135777054 ACAGATTTCAACATTGAGATCGG + Intergenic
1198349810 X:135794294-135794316 ACAGATTTCAACATTGAGATCGG + Intergenic
1198351714 X:135811570-135811592 ACAGATTTCAACATTGAGATCGG + Intergenic
1198353624 X:135828836-135828858 ACAGATTTCAACATTGAGATCGG + Intergenic
1198355530 X:135846088-135846110 ACAGATTTCAACATTGAGATCGG + Intergenic
1198357440 X:135863367-135863389 ACAGATTTCAACATTGAGATCGG + Intergenic
1198359353 X:135880654-135880676 ACAGATTTCAACATTGAGATCGG + Intergenic
1199476358 X:148250073-148250095 ACAGAATTCAGCATTTATGTTGG - Intergenic
1201405392 Y:13644599-13644621 CCAAAATTCAACATTCTTAAAGG + Intergenic
1201533331 Y:15016820-15016842 CCAAAACACAACATTTATCTGGG - Intergenic
1201561318 Y:15320608-15320630 CCAAAATTCAACATTTTTAAAGG - Intergenic