ID: 945080084

View in Genome Browser
Species Human (GRCh38)
Location 2:206079762-206079784
Sequence CTGTGTTAGGGGAAGGAGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 386
Summary {0: 1, 1: 0, 2: 3, 3: 27, 4: 355}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945080084_945080090 -5 Left 945080084 2:206079762-206079784 CCAAACTCCTTCCCCTAACACAG 0: 1
1: 0
2: 3
3: 27
4: 355
Right 945080090 2:206079780-206079802 CACAGAAACTCCTTAGGACCTGG 0: 1
1: 0
2: 0
3: 14
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945080084 Original CRISPR CTGTGTTAGGGGAAGGAGTT TGG (reversed) Intronic
900500524 1:3002322-3002344 CGGTGTCAGAGGAAGGAGCTGGG - Intergenic
901087756 1:6622001-6622023 CTGTGTTGGGGAGAGGTGTTCGG + Exonic
901915434 1:12495900-12495922 CGGGGTTGGGGGAAGGAGCTTGG - Intronic
902456711 1:16538826-16538848 CAGTGCTTGGGGAGGGAGTTGGG - Intergenic
902495457 1:16869085-16869107 CAGTGCTTGGGGAGGGAGTTGGG + Intronic
902682317 1:18052077-18052099 GTGTGTTAGGGGAAGGAGTAGGG - Intergenic
902970092 1:20042142-20042164 CTGAGTTAAGGCAATGAGTTTGG + Intronic
903143769 1:21356499-21356521 CTCTGTTGGGGGAAAGAGCTTGG - Intergenic
903291180 1:22315271-22315293 CCATCTTAGGGGAAGGAGCTGGG + Intergenic
906183237 1:43839562-43839584 CTGTCTCTGGGGAAGGAGTCTGG - Intronic
906528255 1:46508912-46508934 CTGGGGCAGGGGAAGGAGTGGGG - Intronic
907358249 1:53894085-53894107 CCGGGTCAGGGGAAGGAGTCAGG - Intronic
908230592 1:62100916-62100938 CTTTATCAGGGGAGGGAGTTAGG + Intronic
908535651 1:65074534-65074556 ACGTGTTAGGGGAAGGAAATGGG - Intergenic
908820519 1:68081387-68081409 CAATGTTGGGGGATGGAGTTTGG + Intergenic
909295665 1:73945132-73945154 CTGTGTTAGAGGAAGATTTTTGG - Intergenic
909857683 1:80559877-80559899 CATTGTTAGGGGAGGGAGTGGGG - Intergenic
910002500 1:82356767-82356789 CTGAGTTAAGGCAATGAGTTTGG + Intergenic
911612814 1:99975709-99975731 CTGTTTTATGTGAAGGAGTTTGG + Intronic
912137479 1:106679661-106679683 CTGTGTTTGGGGAAAGGATTTGG - Intergenic
913095444 1:115511791-115511813 CTGAGTTAAGGCAATGAGTTTGG + Intergenic
913661957 1:121012469-121012491 CAGTGCTTGGGGAGGGAGTTGGG - Intergenic
914651956 1:149704263-149704285 CAGTGCTTGGGGAGGGAGTTGGG - Exonic
914732830 1:150387366-150387388 GTGTGTTAGGGAAAGGAGAGAGG + Intronic
914847730 1:151292193-151292215 CTGGGTTTGGGGAAGGAGTCAGG + Exonic
915552926 1:156645585-156645607 CTGGGTTCGAGGAAGGAGTCTGG + Intronic
915910926 1:159914851-159914873 CTGTGGTCGGGGAAGGGGTGTGG + Intergenic
916815195 1:168344926-168344948 CTGTCTTAGGGCAATCAGTTGGG + Intergenic
917745605 1:178003825-178003847 CTGTGTTTGTGGAGGGAGTGTGG + Intergenic
918003917 1:180524269-180524291 CTTTGCTAGGGGAATGAGCTAGG + Intergenic
919871246 1:201823133-201823155 CTGTGGTGAGGGATGGAGTTGGG - Exonic
920349298 1:205327350-205327372 CTGTGTTAAGGGAGGGAGGAAGG + Intergenic
921205418 1:212844649-212844671 CTGAGTTAAGGCAATGAGTTTGG - Intronic
923056360 1:230428437-230428459 CTGTGGTAAGAGAAGGAGTGAGG + Intergenic
924089217 1:240485583-240485605 GTGTGTTAGGGGTAGGTGTGGGG - Intergenic
924237598 1:242012209-242012231 ATGTGTTGGGTGAAGGAGTCTGG + Intergenic
924329541 1:242928079-242928101 CTGAGTCATGGGAGGGAGTTTGG + Intergenic
1064205417 10:13319893-13319915 CTGTGTAGGGGTAAGGTGTTTGG + Intronic
1064321241 10:14306984-14307006 CTATGTTAGGAGTAGGAGTGTGG - Intronic
1067043930 10:42974150-42974172 CTCAGTTTGGGGAAGGAGCTGGG + Intergenic
1067552641 10:47246319-47246341 CTGTGTTTGGGAAGGGAGCTGGG + Intergenic
1067819016 10:49510399-49510421 ATATGTAAGGGGAAGGATTTGGG - Intronic
1068067261 10:52147606-52147628 TTGTGTTTGGGGAAAGAGTAGGG + Intronic
1069051743 10:63802574-63802596 CTGTTTTACAGGGAGGAGTTGGG + Intergenic
1069904844 10:71726217-71726239 CTGGTTTAGGGGAAGGGGCTGGG - Intronic
1070441725 10:76452659-76452681 TTATGTTGGGGTAAGGAGTTTGG + Intronic
1070805692 10:79269440-79269462 GTGTGTTGGGGGGAGGTGTTGGG - Intronic
1070985506 10:80686566-80686588 CTGTGTTAGGGAAAGCATATAGG + Intergenic
1072815869 10:98508764-98508786 CTGTGAGATGGGAAGGAGTTTGG + Intronic
1075079326 10:119372146-119372168 CTGAGCTAGGGGATGGAGGTAGG + Intronic
1075604746 10:123796514-123796536 CAGTGTGAGGGTAAGCAGTTAGG + Intronic
1075677746 10:124307998-124308020 CTGTGTCTGGGGAAGGTGTCAGG + Intergenic
1077334141 11:1995999-1996021 CTGTGGATGGGGAAGGAGTGAGG + Intergenic
1077355313 11:2114175-2114197 CTGAGTTTGGGGCAGGAGGTGGG - Intergenic
1077887022 11:6394082-6394104 GTGGGATAGGGGAAGGAGGTTGG + Intronic
1078928582 11:15895925-15895947 CTGTGTTCAGGGAGGGAGTGAGG + Intergenic
1079446581 11:20562245-20562267 CTGTGCTTGGGGCAGGAGGTTGG - Intergenic
1080055263 11:27900370-27900392 CTGTTTTAAGGGAAGAAGTGTGG - Intergenic
1081298046 11:41416047-41416069 CTAGGTTTGGGGAAGGAGATAGG + Intronic
1081562458 11:44230315-44230337 CTGTGACATGTGAAGGAGTTCGG + Intronic
1081622832 11:44629055-44629077 CTGAGGGAGGAGAAGGAGTTAGG - Intergenic
1083048011 11:59754066-59754088 ATGTGTTAGGGGAAGGAGGTGGG + Intronic
1083363485 11:62127748-62127770 CTGTGTTTGGGCAGGGAGTGAGG + Intronic
1083679103 11:64343092-64343114 CAGGCTGAGGGGAAGGAGTTTGG + Intronic
1083816248 11:65134074-65134096 CTGTGTTAGGGTGGGCAGTTCGG + Intronic
1083904530 11:65661563-65661585 CTGAGTCAGGGCAAGGAGTGAGG + Intronic
1086669926 11:89533868-89533890 CTGTTTCAGGGGAAGGATGTGGG - Intergenic
1086989809 11:93290481-93290503 CTTTCTTGTGGGAAGGAGTTGGG + Intergenic
1087091990 11:94283177-94283199 CTGGGTTAGGGGAGGGAATGTGG - Intergenic
1087256477 11:95960569-95960591 CTGTGTTCGAGGAAAGAATTTGG - Intergenic
1089581875 11:119486532-119486554 GTGTGTTAGGGGAGGGGGGTAGG + Intergenic
1089696121 11:120217259-120217281 CTGGGTGAGGGGGATGAGTTTGG + Intronic
1090205020 11:124879304-124879326 CTGTGCTAGGGGCAGGACTGGGG - Exonic
1090908081 11:131094750-131094772 CTGTGGAAAGAGAAGGAGTTGGG + Intergenic
1202817124 11_KI270721v1_random:51181-51203 CTGTGGATGGGGAAGGAGTGAGG + Intergenic
1091693974 12:2615931-2615953 CTGTGTGGAGGGGAGGAGTTAGG - Intronic
1091748722 12:3009771-3009793 CTGTGTCAGAGGAAGGAGTGGGG - Intronic
1091761711 12:3091860-3091882 CTGTGTTGGAGGAGGGAGTATGG + Intronic
1092534776 12:9377708-9377730 GTGGATTAGGGGAAGGAGCTTGG - Intergenic
1092626086 12:10330310-10330332 CTGTGCTGGGGGCAGGAATTAGG + Intergenic
1093423291 12:18999377-18999399 CTGTGTTTGGTGTTGGAGTTTGG + Intergenic
1093534855 12:20210432-20210454 CTGTGCTGGGAAAAGGAGTTTGG + Intergenic
1094043383 12:26141263-26141285 CTGTGTTTGGGGATGGAGGAAGG + Intronic
1096912494 12:54998261-54998283 CTGTGATAGAGGATGGAGCTGGG - Intergenic
1097040467 12:56153214-56153236 TTGTTTTAGGGGCAGGAGTGGGG - Intronic
1098396945 12:70029048-70029070 ATGTGTTTGGGGATGGGGTTAGG + Intergenic
1098773160 12:74580691-74580713 CTATGTTTGAGGAAAGAGTTTGG - Intergenic
1099096490 12:78380292-78380314 TTGTGTTTGGGGAAGGAGGAAGG - Intergenic
1100772192 12:97935668-97935690 CTGTTCTAAGGGAAGGATTTAGG + Intergenic
1100892814 12:99145056-99145078 TTGTTTCAGGGGAAGAAGTTTGG + Intronic
1101931762 12:109020697-109020719 CTGTTTCAGAGGAAGGAATTAGG - Intronic
1102562252 12:113770471-113770493 CAGTGCTTGGGGAAGGAGTAGGG - Intergenic
1102724279 12:115045248-115045270 CTGTGTGAGGGAAGGGATTTTGG + Intergenic
1102788822 12:115626498-115626520 CTGTGTTTAGGGATGGAATTTGG - Intergenic
1103733422 12:123043425-123043447 CAGCGTTAGAGGAAGGAGTCAGG - Intronic
1105942853 13:25165569-25165591 CTGGGTTAGGTGAAGTATTTGGG + Intronic
1106463851 13:29995510-29995532 GTGTGTGAGGGGCAGGAGGTGGG + Intergenic
1106810446 13:33353400-33353422 CTGTGTCAGAGGAAGGAAATGGG - Intergenic
1107186660 13:37530082-37530104 CTGTGGAAGGTGAGGGAGTTGGG + Intergenic
1107246952 13:38308253-38308275 CTGTTTTGGGGGTAGGATTTGGG - Intergenic
1107719118 13:43229517-43229539 GTGTGCCAGGGGAAAGAGTTTGG + Intronic
1107832260 13:44385030-44385052 CTGTCTTCTGGGAAAGAGTTAGG + Intronic
1108092197 13:46860426-46860448 TTGTGTCAGGGTTAGGAGTTAGG + Intronic
1108413835 13:50177485-50177507 GTGTGTTGGGGGTAGGAGGTGGG + Intronic
1108626049 13:52229780-52229802 CTGAGTTAGAGGAAGGTGTGTGG + Intergenic
1108660014 13:52576699-52576721 CTGAGTTAGAGGAAGGTGTGTGG - Intergenic
1110248637 13:73356532-73356554 CTGAGCCAGGGTAAGGAGTTTGG + Intergenic
1110479660 13:75959542-75959564 CTGAGTCAGGGGAAGGAGGCTGG + Intergenic
1112906845 13:104433103-104433125 CAGTGTAAGGGAAAGAAGTTGGG + Intergenic
1113770336 13:112904174-112904196 CTGGGGTAGGGGTAGGTGTTAGG + Intronic
1115305258 14:31927372-31927394 CAGTGGAAGGAGAAGGAGTTGGG - Intergenic
1116023538 14:39489105-39489127 ATGTGTTAGAGGAAGGAGGGCGG - Intergenic
1118074107 14:62279795-62279817 CTTTGTTTGGGGAGGTAGTTTGG + Intergenic
1118261409 14:64250708-64250730 CTGAGTTCGGGGAAGGAGGAGGG - Intronic
1118755876 14:68843491-68843513 GTGTGTTTGGGGAGGGAGTAGGG - Intergenic
1118877332 14:69796617-69796639 CTGGGATGGGGGCAGGAGTTGGG - Intronic
1119776695 14:77253474-77253496 CTGGGTATGGGGAAGGAGATGGG + Intronic
1119926794 14:78502215-78502237 CTGTGCTGGGAGAAGGAGCTGGG - Intronic
1120482975 14:85075668-85075690 CTGTGTTAAGGCAGTGAGTTTGG - Intergenic
1126968486 15:54083415-54083437 CTGTGTAGGGAGAGGGAGTTGGG + Intronic
1128257211 15:66205787-66205809 CTCTGGCAGGGGAAGGAGGTGGG - Intronic
1128702526 15:69814584-69814606 CTGTGTGCTGGGAAGGTGTTAGG - Intergenic
1128992730 15:72273902-72273924 GAGTGGTAGGGGAAGGAGTCAGG + Intronic
1130055399 15:80519615-80519637 CTGTTTTAGGGTAAAGATTTGGG + Intronic
1131888761 15:96949286-96949308 ATGTGTTTGGGGAAGGAATGTGG + Intergenic
1132752293 16:1464347-1464369 CTTTGGGAGGGGCAGGAGTTGGG - Intronic
1133000229 16:2846990-2847012 TTATGTTAGGGGAAGGAGGAGGG - Intergenic
1135256781 16:20947509-20947531 CTGGGTTGGGGGAAAGAATTGGG + Intronic
1136530245 16:30863303-30863325 CTGAGTTAAGGCAATGAGTTCGG - Intronic
1138212238 16:55173305-55173327 CTGTGAAGGGGGAAGGAGTGGGG + Intergenic
1138249097 16:55488796-55488818 CTGTCTTGGGGAAAGGAGGTGGG - Intronic
1141670217 16:85487737-85487759 CGGTGGTGGGGGAAGGAGGTGGG + Intergenic
1141719575 16:85748664-85748686 CTGGGTTACGATAAGGAGTTTGG + Intronic
1142523023 17:518370-518392 CTGTGTTATGAGAAGGAGTCTGG - Exonic
1142720697 17:1773835-1773857 CTGGGGTAGGGGGAGGGGTTGGG + Intronic
1144839850 17:18179179-18179201 CTGTGTCATAGGCAGGAGTTAGG - Exonic
1146665277 17:34698116-34698138 GTGTGTTGGGGAAAGGGGTTTGG - Intergenic
1147262583 17:39217289-39217311 CTGTGTGAGGGGTAGGTGCTGGG - Intronic
1147452075 17:40511965-40511987 GTGGGTGGGGGGAAGGAGTTGGG + Intergenic
1147654507 17:42081162-42081184 CTGGGTTAGGGGAAGAAGGATGG + Intergenic
1149436262 17:56636046-56636068 CTGAGTTTGTTGAAGGAGTTGGG - Intergenic
1150267016 17:63838334-63838356 CTGTCATAGGGGTAGTAGTTGGG - Intronic
1150636324 17:66915706-66915728 GTGTGTGAGGTGGAGGAGTTAGG - Intergenic
1151747394 17:76018777-76018799 CTGAGTCAAGGGAAGGAGTAGGG + Intronic
1151898603 17:76996982-76997004 GTGTGTCAGGGCAAGGAGATGGG - Intergenic
1153405395 18:4733054-4733076 CAGTCTTAGGGGAAGGAGAAGGG - Intergenic
1156109536 18:33708575-33708597 CTGTGGTGGGGGATGGACTTGGG + Intronic
1157100578 18:44725428-44725450 CTGGGTTTGGGGAAGTAGTTAGG + Intronic
1157411297 18:47465540-47465562 CAGTGTTGGAGGAAGGAGCTGGG - Intergenic
1157637325 18:49171362-49171384 GTGTGTTAGAGGAAGGACTGAGG - Intronic
1158120741 18:54045796-54045818 TTGGGGTAGGGGAATGAGTTAGG - Intergenic
1158353411 18:56589135-56589157 TTGGGTTAGGGGCAGGAGATGGG + Intergenic
1158849611 18:61482315-61482337 CTGGGTTAGGGCAGGAAGTTGGG - Intronic
1158940257 18:62401047-62401069 GTTTTTCAGGGGAAGGAGTTGGG - Intergenic
1159828199 18:73241236-73241258 CTGTTTTAGGGGAAAGATCTTGG + Intronic
1160066433 18:75578885-75578907 CTGTAGAAGGGGAGGGAGTTAGG - Intergenic
1160681973 19:416017-416039 CTGTGTTTGTGGGAGGAGCTGGG + Intergenic
1161053838 19:2180083-2180105 CTGTGTTAGGCCAAGGACCTTGG + Intronic
1161416762 19:4151648-4151670 GTGTGTTGTGGCAAGGAGTTTGG - Intergenic
1162466973 19:10848304-10848326 GTGTGTTTGGGGAAGGGGTGGGG + Intronic
1164837702 19:31368376-31368398 CTGTTCTAGAGGAAGGACTTTGG - Intergenic
1165304198 19:34993635-34993657 CTGAGTTGGTGGATGGAGTTAGG + Intergenic
1165453784 19:35899667-35899689 CTGAGTCGTGGGAAGGAGTTTGG - Intronic
1165818425 19:38658140-38658162 CTGTCCTCGGGGCAGGAGTTGGG + Intronic
1166096211 19:40541146-40541168 AGGTTTTAGAGGAAGGAGTTGGG + Intronic
1167517268 19:49930468-49930490 CTGTATTGGGGGAAGGGGTGGGG + Intronic
1167750164 19:51374631-51374653 CTGAGTTTGGGGATGGAGTTGGG - Intergenic
1168354171 19:55691789-55691811 CTGTGGTCGGGGCAGGAGCTGGG - Exonic
1168629213 19:57944111-57944133 ATGTGTGAGGGGAAGGATTATGG - Intronic
925329055 2:3044076-3044098 CTGTGTTTGGAGAGGGATTTAGG + Intergenic
925427830 2:3765529-3765551 CTGTGCTAGGTTAAGGAGTTTGG + Intronic
925433559 2:3817427-3817449 CTGAGTTAAGGCAATGAGTTTGG + Intronic
926027081 2:9555225-9555247 TTGTGTTCGGGGAGGGTGTTGGG - Intronic
926268594 2:11347213-11347235 GTGTGTTTGGGGCAGGATTTTGG - Intronic
926598485 2:14816140-14816162 CTGTGTAAGCTAAAGGAGTTTGG - Intergenic
926695503 2:15767727-15767749 CCATGTTAGGGGAAGGAGGGTGG - Intergenic
926948178 2:18211857-18211879 GTGTTTTAGGGTGAGGAGTTGGG - Intronic
928230904 2:29498251-29498273 CTGGGTTTGGGGGAGGAGGTTGG + Intronic
928392542 2:30920515-30920537 CAGTGTTAGCAGAAGGGGTTGGG + Intronic
928429200 2:31204020-31204042 CTGTTTTGGGGGTAGGAGGTTGG + Intronic
928493870 2:31812179-31812201 CTCTGTCAGGGCAAGGAGTGTGG - Intergenic
929500431 2:42486498-42486520 GTGTGCCATGGGAAGGAGTTTGG - Intronic
930713056 2:54567277-54567299 CCCTGTTAGGTAAAGGAGTTTGG + Intronic
931321553 2:61177968-61177990 CTGTGTTAGGGGCGGGGGTATGG + Exonic
931422720 2:62143072-62143094 CTGTTTTAAGGGAGGGATTTTGG - Intronic
931486645 2:62700425-62700447 CTATGTTGGGGGAAGGGGATGGG + Intronic
931805150 2:65797006-65797028 CTGTGCTAAAGGAAGGAGTGGGG + Intergenic
932219223 2:69987147-69987169 CTGAGTGAGGGGAAGGCATTGGG + Intergenic
932539133 2:72633243-72633265 CTGGGATAGGGGTAGGAGGTTGG - Intronic
932594382 2:73085173-73085195 CTGTGGCAGCGGAAGGAGCTTGG - Intronic
938796810 2:134724563-134724585 CTATGTTAGTGTCAGGAGTTGGG - Intergenic
938890011 2:135694686-135694708 CTGAGTTAGGAGATGGAGTTGGG + Intronic
939363064 2:141198661-141198683 CTGTGCTAGAAGAAGGAATTGGG - Intronic
939728983 2:145757965-145757987 CTGTGCAAGAGGATGGAGTTTGG + Intergenic
941930523 2:170934554-170934576 CTGTGTTAGGGGATGAGGTAGGG - Intronic
942408054 2:175676415-175676437 CTGGGTTAGATGAAGGGGTTGGG + Intergenic
942528302 2:176880118-176880140 CTGTGTTGGGGCATGGGGTTGGG - Intergenic
942530521 2:176904965-176904987 ATGTGGTAGAGGAGGGAGTTGGG + Intergenic
944700487 2:202241419-202241441 CAGTGTTGGGGGAGGGACTTGGG + Intergenic
945080084 2:206079762-206079784 CTGTGTTAGGGGAAGGAGTTTGG - Intronic
945554979 2:211265543-211265565 CTGAGTTAAGGCAATGAGTTCGG - Intergenic
947538197 2:230954221-230954243 CTGTGTCAGGGGAAGGGGCAAGG - Intronic
948797418 2:240412080-240412102 CTGTGTGCGGGGAAGGAGAACGG - Intergenic
1168942999 20:1729367-1729389 CTGAGTTAAGGCAATGAGTTTGG + Intergenic
1169652789 20:7888347-7888369 TTGTGTTTGGGGGAGGGGTTGGG - Intronic
1169946236 20:10991956-10991978 TTGTTTTAGGGGAGGAAGTTTGG + Intergenic
1171431118 20:25083700-25083722 CTGGGTTTAGGGAAGGCGTTGGG + Intergenic
1174758180 20:53180622-53180644 CAGTGTTAGGAGAAGGATGTTGG - Intronic
1175295652 20:57907188-57907210 CTATGATTGGGGAAGGAGTGGGG - Intergenic
1175961524 20:62639283-62639305 CTGTGTTCAGGTGAGGAGTTAGG - Intergenic
1177528646 21:22332043-22332065 CTGTGTTAGTGCAAAGATTTTGG + Intergenic
1181629439 22:24142870-24142892 CTGACTTGGGGGAAGGAGTGAGG - Intronic
1182571104 22:31238718-31238740 CTCTGTAAAAGGAAGGAGTTAGG - Intronic
1183635323 22:39058690-39058712 CTGAGTTAAGGCAATGAGTTTGG + Intronic
1183752702 22:39731068-39731090 CTGTGCTAGGGGAGGGGGCTGGG + Intergenic
1184189643 22:42886162-42886184 CTGTGCTGGGGGCAGGACTTGGG - Intronic
1185214288 22:49589718-49589740 CTGTGCTGGGGGCAGGAGATGGG + Intronic
949421536 3:3871644-3871666 CTGGGTCAGGGGAAAGAGCTGGG - Intronic
949862741 3:8521404-8521426 CTGTCAAAGGGGATGGAGTTGGG - Intronic
950549968 3:13660280-13660302 CTGTGAAAGGGGCAGGTGTTGGG + Intergenic
952591065 3:34954253-34954275 CTGTGTATGGGGAAGGAGATAGG + Intergenic
953418812 3:42739344-42739366 ATGTATTGGGGGAAGGAGGTGGG - Intronic
954055113 3:48016694-48016716 CTGTGTTAGAGGAAGGAAGTGGG - Intronic
954878416 3:53818284-53818306 CTGTCTGAGGGGATGGTGTTTGG + Intronic
955770362 3:62378809-62378831 ATGTGATAGCGGAGGGAGTTGGG - Intergenic
956787811 3:72656839-72656861 CTGGGGTGGGGAAAGGAGTTGGG - Intergenic
957451722 3:80388966-80388988 CTGAGTTAAGGCAATGAGTTCGG - Intergenic
959134930 3:102405889-102405911 CTTTGTTAAGTGAAAGAGTTGGG + Intronic
959504128 3:107139297-107139319 CTGAATTAGGGGATGGAGTGTGG + Intergenic
960616929 3:119604603-119604625 CTGAGAAGGGGGAAGGAGTTGGG + Intronic
961220204 3:125193699-125193721 CTGCCTCAGGGGAAGGAATTGGG - Intronic
961393536 3:126570608-126570630 CTGTGTGAGGGGAGGCAGTGAGG - Intergenic
963010074 3:140760486-140760508 CTGTGTTGTGGGCAGGAGCTGGG + Intergenic
963111592 3:141693228-141693250 CTGAGTTAAGGCAATGAGTTCGG + Intergenic
965335434 3:167427073-167427095 CTGAGTTAAGGCAATGAGTTTGG - Intergenic
966398150 3:179522545-179522567 CTGAGTTAAGGCAATGAGTTCGG + Intergenic
967142798 3:186576356-186576378 CAGCATTAGGGGAAGGAATTAGG + Intronic
967992102 3:195139085-195139107 CAGTGTCAGGCTAAGGAGTTCGG + Intronic
968075957 3:195816262-195816284 CTGTGTAAGGAGAAGGAGGCCGG - Intergenic
968076144 3:195816953-195816975 CTGTGTAAGGAGAAGGAGGCCGG - Intergenic
968082535 3:195856735-195856757 CTGTGTTTGGGGGAGTGGTTCGG - Intergenic
968252247 3:197230396-197230418 ATGTGACAGGTGAAGGAGTTTGG - Intronic
971327243 4:25654743-25654765 CTGTGCAAGGGGAAGGACTCGGG - Intergenic
971975635 4:33682729-33682751 CTGTGTTACAGGGAGGAGTGTGG + Intergenic
973300586 4:48578683-48578705 CTGTGTTAAGGGAAAAAATTGGG - Intronic
973720094 4:53714715-53714737 ATGTGTTGGGGGAATGAGTAGGG + Intronic
974882284 4:67774618-67774640 CTGTGTTAGAGCAGGTAGTTAGG + Intergenic
977775163 4:100909533-100909555 TTTTGTTGGGGGAAGGAGTATGG + Intergenic
977990416 4:103434400-103434422 CTGTTTTAGGGCAAGGACTTTGG - Intergenic
980264944 4:130503261-130503283 GTGTGTTAGGGGACTGATTTGGG + Intergenic
981717758 4:147768465-147768487 CTGTGATGGGGCAAGGAATTTGG - Intronic
981923525 4:150113248-150113270 CTGGGTTAATGGAATGAGTTAGG + Intronic
982308141 4:153955055-153955077 CTGTGTCAGCAGAATGAGTTGGG - Intergenic
983649254 4:170022416-170022438 CAGTGTCATGTGAAGGAGTTTGG - Intronic
984002839 4:174271557-174271579 CTGAGTGAGGGAAAGGGGTTGGG - Intronic
984093624 4:175407404-175407426 GTGCATTAGGGGAAGTAGTTAGG + Intergenic
984637979 4:182134416-182134438 CTGAGTTAGGGGAAAGAGAAGGG - Intergenic
986160715 5:5225961-5225983 CTGTTTTAGGGTAAAGATTTGGG + Intronic
986485870 5:8236353-8236375 CTGTTTTGGGGGAAGGAGGAGGG - Intergenic
986591981 5:9380378-9380400 CTGTGTTTGCGCAAGGGGTTAGG - Intronic
987226852 5:15850963-15850985 CTAGGAGAGGGGAAGGAGTTGGG - Intronic
987803790 5:22734604-22734626 CAGTGTTTGGAGAAGAAGTTGGG - Intronic
988995972 5:36715267-36715289 GCATGTTGGGGGAAGGAGTTGGG - Intergenic
989662740 5:43816649-43816671 CAGTGTTAGAGGAAGGGGTCTGG + Intergenic
989688592 5:44115964-44115986 CTGAGTTAAGGCAATGAGTTTGG + Intergenic
989786579 5:45339529-45339551 CTGTGTCATATGAAGGAGTTTGG + Intronic
990123475 5:52485088-52485110 CTGTGTTTGGGGTAGGTTTTTGG - Intergenic
992850122 5:80798374-80798396 CTGAGATAAGGGAAGGAATTGGG - Intronic
993050973 5:82925500-82925522 GTGTGTTAGGGGAAGTTGTCAGG + Intergenic
994335720 5:98563477-98563499 CTGTGTTTGGGGATGGAGAAAGG - Intergenic
994675321 5:102814023-102814045 CTGTGGTAGGGGCAGGAGACTGG + Intronic
997602944 5:135152693-135152715 GTGTGTTGGTGGAAGGAGTTGGG + Intronic
997860187 5:137409002-137409024 GTGTGTTTGGGGAAGGGGTTTGG - Intronic
998593547 5:143503242-143503264 CAGGGTGAAGGGAAGGAGTTTGG - Intergenic
999885810 5:155921381-155921403 AGGTCTTAGGGGAAGGAGATGGG + Intronic
1000137412 5:158366038-158366060 CTGTGTCAGGGGCAAGACTTGGG + Intergenic
1001024273 5:168210288-168210310 CTATGTTGGGGGAAGGAGAAGGG - Intronic
1001353969 5:171002625-171002647 CTGAGTTAAGGCAATGAGTTTGG + Intronic
1001503379 5:172256283-172256305 GTGTGTTGGGGGCAGGTGTTGGG - Intronic
1001914701 5:175549817-175549839 ATGTGTTTGTGGGAGGAGTTGGG - Intergenic
1001958712 5:175866660-175866682 CTGAGTTAGGGGCAGGGCTTTGG + Intronic
1003335851 6:5171502-5171524 GTGTGTTAGGGGAAGTGGTGGGG + Intronic
1003676585 6:8210324-8210346 CTTATTTAGGGGAAGGAGGTCGG - Intergenic
1003891293 6:10565977-10565999 CTGTGTTTGGTGAAGGTGCTGGG - Intronic
1004271219 6:14197483-14197505 CTGTGGAAGGGGAAGAAGTGTGG + Intergenic
1006098171 6:31669210-31669232 CAGTCTTATGGGAAGGAGTTGGG + Intronic
1006395088 6:33782051-33782073 CTGTGTTAGGGGAAGGCGACAGG - Intronic
1006461556 6:34162117-34162139 CTCTGATGGGGGAAGGAGTTGGG + Intergenic
1006475063 6:34248084-34248106 CTGATTTAGGGATAGGAGTTGGG - Intronic
1007947305 6:45838095-45838117 ATGTGTTAGGGGTGGGAATTAGG - Intergenic
1008375828 6:50790331-50790353 GTGTGAGAGGGGAAGGAGGTGGG - Intergenic
1009270080 6:61604050-61604072 TTGAGTTAAGGAAAGGAGTTTGG - Intergenic
1009544910 6:65009191-65009213 CTTTGGTAGGGAAAGGAGGTGGG - Intronic
1012334755 6:98041414-98041436 CTGTGTTAGGGGTTGGAGCTGGG - Intergenic
1012924308 6:105252170-105252192 TTGAGTTAGGGGAAGGGGTAGGG + Intergenic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1013418251 6:109943805-109943827 CTGTGTTATGGGAATAAGCTTGG - Intergenic
1013532273 6:111030815-111030837 CAGTGTTGTGGGAAGGAGTGTGG + Intergenic
1013564260 6:111341737-111341759 CTGTGCAAGTGGCAGGAGTTGGG + Intronic
1016318840 6:142819914-142819936 CTCTGTTAAAGGAAGGATTTCGG + Intronic
1016496155 6:144664227-144664249 TTGTGTCAGGGGAAGAAATTGGG + Intronic
1016511436 6:144847690-144847712 CTGTTTTAGGGTAAAGATTTGGG + Intronic
1017270124 6:152494577-152494599 CTGAGTTAAGGCAATGAGTTTGG - Intronic
1017694900 6:157004728-157004750 CGGTGTTAGGGGAGGGTGTTGGG + Intronic
1017964501 6:159252243-159252265 CTGTGTAAGAGGAAGAAGTATGG + Intronic
1018742357 6:166739862-166739884 CTGTGTTACGGAAAGGGGTTGGG - Intronic
1018965069 6:168478707-168478729 CTGTCTCAGGGAAAGGAGTCAGG + Intronic
1022115058 7:27253634-27253656 CTGTGTAAGAGAAAGGAGATGGG + Intergenic
1022186262 7:27972413-27972435 CTCTTTTAGGGGAAGGAGGATGG + Intronic
1022192132 7:28026692-28026714 CTGTGTTAGGGGCAAGAAATTGG - Intronic
1022623484 7:32009286-32009308 CTGAGTCAGGAGATGGAGTTGGG + Intronic
1024702847 7:51923577-51923599 ATGTCTTAGGAGAAGTAGTTAGG + Intergenic
1027336642 7:77157923-77157945 CTGTGCTATGGGTAGGAGATAGG - Intronic
1027675653 7:81154602-81154624 CTGTTTTAGGGTAAGGATCTTGG - Intergenic
1029104094 7:98160657-98160679 CTGATTTGGGGGAAGGAGTGTGG + Intronic
1029163292 7:98568343-98568365 TTGGGGTAGGGAAAGGAGTTGGG - Intergenic
1029594931 7:101532662-101532684 CAGAGTCTGGGGAAGGAGTTGGG - Intronic
1029779148 7:102713186-102713208 CTGTGCTATGGGTAGGAGATAGG + Intergenic
1031818365 7:126469093-126469115 CTTTATTAGGTGAAGGAGATGGG - Intronic
1032007559 7:128315226-128315248 CTGTGTTATGGGAAGGGGAATGG - Intronic
1032638427 7:133736825-133736847 CTGGGTTTGGGGAAAGAGTAGGG - Intronic
1034266312 7:149782775-149782797 CTGCGATAAGGGAAGGAGCTTGG - Intergenic
1035141213 7:156764059-156764081 CTTTGTTAGTGGAAAGTGTTAGG - Intronic
1035496910 7:159335864-159335886 CAGTGTTAGGGTTAGGGGTTAGG + Intergenic
1036753359 8:11456855-11456877 CTGAGTTAGGGAAGTGAGTTGGG + Intronic
1037621595 8:20568063-20568085 CTGTGTTAGGGGAAGCAACTGGG + Intergenic
1037807990 8:22069111-22069133 ATGTGTGAGGGGAGGGAGTTAGG - Intronic
1038317574 8:26500893-26500915 GAGTGTTGGGGGAAGGTGTTAGG + Intronic
1039970182 8:42315515-42315537 CAGGGCCAGGGGAAGGAGTTTGG + Intronic
1041917218 8:63149724-63149746 CTGAGTTAAGGCAATGAGTTCGG + Intergenic
1042143253 8:65700828-65700850 CTGTTTTAGGGTAAGGATCTTGG - Intronic
1042835048 8:73072108-73072130 CTGTGTGAGAGGAAGGAGAGGGG + Intronic
1043570258 8:81594999-81595021 CTGTTTTAGGGTAAGGATCTTGG - Intergenic
1043597172 8:81900154-81900176 CTGAGTTAAGGCAATGAGTTCGG + Intergenic
1044192504 8:89335697-89335719 CTGGGTCAGGGGAGGGAGGTGGG - Intergenic
1044825679 8:96194647-96194669 CTGTATTTGGAGAAGGAGTTTGG + Intergenic
1047050440 8:121105642-121105664 CTCTGTTAGGGGATGAACTTTGG + Intergenic
1047119801 8:121888845-121888867 CTGTCTTCGTGGAATGAGTTAGG + Intergenic
1047621506 8:126612657-126612679 CTGGTTTTGTGGAAGGAGTTGGG - Intergenic
1048340775 8:133537042-133537064 TTGTGTTTGGGGTAGGAGTTGGG - Intronic
1048447677 8:134504217-134504239 CTGAGGTGGGGGAGGGAGTTGGG - Intronic
1048468876 8:134689513-134689535 CTGAATTAGGGGAAGGAGGCTGG - Intronic
1048707427 8:137169483-137169505 CTGTGTTTGTGGAACGAGGTTGG + Intergenic
1049283213 8:141761093-141761115 CTGTGTTTGGGGACAGAGGTGGG - Intergenic
1049505559 8:142994639-142994661 CAGTTTTAGGGGAAGGAGTTGGG + Intergenic
1050053881 9:1631781-1631803 CTGTTTTAGGAGGAGGAGTTGGG - Intergenic
1052477751 9:28982170-28982192 GTGGGATAGGGGAAGGATTTGGG + Intergenic
1052549645 9:29931654-29931676 CTGACTTAGGGGAAAGAGGTAGG + Intergenic
1053025093 9:34722997-34723019 TTGTGTTAAGGGAAGGTGTGAGG - Intergenic
1053036617 9:34832059-34832081 TTGTGTTAAGGGAAGGTGTGAGG - Intergenic
1055359741 9:75476968-75476990 GTGTGGTCAGGGAAGGAGTTGGG - Intergenic
1056763246 9:89429093-89429115 CTGCATTTGGGGAAGGAGCTGGG - Intronic
1058001461 9:99870192-99870214 CTGTGTTCTGGGAAGGAATGGGG - Intergenic
1058893380 9:109380051-109380073 TTGTGTTGGGGTAAGGAGTCTGG + Intronic
1059123700 9:111663674-111663696 CTGTTTGAGGGGAAGAAGTCAGG + Intronic
1059165718 9:112074643-112074665 ATGTGTTAGGCTAAGGATTTGGG - Intronic
1060069548 9:120534206-120534228 CTGTGTTCTGGAAAGGAGTGGGG - Intronic
1060104024 9:120862414-120862436 CTGTGGTGGTGAAAGGAGTTGGG + Intronic
1060876667 9:127088934-127088956 CTGGCTTAGTGGAAGGTGTTGGG + Exonic
1062592875 9:137281832-137281854 CAGGGCTAGGGGAAGGAGCTGGG + Exonic
1185712838 X:2317935-2317957 CTGTTTTAGGGGAAAGATTTTGG + Intronic
1186038451 X:5449565-5449587 CTGTGTGTGGGGAGGGAGGTGGG - Intergenic
1186324136 X:8460129-8460151 CTGTGTTGTGGGAAGGAACTAGG - Intergenic
1186664572 X:11704357-11704379 CAGTGTTTGGGGAAGGAAATCGG + Intergenic
1187103494 X:16218591-16218613 CTGAGTTAAGGCAATGAGTTTGG + Intergenic
1188200613 X:27290374-27290396 CTGAGTTAAGGCAATGAGTTTGG + Intergenic
1189240201 X:39518994-39519016 CTGTGTCACGGGCAGGAGGTCGG - Intergenic
1189851353 X:45179173-45179195 CTTTGTTGGGGGAAGGAGGCTGG - Intronic
1192341464 X:70267130-70267152 CTCAGTGAGGGGCAGGAGTTAGG + Intergenic
1192370974 X:70512636-70512658 GTCTGATAGGGGAAGGGGTTAGG - Intergenic
1192452376 X:71252451-71252473 ATGTGTGTGGGGAAGGACTTGGG - Intronic
1192454950 X:71268736-71268758 CTGAGTTAAGGCAATGAGTTTGG - Intergenic
1192731223 X:73804361-73804383 CTGAGTTAAGGCAATGAGTTTGG + Intergenic
1192928306 X:75779207-75779229 CTTTCTAAGGGGAAAGAGTTAGG - Intergenic
1194706960 X:97187229-97187251 ATGTATTAGAGGAAGGAGTAGGG + Intronic
1195016784 X:100788879-100788901 CTGAGTTAAGGCAATGAGTTTGG + Intergenic
1195746688 X:108125695-108125717 CTGTGACATGGGCAGGAGTTAGG + Intronic
1195967141 X:110439057-110439079 CAGTGTTAGGGGAAGAGGGTAGG + Intronic
1196048087 X:111276930-111276952 CTGTGTTGCGGGAGGGAGGTGGG + Intergenic
1197196751 X:123710045-123710067 CTGTCTTAGGGGTTTGAGTTCGG - Intronic
1199585858 X:149415180-149415202 TTGTGTTCGAGGAAGGAGATAGG + Intergenic
1201226902 Y:11827198-11827220 CTGAGTCAAGGGAGGGAGTTTGG + Intergenic
1201233977 Y:11892524-11892546 CTGAGTTAAGGCAATGAGTTCGG + Intergenic
1201293286 Y:12442407-12442429 CTGGGTTAGGTGAGGGAGGTAGG - Intergenic
1201633035 Y:16091256-16091278 CTGTGTGTGGGGAGGGAGGTGGG + Intergenic
1202031200 Y:20576003-20576025 CTGTGTTCGGGAAAGGAGCTGGG + Intronic