ID: 945081709

View in Genome Browser
Species Human (GRCh38)
Location 2:206092432-206092454
Sequence AACCTCTGCCTATTATTCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945081709_945081711 17 Left 945081709 2:206092432-206092454 CCTCTGAATAATAGGCAGAGGTT No data
Right 945081711 2:206092472-206092494 GTTCATTTCTGCTGCATTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945081709 Original CRISPR AACCTCTGCCTATTATTCAG AGG (reversed) Intergenic
No off target data available for this crispr