ID: 945090933

View in Genome Browser
Species Human (GRCh38)
Location 2:206174905-206174927
Sequence AGCTGTGTTGGGAGGGGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 756
Summary {0: 1, 1: 1, 2: 7, 3: 58, 4: 689}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945090919_945090933 28 Left 945090919 2:206174854-206174876 CCTGAGTTGCCACATTAGAAGTC 0: 1
1: 0
2: 6
3: 24
4: 153
Right 945090933 2:206174905-206174927 AGCTGTGTTGGGAGGGGAGAGGG 0: 1
1: 1
2: 7
3: 58
4: 689
945090921_945090933 19 Left 945090921 2:206174863-206174885 CCACATTAGAAGTCTGGCGACCC 0: 1
1: 0
2: 1
3: 13
4: 74
Right 945090933 2:206174905-206174927 AGCTGTGTTGGGAGGGGAGAGGG 0: 1
1: 1
2: 7
3: 58
4: 689
945090925_945090933 -2 Left 945090925 2:206174884-206174906 CCTGAAATGCCATGGTGGAATAG 0: 1
1: 0
2: 1
3: 7
4: 99
Right 945090933 2:206174905-206174927 AGCTGTGTTGGGAGGGGAGAGGG 0: 1
1: 1
2: 7
3: 58
4: 689
945090924_945090933 -1 Left 945090924 2:206174883-206174905 CCCTGAAATGCCATGGTGGAATA 0: 1
1: 0
2: 0
3: 21
4: 227
Right 945090933 2:206174905-206174927 AGCTGTGTTGGGAGGGGAGAGGG 0: 1
1: 1
2: 7
3: 58
4: 689
945090918_945090933 29 Left 945090918 2:206174853-206174875 CCCTGAGTTGCCACATTAGAAGT 0: 1
1: 0
2: 5
3: 25
4: 210
Right 945090933 2:206174905-206174927 AGCTGTGTTGGGAGGGGAGAGGG 0: 1
1: 1
2: 7
3: 58
4: 689

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945090933 Original CRISPR AGCTGTGTTGGGAGGGGAGA GGG Intergenic
900103189 1:971443-971465 AGCTGTGTGGGGGTGGGAGGGGG + Intronic
900173200 1:1280673-1280695 AGCTGTGATGGGAAGGGAGTCGG - Intronic
900200220 1:1401360-1401382 AGCTGCCTTTGGAGGGGAGACGG + Intronic
900237004 1:1597762-1597784 AGCTGTGTTGGCGGGGGAAGGGG - Intergenic
900288110 1:1911455-1911477 TGGTGTGTTGGAAGGGCAGAGGG - Intergenic
900461592 1:2804594-2804616 TGCTGTGATGGTAGGGGACAAGG - Intergenic
900919695 1:5662488-5662510 GACTGTGTTGGGGTGGGAGAGGG - Intergenic
901065716 1:6493245-6493267 AGCTGTGCTGGGAGGAAGGAAGG - Intronic
901380095 1:8867340-8867362 AGGTGTGATGGGGGAGGAGATGG - Intronic
901843018 1:11965518-11965540 AGCTGTCTAGGGAGAGCAGATGG - Exonic
902877809 1:19351476-19351498 TGTTTTGTTGGGAGGGGTGAAGG + Intronic
902914800 1:19630655-19630677 AGCTAGGCTAGGAGGGGAGAAGG + Intronic
903024983 1:20421821-20421843 TGCTGTGATGGGATGAGAGAGGG - Intergenic
903264470 1:22149266-22149288 AGCTCTCTGGGGTGGGGAGATGG - Intergenic
903441995 1:23395085-23395107 AGAAGTGGTGGGAGGGGAGGTGG + Intronic
903741637 1:25561962-25561984 AGTTGGGTTTGGAGGGGTGAGGG + Intronic
903750711 1:25618505-25618527 AACTGTGTAGGGAGGAAAGAAGG - Intronic
903932660 1:26872469-26872491 TGCTGTGTGGGGAGTGGAAAAGG + Intergenic
904699258 1:32348606-32348628 GGCTGGGCTGGGAGGGAAGATGG - Intergenic
904902569 1:33869067-33869089 AGATGTGTTTGGAAGGGTGAAGG + Intronic
904962755 1:34347724-34347746 AGGTGTGGTGGGTGGGGAGGGGG + Intergenic
905228452 1:36495085-36495107 AGCTCTGCTGGGCGGGGAGATGG - Intergenic
905652638 1:39666772-39666794 ATCAGGTTTGGGAGGGGAGAAGG - Intronic
905912674 1:41664578-41664600 ATCAGTCCTGGGAGGGGAGAGGG - Intronic
906781438 1:48576326-48576348 ACCAGGGTTAGGAGGGGAGATGG - Intronic
907034810 1:51206884-51206906 TGATGTTTTGGGAGAGGAGAAGG - Intergenic
907183403 1:52590306-52590328 AGCTGTGGGGGGAGGGGACCGGG + Intergenic
907400353 1:54221467-54221489 AGATGTATTCTGAGGGGAGAGGG - Intronic
907617384 1:55938581-55938603 AGCTCTGCTGGGAGGGAGGATGG + Intergenic
908892520 1:68862830-68862852 ACCTGTGCTGGGAGGAGAGAGGG + Intergenic
909504870 1:76377414-76377436 AACTGTGGTGGGAGGGCAAAGGG + Intronic
909983154 1:82129367-82129389 AGATGTGTTGAGAAGGGAGTAGG + Intergenic
910036582 1:82796271-82796293 AGCTGAGCTGGAAGGGGAGAAGG + Intergenic
912155131 1:106908951-106908973 AGCTGGCTAGGGAGGGAAGAGGG + Intergenic
912711399 1:111952571-111952593 ACCTCGGTTGTGAGGGGAGAAGG - Intronic
912755828 1:112324286-112324308 ATCTGTGATGGGATGGGAGTAGG + Intergenic
913490385 1:119374290-119374312 AGAGGTGATGGGAGAGGAGAAGG - Intronic
914244592 1:145876309-145876331 AGGTGTGAGGGGAGGGGAGCCGG - Intronic
915340076 1:155172671-155172693 AGCTGTGTGGGGAAGGGGAAGGG + Exonic
915847681 1:159285097-159285119 AGGTGAGTTAGGAGGGGAGATGG + Intergenic
916853159 1:168724618-168724640 AGATGTGTGGGGAGAGGAGGTGG + Intronic
917359358 1:174159501-174159523 AACTGAGAGGGGAGGGGAGAAGG - Exonic
917530164 1:175828067-175828089 GGATCTGTTGGGAGGGGTGAGGG - Intergenic
917929464 1:179813577-179813599 AGGAGTGGTGGGAGGGGAAAAGG + Intronic
918066317 1:181104659-181104681 GGAGGTGTTGGGAGGGGAGTAGG - Intergenic
918295126 1:183149445-183149467 AGCTGTGTGGTGTGAGGAGAGGG - Intergenic
918543543 1:185657619-185657641 AGAGGGGTGGGGAGGGGAGAAGG - Intergenic
918848430 1:189650053-189650075 TGCGGTGGTGGGAGGGGGGAGGG + Intergenic
920046584 1:203136635-203136657 ACCTGTGGTGGGAGTGGGGATGG + Intronic
920294724 1:204948920-204948942 AGTTGGCTTGGGTGGGGAGAAGG - Intronic
920381357 1:205536335-205536357 AGGTGTGGTGGGAAGGGAGAAGG + Intergenic
920694852 1:208174432-208174454 GGCTGTGGAGGGAGGGAAGAAGG + Intronic
921034902 1:211367620-211367642 AGCTGAGTAGGGAGGGGACATGG + Intronic
921035199 1:211371095-211371117 AGCTGTGGTAGGAGAGGAGGAGG + Intronic
921056986 1:211549761-211549783 TGCTGGGCTGGGAGTGGAGATGG - Intergenic
921252623 1:213311804-213311826 AGCTGTGTGAGGTGGGGAGATGG + Intergenic
921269352 1:213453358-213453380 AGTTGTGGTGGGAGAGGAGCAGG + Intergenic
921320154 1:213930909-213930931 AGCTGTGTAGGAAGTGTAGAAGG - Intergenic
922296798 1:224257045-224257067 AGCTGGGTTGAGAGGGCAAAAGG - Intronic
922576035 1:226661134-226661156 AGGTGTGTTGGGGGTGGAGATGG - Intronic
922896233 1:229102647-229102669 AGGTGAGCGGGGAGGGGAGAAGG - Intergenic
923147758 1:231209892-231209914 ACCTCTGTTAGGAGGGCAGATGG + Intronic
923259984 1:232259178-232259200 ACCTGTGTGGGGCGGGGGGATGG + Intergenic
924028987 1:239867833-239867855 GGCTGCCTTTGGAGGGGAGATGG - Intronic
924386916 1:243507526-243507548 GGCTGCGGTGGGAGGGGAGCTGG + Intronic
1062904494 10:1170685-1170707 AGCTCTGTGTGGAGGGGAGAGGG - Intergenic
1062919388 10:1267795-1267817 AACTGTGCTGGGAGGGTTGAAGG + Intronic
1063492671 10:6479246-6479268 ACCTGTGTTGGGTGGGAAAAGGG + Intronic
1064191059 10:13206300-13206322 ACCTGTGTGGGGAGGGTATAGGG - Intronic
1064424769 10:15220942-15220964 ACCTGGGATGGGAGGGGACATGG + Exonic
1065289579 10:24216199-24216221 AAATGAGTTGGGAAGGGAGATGG - Intronic
1065740952 10:28796760-28796782 AACTGTGCTGGGAGGGGAAGTGG - Intergenic
1065752829 10:28903429-28903451 ACCTGTGTGGGGAGGAGAGAAGG + Intergenic
1066310215 10:34188873-34188895 TGCTGTGTTGGGAAGGGTGTGGG - Intronic
1067160486 10:43821213-43821235 TGCTGTGGAGGGAGGGGACAGGG - Intergenic
1067802375 10:49367993-49368015 GGCTGTCTTGGGAAGGGAGGTGG - Intronic
1067831966 10:49615541-49615563 GGTGGTGTTGGGTGGGGAGAGGG + Intronic
1067841150 10:49680347-49680369 AGCCATAATGGGAGGGGAGAGGG + Intronic
1068249897 10:54424859-54424881 AGCGGTGGGGGGAGGGGGGAGGG + Intronic
1070485332 10:76924989-76925011 AGCTGGGTTGGGAGGGAAGAGGG - Intronic
1070646571 10:78205971-78205993 AGCTGGGCAGGGAGAGGAGATGG - Intergenic
1071566290 10:86673046-86673068 AGCTGTGTTTGGGGGTGGGAGGG - Intronic
1073094574 10:100971774-100971796 AGATGTGTCGGGAGGGGCCAAGG + Intronic
1073192304 10:101660319-101660341 AGTTGGGTTGGGAGGGGGGGTGG + Intronic
1073434537 10:103508226-103508248 TTCTGTCATGGGAGGGGAGAGGG - Intronic
1073459620 10:103659145-103659167 AGATGGGATAGGAGGGGAGAGGG + Intronic
1074085997 10:110209395-110209417 TGTTGTGTTGGGTGGGGGGAAGG - Intronic
1074578427 10:114693150-114693172 GGCTGTGTTGGGATCGGTGAGGG + Intergenic
1074771089 10:116734551-116734573 AGCTCTGTTGGCAGCTGAGAGGG - Intronic
1075014732 10:118902335-118902357 AGGGGTGTTTTGAGGGGAGAGGG + Intergenic
1075438736 10:122462896-122462918 ACCTGTTCTGGCAGGGGAGACGG + Intronic
1075498841 10:122953933-122953955 AGCTGTGAGGGGAGGCGAGAGGG - Intronic
1075672622 10:124272932-124272954 AGCTGTGCTGGGCTGAGAGATGG - Intergenic
1076719742 10:132387855-132387877 AGCTGCCTTGGGAAGGGAAAAGG + Intergenic
1076794283 10:132791205-132791227 AGGTGGGGTGGGAGGGGAGAGGG + Intergenic
1076872299 10:133200000-133200022 AGCTGTGTTGGGTGGGGCGGCGG + Intronic
1077388424 11:2286973-2286995 TTATGAGTTGGGAGGGGAGATGG - Intergenic
1077556229 11:3227436-3227458 AGCTGGAGTGGGAGGGGAGGTGG + Intergenic
1077644566 11:3912123-3912145 AGAGGGGATGGGAGGGGAGAAGG - Intronic
1078052131 11:7974957-7974979 AGCTTTGCAGGGAGGGAAGAAGG + Intronic
1078067999 11:8090364-8090386 AGCTGAGTAGGGAGGGCAGAGGG + Intronic
1078082527 11:8214670-8214692 AGATGTGCTGGGAGGTGAGGGGG - Intergenic
1078429745 11:11280007-11280029 GTGTGTGTTGGGAGGGGACATGG + Intronic
1078923757 11:15855735-15855757 AGTTTTGTTGGGAAGGGAGCTGG + Intergenic
1079121643 11:17689420-17689442 AGATGTGTTAGGAGTAGAGAGGG - Intergenic
1079766853 11:24405225-24405247 CCCTGTGTTGGGATGGTAGAGGG + Intergenic
1080070314 11:28076168-28076190 GTCTGTGTTTGGAAGGGAGAGGG + Intronic
1080657755 11:34271078-34271100 AGCTGTATAGGGACGGGTGATGG + Intronic
1080668965 11:34358548-34358570 GGCTGTGTTTGGAGGGAGGAGGG + Intergenic
1080944619 11:36957620-36957642 AAGTGTGTTGGGAGGGAAGTGGG + Intergenic
1081207532 11:40293111-40293133 ACCGGAGTTTGGAGGGGAGAGGG - Exonic
1081796506 11:45824141-45824163 AGGTGTGCTGGGAGCGTAGATGG + Intergenic
1081833837 11:46137064-46137086 GCCTGTGGTGGGAGGGGAGGAGG + Intergenic
1081869219 11:46375736-46375758 AGGGGTGTTGGGAGTGGAGCGGG + Intronic
1082079595 11:48001978-48002000 AGCTGTGTTTGGAAGTGAGCAGG - Intronic
1082148343 11:48699974-48699996 TGCGGTGGGGGGAGGGGAGAGGG - Intergenic
1082811764 11:57482825-57482847 AGATGGCTGGGGAGGGGAGAGGG - Intergenic
1082821303 11:57546217-57546239 AGCTGCCCTGTGAGGGGAGAGGG - Exonic
1082836353 11:57653469-57653491 AGGGGTGGGGGGAGGGGAGAGGG + Intronic
1083256454 11:61498984-61499006 AGCTGCCTTGGGAGGAGAGTGGG + Intergenic
1083297817 11:61724722-61724744 AGCTGGGCTGGGAGGGAATATGG - Intronic
1083777593 11:64901900-64901922 AGGTGTGTTTGGAGCGGGGACGG - Intronic
1084640713 11:70424132-70424154 TGCAGAGTTGGGAGGGGAGTAGG + Intronic
1085306032 11:75486607-75486629 AGCTGGGTTGGGAGCAGGGATGG - Intronic
1085308478 11:75501683-75501705 AGGGGTGCTGGGAGAGGAGAGGG + Intronic
1086162562 11:83738769-83738791 AGCTATGATGGGAGAGGAGCTGG - Intronic
1086230267 11:84560560-84560582 AGATTTGTTGAGAGAGGAGAGGG + Intronic
1086436998 11:86791361-86791383 ATCTGTGTGCGGAGGGCAGAAGG + Intronic
1086477840 11:87198554-87198576 AGCGGAGAGGGGAGGGGAGAGGG - Intronic
1086654966 11:89343078-89343100 AGCTTTGTGGGGAGTGGGGAGGG - Intronic
1086806319 11:91247257-91247279 ATGTGTGTGTGGAGGGGAGAAGG + Intergenic
1089124836 11:116169565-116169587 AGCTGGGTTGGGAGATAAGAGGG - Intergenic
1089127855 11:116190029-116190051 AGCTGGGGGTGGAGGGGAGAGGG + Intergenic
1089333054 11:117703399-117703421 AGCTGTCTGGGAAGGGGAGATGG - Intronic
1089802320 11:121043692-121043714 AGTTTTGCTGGGAGTGGAGAAGG - Intronic
1090607798 11:128441146-128441168 AAATGTGTTGGGAGGGGCGGGGG + Intergenic
1091320687 11:134647226-134647248 TCCTGTGCTGGGAGGGGAGGTGG - Intergenic
1091961771 12:4701632-4701654 AGCTGTGTTGGGGTGGGAGAAGG + Intronic
1091989621 12:4944442-4944464 AACTGTGTTGGGAGGAGTGTGGG - Intergenic
1094401059 12:30060910-30060932 TGATGTGTAGGGAGGGGAGGAGG - Intergenic
1094472501 12:30816824-30816846 ATCTGTGTAGGGAGGGGGAAGGG + Intergenic
1094573149 12:31659545-31659567 ATCGGTGCTGGGACGGGAGAGGG + Intronic
1094807289 12:34106293-34106315 AGCAGTGTGGGGTGGGGAGTGGG + Intergenic
1095456603 12:42392216-42392238 GGCTTTTTTGGGAGGGGCGAGGG - Intronic
1095795052 12:46210128-46210150 AGGTGTGCTGGGAGGGGGAAGGG - Intronic
1095934103 12:47658128-47658150 AGCTGTCAGGGGAGAGGAGAGGG + Intergenic
1096504980 12:52087100-52087122 AGCAGAGTTGGGAGGTGGGAGGG - Intergenic
1096829260 12:54301539-54301561 GGCTGAGGGGGGAGGGGAGAAGG - Intronic
1096873016 12:54606473-54606495 AGCTGTGATTGGAGGGGTGAGGG - Intergenic
1097174567 12:57135416-57135438 AGCTGAGTTGGGAGCGGGGTAGG - Intronic
1097839085 12:64303430-64303452 ATGTGTGTGTGGAGGGGAGATGG - Intronic
1098073762 12:66703841-66703863 ATGTGTGTGGGGTGGGGAGAGGG + Intronic
1100189828 12:92178525-92178547 AGGTGTGATGGGAGGGGAGGTGG + Intergenic
1101018247 12:100524823-100524845 ATGTTTGTTGGGAGGGAAGATGG - Intronic
1101039302 12:100737601-100737623 GGCTCTGTTGGGAGGGAGGAGGG + Intronic
1101382218 12:104223924-104223946 AGTAGTGTGGGAAGGGGAGAGGG + Intronic
1102394146 12:112573905-112573927 AGGTGTGGTGGGTAGGGAGACGG + Intronic
1102405874 12:112673812-112673834 GGCTGTGTGGGGAGGGAAGTAGG - Intronic
1102768850 12:115455685-115455707 AGCTGTGTTGGGAGCGATGGAGG - Intergenic
1102797349 12:115700344-115700366 ATCTGTGTGGGAAGGGCAGAAGG - Intergenic
1102863388 12:116355561-116355583 AGCAGTGATGGGGGAGGAGAAGG - Intergenic
1103073874 12:117967025-117967047 AGCTGGGTTGGTTTGGGAGAAGG + Intronic
1103188483 12:118981211-118981233 AGCGATGATGGGAGAGGAGAGGG + Intergenic
1103570591 12:121842057-121842079 GGCTGGGGTGGGAGGGGGGAAGG + Intronic
1103861478 12:124018098-124018120 CGCTGTGTTGTGAGGAAAGAGGG + Intronic
1104068785 12:125327409-125327431 AGCTATGATGGGAGGGGAGAGGG - Intronic
1104085312 12:125469503-125469525 TGCTGCCTTGGGAGGGGAGTAGG + Intronic
1104383656 12:128329705-128329727 AGCTTTGTTGGGGGCGGAGGAGG + Intronic
1105292697 13:19062660-19062682 AGCTGTGTTGGGAGTGGAAGAGG - Intergenic
1105767321 13:23574734-23574756 CTCTGTGATGGGAGGGCAGAGGG + Intronic
1105916475 13:24921824-24921846 AGGTGTGTTTGGTGGGGAGTTGG - Intronic
1106138277 13:26990682-26990704 GGGTGTGGTGGGAGGGGACAGGG - Intergenic
1106154055 13:27135820-27135842 AGCTAGCTAGGGAGGGGAGAAGG + Intronic
1106639085 13:31564118-31564140 AGTTGTGTTGGGAAGAGACATGG + Intergenic
1106830798 13:33580384-33580406 GGCTTAGTGGGGAGGGGAGAAGG + Intergenic
1107837793 13:44425753-44425775 AGCTGTGCTGGGCAGGGAGAGGG + Intergenic
1110464987 13:75790180-75790202 AACTGTGTTGGGGGTGGAGGGGG + Intronic
1110597131 13:77331504-77331526 AGGAGTTTGGGGAGGGGAGATGG - Intergenic
1110763247 13:79253429-79253451 AGCTGTGTGTGGAGGAAAGAAGG - Intergenic
1111683291 13:91470062-91470084 ACCTGTGGTGGGAGTGGGGAGGG - Intronic
1111694280 13:91604093-91604115 TGGTGTGGTGGGAGGGGGGAGGG - Intronic
1112114895 13:96341005-96341027 TACAGTGTTGGGAGGGAAGATGG + Intronic
1112783405 13:102926390-102926412 TGCTGTGCTGGGAGTGGATAGGG + Intergenic
1113957097 13:114104882-114104904 ACGTGTGTGGGGAGGGGAGTGGG - Intronic
1113957105 13:114104908-114104930 ACGTGTGTGGGGAGGGGAGGGGG - Intronic
1114452339 14:22835731-22835753 AGGTATGTAGGGAAGGGAGAGGG - Intergenic
1114654531 14:24308125-24308147 ACATGTGTTGTGAGGGTAGATGG + Exonic
1115313895 14:32006445-32006467 AGCAGTGTTGGTTGGGGATAGGG + Intergenic
1118729762 14:68658150-68658172 GGCTGGGTTGGCAGGTGAGATGG + Intronic
1118921075 14:70150569-70150591 AGCGGTGATGGGAGGGTAGGAGG - Intronic
1118928680 14:70219006-70219028 AGCTGTTATGGGAGGGGAGAGGG - Intergenic
1119599748 14:75967579-75967601 AGCTGTGTTGGGGAGAGTGAGGG + Intronic
1119637853 14:76291361-76291383 AGGGGTGGTGGGAGGGGACAGGG - Intergenic
1120957015 14:90091781-90091803 ACCAGTGCTGGCAGGGGAGAAGG + Intronic
1120994123 14:90402462-90402484 AGATGAGTTGGGAGGAGAAAAGG + Intronic
1121210669 14:92206159-92206181 AGATGGACTGGGAGGGGAGAGGG - Intergenic
1121229569 14:92346864-92346886 AGCTGGGTTGGGTGGGGATGTGG + Intronic
1121494340 14:94381636-94381658 AGCTCTGTTGGTATGGCAGAGGG - Intronic
1121712265 14:96047506-96047528 AGCTGTGATGGGAAGGTACAGGG - Intronic
1121789244 14:96686617-96686639 AGGTGTGGTGGCATGGGAGAAGG + Intergenic
1121980255 14:98448270-98448292 TGCTGTGTAGGGAAGGGAGGGGG + Intergenic
1122430764 14:101640244-101640266 AGCTGTGGGGAAAGGGGAGATGG + Intergenic
1122853646 14:104549438-104549460 TGCTGTGTGGGGTGGGGAGGTGG - Intronic
1122986218 14:105212821-105212843 AGCTGTGTGGGGAGGCGGTAGGG + Intronic
1202901159 14_GL000194v1_random:40581-40603 AGGTGTGCTGGGAGTGGAGGGGG + Intergenic
1125328370 15:38559920-38559942 AGCTGGGATGGGAGGGGAAGGGG + Exonic
1125439755 15:39689384-39689406 AGATGTCCAGGGAGGGGAGAGGG - Intronic
1125505314 15:40264676-40264698 AGCTGTGCTGGGGGAGGGGAGGG + Intronic
1126298788 15:47171401-47171423 TGCGGTGGTGGGAGGGGGGAGGG + Intergenic
1126937383 15:53726341-53726363 ACGTGTGTTGGGAGGGGGGCGGG + Intronic
1126986794 15:54320973-54320995 AGCTGTGGTGGTAGTGGATATGG - Intronic
1127326181 15:57897234-57897256 AGCTGTGTAGGAAGGTGTGATGG - Intergenic
1127475400 15:59327979-59328001 AGCTGTGTTAAAAGAGGAGATGG + Intronic
1127616918 15:60695220-60695242 AGCAGTGTTGGGAGAAGAGATGG - Intronic
1127802125 15:62485823-62485845 AGTTGGCTTGGGAGTGGAGAGGG + Intronic
1128079029 15:64845315-64845337 AGGAGGGATGGGAGGGGAGAGGG + Intronic
1128211860 15:65908894-65908916 AGACATGTTGGGAGGGAAGAGGG + Intronic
1128498207 15:68210244-68210266 CGGTGTGTGGAGAGGGGAGAGGG - Intronic
1128506373 15:68275915-68275937 AAGTGTGTTGGCAGAGGAGAGGG + Intergenic
1128632157 15:69278610-69278632 AGCTGTGGTGAGAGGGAAGGGGG + Intergenic
1128706119 15:69838459-69838481 AGCAGAATTGTGAGGGGAGAAGG - Intergenic
1129714567 15:77839690-77839712 ATCTGTGTGGAGATGGGAGAAGG - Intergenic
1129977957 15:79838331-79838353 AGCTGTGGTGGGAGGTGGCAGGG + Intronic
1130096592 15:80860808-80860830 AGCTGTGTGGTGAGGTCAGAGGG - Intronic
1130550664 15:84888396-84888418 AGCTGTTTTGGGTGGGGGGTGGG - Intronic
1130626902 15:85524752-85524774 AACTGAGATGGGTGGGGAGATGG - Intronic
1131536020 15:93238782-93238804 AGCTGTGCTGGGATTGGAGAGGG + Intergenic
1131700338 15:94928619-94928641 ATGTGTGTTGGGAGGGGAGTTGG + Intergenic
1131786229 15:95914003-95914025 CACTGTGTAGGGAGGGGGGATGG + Intergenic
1131957166 15:97748756-97748778 GGCTGTGCAGGGAGGGGAGGTGG - Intergenic
1132747186 16:1441683-1441705 GGCTGTGTGGGGAGGGGTGGAGG + Intronic
1132840265 16:1975437-1975459 AGGTGTGTTGGGCCGGGACATGG + Exonic
1133569910 16:7031020-7031042 AGTTGGTTTGGGATGGGAGATGG + Intronic
1134191562 16:12125299-12125321 AGCTGTGTGGGGAAGGCGGAAGG + Intronic
1134623321 16:15706357-15706379 AGCTGTGTGGGGAGCGTACAGGG - Intronic
1134653386 16:15928289-15928311 TGCTGCCTTGGGAGGGGAGTTGG - Intergenic
1135698455 16:24610702-24610724 AGATGGGCTGGGAAGGGAGAGGG - Intergenic
1135941565 16:26826521-26826543 ACCTGTGTTGGGAGGCAAGGGGG - Intergenic
1136103506 16:28012230-28012252 AGGGGTGGTGGGAGGGCAGAGGG - Intronic
1136189028 16:28604550-28604572 ACCTGTTTGGAGAGGGGAGAGGG - Intergenic
1136449654 16:30346597-30346619 AGCTGTATGGGGAGGGAATAGGG + Intergenic
1136549717 16:30976499-30976521 GGCTGTGCTGGGACAGGAGAGGG + Intronic
1137525666 16:49234076-49234098 TGGGGTGTGGGGAGGGGAGAGGG + Intergenic
1138335907 16:56252744-56252766 AGGAAGGTTGGGAGGGGAGAAGG - Intronic
1138727776 16:59159610-59159632 TGCTTTGTTGGCAGGGGTGAGGG + Intergenic
1140476062 16:75239768-75239790 AGCTGGGGAGGGAGGGGAGCGGG - Intronic
1141209048 16:81959110-81959132 TGCTGGGTTGGGAAGGGAGGTGG + Exonic
1141749079 16:85946364-85946386 AGCTTTGGGGTGAGGGGAGAGGG - Intergenic
1141954437 16:87360977-87360999 AGCTGTGGTGGGGTGGGAGTAGG - Intronic
1142200692 16:88759884-88759906 AGCTGTGTGGGGAGGGGACCTGG + Intronic
1142223457 16:88866240-88866262 AGCTGACTTAGGAGGGGAGAGGG - Intronic
1142350243 16:89576289-89576311 AGCGGGGTTCGGAGGAGAGAGGG + Intronic
1142603137 17:1067013-1067035 AGCTGTGTTGGGGGAGGTGGAGG - Intronic
1142875962 17:2852515-2852537 TGCTGGGTGGAGAGGGGAGAGGG - Intronic
1143001946 17:3800243-3800265 GGCTGTGCTGGGAGGGGACTTGG - Intronic
1143058494 17:4180303-4180325 AGCTGGGATGGGAGGTGGGATGG - Intronic
1143325941 17:6098461-6098483 AAATGCGTTGTGAGGGGAGATGG - Intronic
1143615462 17:8046760-8046782 AGCTGTGTTGGGGAGGGAGTAGG + Intronic
1143696980 17:8628839-8628861 AGCTGAGATGGAAGGTGAGATGG - Intronic
1143792679 17:9310600-9310622 ACCTGTTTTGGGAGGAGAGTGGG + Intronic
1144215968 17:13055822-13055844 AGCTGATGAGGGAGGGGAGATGG + Intergenic
1144302380 17:13933924-13933946 GAATGTGTTGGGAGGGGAGTTGG + Intergenic
1145353800 17:22117783-22117805 TGGGGTGCTGGGAGGGGAGAGGG - Intergenic
1145873689 17:28299057-28299079 AGTTCATTTGGGAGGGGAGAAGG - Intergenic
1146185125 17:30719724-30719746 GGATGTGATGTGAGGGGAGAGGG + Intergenic
1146197161 17:30823874-30823896 AGCTATGTTGGAAGAGCAGAAGG - Intronic
1146791033 17:35750642-35750664 AGCTGAGTGGGGAGAGGGGAAGG - Intronic
1146821528 17:35986659-35986681 AGCTGTTGTGGGAGGAGAGCTGG + Exonic
1146824187 17:36009179-36009201 AGCTGGGAGGAGAGGGGAGAAGG - Intergenic
1146926871 17:36751486-36751508 AAATGTGTGGGGAGGGGACAAGG - Intergenic
1147178564 17:38671561-38671583 AGCTGTGTTGTGGGAGGAGGAGG - Intergenic
1147183107 17:38699280-38699302 ACATGAATTGGGAGGGGAGAAGG - Intergenic
1147996549 17:44363116-44363138 AGCTGGGTTTGAAGGGGGGAGGG - Intronic
1148651444 17:49252975-49252997 AGGTGTGTTGAGAGCGGAAAGGG + Intergenic
1148678315 17:49457925-49457947 AGTTGTGTTGGGTGTGGAGGGGG + Intronic
1148742032 17:49898405-49898427 AGCAGGGCTGGGAGGGAAGAGGG - Intergenic
1148805823 17:50263506-50263528 AGCTGTCTTGGGAGGGTGAAGGG + Intergenic
1149427630 17:56570285-56570307 GGCTGTGAGAGGAGGGGAGATGG - Intergenic
1149475089 17:56954218-56954240 AGCTGTTTTGGAAGGCGTGAGGG - Intronic
1149605897 17:57924915-57924937 AGATGAGTTTGGAGGGGAGGGGG + Intronic
1149696597 17:58621163-58621185 AGCTGTGATGGGAGAAGAGGGGG + Intronic
1150343561 17:64387524-64387546 AGAAGTGGTGGTAGGGGAGAGGG + Intronic
1150514581 17:65794788-65794810 AGTGGTGGTGGAAGGGGAGACGG - Intronic
1150590524 17:66558437-66558459 ATCAGTGTAGGGAGAGGAGAGGG + Intronic
1151446209 17:74166001-74166023 ACCTGTGGTGGGAGGGAAAAGGG + Intergenic
1151559543 17:74862980-74863002 GGCTGTTCTGGGAGGGGTGAAGG - Intronic
1151575251 17:74949883-74949905 AGGTGTGTGGGGAGAGGAGCTGG - Exonic
1152410514 17:80120450-80120472 AGGTGGGGTGGGAGGGGAGGTGG - Intergenic
1152684856 17:81688928-81688950 CCCTGTGTTGGGAGGGAGGAGGG + Intronic
1152903456 17:82958073-82958095 GGCTGCGGTGGGAGGAGAGAGGG - Intronic
1153040702 18:811660-811682 AGCTGTGCGGGGAGAGGAGCGGG - Intronic
1155041373 18:22068108-22068130 CTCTGAGTTGGGAGGGGAGTAGG - Intergenic
1155044163 18:22088979-22089001 AGCAGTAGTAGGAGGGGAGAAGG + Intronic
1155724486 18:29062639-29062661 AGGTGTGGAGGTAGGGGAGAGGG - Intergenic
1156221819 18:35060285-35060307 AGCTGAGTTGGCGGGGGAGGGGG + Intronic
1156468580 18:37363171-37363193 GGCTGTGTGGGGAGGGGACGAGG + Intronic
1157075708 18:44465185-44465207 AGATGTTTTGGAAGGGGAGAGGG + Intergenic
1157270838 18:46274885-46274907 TGCAGTGTTGGCAGGGGTGAGGG + Intergenic
1157890487 18:51411333-51411355 AGCTGTGTAGGGAGGGCTGTGGG + Intergenic
1158490274 18:57903610-57903632 AGCTGTGATGCCAGGGGACAAGG - Intergenic
1158548401 18:58415002-58415024 AGCTCTGAAGGGAGGGGGGAAGG - Intergenic
1158817352 18:61118372-61118394 AGGTGTGGTGGGAGGGGAATGGG + Intergenic
1158868162 18:61658126-61658148 AGCTGTGATGGGAGGGGATTTGG + Intergenic
1159551611 18:69901304-69901326 TGCTGTTTTGTGAGGGGTGAAGG + Intronic
1159588261 18:70302658-70302680 AGCTGAGTAGGAAGGGAAGAGGG + Intronic
1159820846 18:73141620-73141642 AGTAGTGAGGGGAGGGGAGAAGG - Intergenic
1160826441 19:1082504-1082526 AGCTGGGCTGGGATGGGAGTGGG + Intronic
1160978906 19:1807494-1807516 AGCTGGGCTTGGACGGGAGAAGG - Intronic
1161085532 19:2333255-2333277 GGCTCTGCTGGGAGGGGAGCAGG + Intronic
1161256279 19:3311598-3311620 TGGTGTGTGGGGAGGGGCGAGGG - Intergenic
1162152619 19:8656624-8656646 AGCTGTGCTGTGTGGGGAGCAGG - Intergenic
1162398950 19:10433003-10433025 AGCTGGGTTGGGGGTGGGGAGGG + Intronic
1162838297 19:13336262-13336284 GACTGTGTTGGGAGAAGAGAAGG - Intronic
1162973655 19:14195965-14195987 GGATGTGATGTGAGGGGAGAGGG - Intronic
1163430479 19:17264213-17264235 ATCTGGGTGTGGAGGGGAGAGGG + Intronic
1163644804 19:18483141-18483163 TGCTAGTTTGGGAGGGGAGAGGG - Intronic
1164143214 19:22492943-22492965 ACCTGAGCTGGGAGGGGAGGCGG - Intronic
1164220526 19:23188934-23188956 TGATGTGTAGGGAAGGGAGAGGG + Intergenic
1164559487 19:29279500-29279522 AGCCGAGGTGGGAGGGGTGATGG - Intergenic
1165202841 19:34159285-34159307 AGCTGTGATGGAAGGGGAAGGGG - Intergenic
1165773349 19:38390514-38390536 ACCTGGGGAGGGAGGGGAGAGGG + Intronic
1165899421 19:39161876-39161898 ACCTGCGTGAGGAGGGGAGAGGG - Intronic
1165922055 19:39305383-39305405 AGCTGGTTGGGGAGAGGAGAGGG - Intergenic
1165980056 19:39714087-39714109 ATGGGTGTGGGGAGGGGAGAGGG - Intergenic
1166271271 19:41715668-41715690 AGATGTGTTTAGAGGGGAAATGG - Exonic
1166326959 19:42056873-42056895 AGCTGTGATGGGAAGGAAGTGGG + Intronic
1166778058 19:45324183-45324205 ATCTGAGGGGGGAGGGGAGAGGG + Intergenic
1167637067 19:50661484-50661506 AGCTGTGTGTGCTGGGGAGAGGG + Intronic
1167724421 19:51200802-51200824 AGCTGAGTAGGGAAGGGACAGGG - Intergenic
1168273758 19:55265183-55265205 AGGTGTGTGGGGAGGGGATGGGG - Intronic
1168339984 19:55617152-55617174 AGCAGAGTTGGGAGGGCACAAGG + Exonic
1168494855 19:56839994-56840016 AGTGGTGGTGGGAGGGGCGAAGG - Intronic
1202633268 1_KI270706v1_random:19482-19504 AGCTTTGGTGGGAGGCAAGAGGG + Intergenic
925161670 2:1688561-1688583 AGCTGTGTTGTGAGGCAAGCTGG - Intronic
925235253 2:2272238-2272260 AGCAGTGTTGGGAAGAGAGCTGG - Intronic
925422601 2:3724977-3724999 GTCTGGGTTGGGAAGGGAGAGGG + Intronic
927827551 2:26319121-26319143 AGATGGGATGGGAGGGAAGAGGG + Intronic
927879090 2:26677858-26677880 AGCTGTGGTGGCAGGGGCTATGG + Intergenic
928022537 2:27715825-27715847 AGGGGTGTGGGGAGGGGGGAGGG - Intergenic
928234724 2:29529701-29529723 ATCTGTGTGGTGAGGGTAGAAGG - Intronic
929122329 2:38493889-38493911 ATCTGGGATAGGAGGGGAGAGGG + Intergenic
930188716 2:48436325-48436347 AGCCATCTTGGGAGGCGAGAGGG - Intergenic
930850111 2:55951378-55951400 AGATGTGGTGGGAGGGGATTAGG + Intergenic
931248788 2:60512504-60512526 TTCTGGGTTGGGAGGGGAGCCGG - Intronic
931847492 2:66219671-66219693 AGATTTGTCGGGAGGGGAGTGGG - Intergenic
932012654 2:67993923-67993945 AGGGGAGATGGGAGGGGAGATGG - Intergenic
932012659 2:67993935-67993957 AGATCAGTTGGTAGGGGAGATGG - Intergenic
932485783 2:72083620-72083642 AGCTGTTTTCGGACGGGAGCTGG + Intergenic
932705831 2:74024380-74024402 AGGGGTCTTGGGAGGAGAGAGGG + Intronic
932815274 2:74856142-74856164 GGCGTTGTTGGGAGGGGAGTAGG + Intronic
933164691 2:79063265-79063287 AGGTGTGTGGGGAGGGGTGTTGG + Intergenic
933264701 2:80169298-80169320 AGCTGGGATCGGAGGGGAGAGGG + Intronic
933743263 2:85551725-85551747 CCATGTGGTGGGAGGGGAGAGGG - Intronic
933767413 2:85719539-85719561 AAGTGTGTTGGGAGGAGAAAAGG + Intergenic
933885725 2:86718498-86718520 GGCTGTCTTGGAAAGGGAGAAGG + Intronic
933924453 2:87078208-87078230 GGCTGTCTTGGAAAGGGAGAAGG - Intergenic
933939337 2:87232529-87232551 AGCTCTGAGGGGAGGGCAGAAGG - Intergenic
935069838 2:99684360-99684382 AGCTGCAGGGGGAGGGGAGATGG - Intronic
935646523 2:105340367-105340389 AGGTGTGTGGGGAGGGGAAGCGG + Intronic
936353796 2:111733249-111733271 AGCTCTGAGGGGAGGGCAGAAGG + Intergenic
936400926 2:112163940-112163962 AGATGTCTGGGGAGGGCAGAGGG - Intronic
936699405 2:114992587-114992609 AGCTGTGTGGGGAGTGGAGAGGG - Intronic
936883613 2:117282900-117282922 TGATGTGTAGGGAAGGGAGAGGG - Intergenic
937150173 2:119681013-119681035 AGCTGTGGAGGGAGCGGAGCTGG - Exonic
937159614 2:119747590-119747612 AGCTGGGTGGGGAGGGTGGAAGG + Intergenic
937265356 2:120611817-120611839 AGCTAGGCTGGGAGGGGAGCAGG + Intergenic
938653900 2:133411434-133411456 AGCTGTGTGGGATGAGGAGAAGG + Intronic
939606609 2:144262650-144262672 AGATGGAATGGGAGGGGAGATGG + Intronic
939606654 2:144262768-144262790 AGATGGAATGGGAGGGGAGATGG + Intronic
941068390 2:160928788-160928810 AGGTGTGTAGGGAGAGGAAAAGG + Intergenic
941186739 2:162327651-162327673 AGCTGAGCTGAGAGGGGAAAGGG + Intronic
941377363 2:164748023-164748045 AGCTGTGTGTGGTGGGGAGCAGG + Intronic
941935574 2:170978974-170978996 TGCTGTGTAGGGAAGGGAGGGGG + Intergenic
942331359 2:174828048-174828070 CCCTGAGTTGGGAGGGAAGAGGG + Intronic
942351621 2:175058527-175058549 AGCTGTGGGGTGTGGGGAGACGG - Intergenic
944610506 2:201400463-201400485 AGCTGGGGGGAGAGGGGAGAAGG + Intronic
944734061 2:202545208-202545230 AGGTGTGTGGGGAGGGGAGGGGG - Intronic
944783959 2:203048573-203048595 ATCTGTGTTCCGAGAGGAGATGG - Intronic
945090933 2:206174905-206174927 AGCTGTGTTGGGAGGGGAGAGGG + Intergenic
945446359 2:209942432-209942454 TGGTGTGTTGGGATTGGAGAAGG + Intronic
946391282 2:219418306-219418328 AGCTGTCAGGGGAGGGGAGGCGG + Intergenic
946418060 2:219550439-219550461 GGCTGGGTTGGGAAGGGAGTTGG + Exonic
947257183 2:228180383-228180405 AGATGCGGTGGGAGGGGAGGTGG - Intronic
947618403 2:231573600-231573622 AGCAGTGCTGGGAAGGGGGAAGG - Intergenic
947740485 2:232482653-232482675 AGCTGTGATGTGAGGGTAGCGGG - Intronic
947967543 2:234294202-234294224 AGCTGTGTGGGCAGAGAAGAAGG - Intergenic
948229828 2:236341744-236341766 TGCTGTGTGTGGTGGGGAGAAGG + Intronic
948290566 2:236821158-236821180 GGTTGTGTTGGGTGGAGAGAGGG + Intergenic
948802507 2:240439277-240439299 GGCTGTGCTGGGTGGGGAGCGGG + Intronic
948863016 2:240762021-240762043 TGCTGTGTTGGGAGGAGGGGTGG - Intronic
949035520 2:241814221-241814243 AGCCGTGTTGAGAGGGGAAGGGG + Intronic
1168964701 20:1892417-1892439 ATCTGGGGTGGGAGTGGAGATGG - Intergenic
1170881970 20:20304760-20304782 AGCTGTGGGTGGAGAGGAGAGGG + Intronic
1170895619 20:20410940-20410962 AGCTTTGTTGGGAGATAAGAGGG - Intronic
1171026659 20:21636924-21636946 AGGTGTGGGGGGAGGGGGGAGGG + Intergenic
1171210283 20:23311188-23311210 AGCTGGAGTGGGAGGGGAGGGGG - Intergenic
1171327730 20:24310514-24310536 AGCTGGGTTGAGAAGGGAAAAGG + Intergenic
1171564058 20:26161924-26161946 TGGAGTGGTGGGAGGGGAGAGGG - Intergenic
1171893221 20:30736010-30736032 AGGTGTGCTGGGAGTGGAGGGGG - Intergenic
1172179155 20:32990136-32990158 AGGGGTGCTGGGAGGGGATAGGG - Intronic
1172756351 20:37287621-37287643 AGATGTGTTGGGAAGGAAGAAGG - Intergenic
1172838464 20:37887839-37887861 AACTGTGGTGGGAGGGAGGATGG + Intergenic
1173180540 20:40803428-40803450 AGCTGTGTTGGGAGTGGGCAGGG - Intergenic
1174324237 20:49766506-49766528 GGTTCTGTTGGCAGGGGAGAAGG + Intergenic
1175148159 20:56912221-56912243 AGCTGTGTTCGTTGGGGAGGCGG - Intergenic
1175229028 20:57461838-57461860 TGCTGTCTAGGGAGGGGAGGAGG - Intergenic
1175318996 20:58072306-58072328 AGCTGTCTTGGGTGGGAGGAGGG + Intergenic
1175368392 20:58470802-58470824 AGTGGGGTTGGGAGGGCAGATGG - Intronic
1175416328 20:58803858-58803880 GGCTGCGGTCGGAGGGGAGAAGG - Intergenic
1175456379 20:59118049-59118071 AGCTGTTTTTGGAGGGGATGTGG + Intergenic
1175524366 20:59623474-59623496 AGCTGTCGTGGGACGAGAGACGG - Intronic
1175873524 20:62219311-62219333 AGCTGTGTTGGGGGAAGGGACGG - Intronic
1175983751 20:62754163-62754185 AGCTGGGGTGGGAGGGAGGAAGG + Intronic
1176620533 21:9055359-9055381 AGGTGTGCTGGGAGTGGAGGGGG + Intergenic
1176645482 21:9345343-9345365 AGCTTTGGTGGGAGGCAAGAGGG + Intergenic
1178095564 21:29211821-29211843 AGCTGTGGGGGGATGGGAGAAGG - Intronic
1178580007 21:33830513-33830535 AGCTGTGCCGGGAGGGAGGAGGG + Intronic
1178765756 21:35449625-35449647 TACTGGGTTGAGAGGGGAGAGGG + Intronic
1179182812 21:39060207-39060229 AGCACTGTTGGGAGTGGAGAAGG - Intergenic
1179555585 21:42173392-42173414 AGGTGTGATGGCACGGGAGAGGG + Intergenic
1179837700 21:44048217-44048239 GACTGTGTTAGGAGAGGAGAGGG - Intronic
1180090878 21:45533376-45533398 AGCTGTCTTGGCAGGGGCCAGGG + Intronic
1180135830 21:45861200-45861222 TGCTGTGTGCGGTGGGGAGAAGG - Intronic
1180367443 22:11953813-11953835 AGCTTTGGTGGGAGGCAAGAGGG - Intergenic
1180755306 22:18156941-18156963 AGCTGTGCTGGGTTGGGGGAGGG + Intronic
1181337776 22:22153799-22153821 AGCTGGGGTGGGAGGGGTGGGGG + Intergenic
1182157621 22:28089964-28089986 TGGGGTGGTGGGAGGGGAGAAGG + Intronic
1182508196 22:30800478-30800500 AGCTGGGCTGGGAGGGCGGACGG + Intronic
1182709184 22:32310047-32310069 AGCGGGGTGGGGAGGGGGGAGGG + Intergenic
1182959639 22:34460150-34460172 AGTTGGGTTGGGTGGGGGGAAGG - Intergenic
1183034331 22:35129671-35129693 AGCTGGGAAGGGAGAGGAGAAGG + Intergenic
1183055535 22:35303117-35303139 GTGTGTGTTGGGAGGGGAGGTGG - Intronic
1183367466 22:37414789-37414811 AGCTGTCTTGGGATGGGAAGGGG - Intronic
1183403483 22:37618427-37618449 ACCTGTGCAGGGAGGGGGGATGG - Exonic
1183437182 22:37802870-37802892 CGCTGGGATGGGCGGGGAGAAGG + Intergenic
1183477302 22:38042646-38042668 AGCTGGGCTGGGAAGGGAGAAGG + Intergenic
1184381447 22:44147292-44147314 AGTTGTGGTGGGAGTGGAGGGGG + Intronic
1184878564 22:47290818-47290840 AGCTGTGCTGGGTGAGTAGAAGG - Intergenic
1185176163 22:49328222-49328244 AGCTCTGAGAGGAGGGGAGAAGG - Intergenic
1185224288 22:49644126-49644148 AGCTGAGCTGGGTGGGCAGAGGG - Intronic
950187374 3:10953486-10953508 AGGTGTGTTGGGGGCGGAGAAGG - Intergenic
950202720 3:11056506-11056528 AGGGGTTGTGGGAGGGGAGAGGG + Intergenic
950423503 3:12912267-12912289 GGCTGGGCTGGGAGGGGAGAGGG + Intronic
951501179 3:23389437-23389459 AGATGTCTTGGGAGGGAAGACGG - Intronic
951944977 3:28125938-28125960 AGCTGGGATGGGAGGAGTGAGGG - Intergenic
952812978 3:37421824-37421846 ACCTGTGTTGGGAGGGGCCTTGG + Intronic
953168838 3:40489139-40489161 AGCTTTATTGGAAGGGGATATGG + Exonic
953599137 3:44346495-44346517 TGATGTGTAGGGAAGGGAGAGGG + Intronic
954041366 3:47890210-47890232 AGCTGTGGGGGGATGGGAGATGG + Intronic
954305188 3:49721931-49721953 GGCTGGGCTGGGTGGGGAGAGGG - Exonic
954411879 3:50374380-50374402 AGGTGGGTGGGGAGGGGAGGGGG + Intronic
954683797 3:52359776-52359798 GTCTGAGTTGGGAGGGGAGCAGG - Intronic
955263951 3:57423577-57423599 TGCTATGCTGTGAGGGGAGAGGG + Intronic
955980963 3:64527466-64527488 AGCTGAGTTGGGGGTGGAGGTGG + Intronic
956756092 3:72388424-72388446 AGTTGAGATGGGAGAGGAGATGG - Intronic
956760465 3:72438909-72438931 CGCTGTGTATGGAGGGCAGACGG + Intronic
957960808 3:87248745-87248767 AGGTGTGTTGGGGGTGGGGAGGG + Intronic
958032370 3:88127318-88127340 AGCTGTGAAGGGATGGGAGGTGG + Intronic
958169767 3:89924107-89924129 AGCTGTGGTGTGAAGGGAGTGGG + Intergenic
959565120 3:107825960-107825982 AGCTTGGGTGGGAGGGGAGCAGG - Intergenic
960038360 3:113124348-113124370 AGCTCTGCTGGGCTGGGAGAGGG + Intergenic
961464586 3:127073440-127073462 AGTTGGGTGGGGAGTGGAGAGGG - Intergenic
962459025 3:135591698-135591720 AGCTGAGTTGGGAGGGGAGCAGG - Intergenic
962829815 3:139130193-139130215 AGATGTGTGGGGAAGGGAGTGGG + Intronic
962931515 3:140041875-140041897 ACCTGTGTGAGGAGGGAAGAGGG + Intronic
964280256 3:155056319-155056341 TGCGGTGTGGGGAGGGGGGAGGG - Intronic
964545091 3:157825822-157825844 AACAGTGTTGGGAGGGAAAATGG - Intergenic
964735253 3:159910862-159910884 AGCTTTGTTGGGAGGTTACATGG - Intergenic
964959518 3:162406006-162406028 TGCGGTGGTGGGAGGGGGGAGGG - Intergenic
966279681 3:178212444-178212466 TGATGTGTAGGGAAGGGAGAGGG - Intergenic
966462875 3:180197186-180197208 AGATCTGTGGGGATGGGAGACGG + Intergenic
966594090 3:181711161-181711183 AGCTGAGTTGGACAGGGAGATGG + Intergenic
966678391 3:182614005-182614027 ATCTGGGTTGGGAGGGCAGTGGG - Intergenic
966805373 3:183803631-183803653 AGCTGGGGTAGGAGGGGAGTGGG + Intronic
966805393 3:183803719-183803741 AGCTGGGGTAGGAGGGGAGTGGG + Intronic
967055188 3:185824590-185824612 AGCTGTGGGGGGAGGGGAGCGGG + Intronic
967390245 3:188948015-188948037 AGCGGGGCGGGGAGGGGAGAGGG - Intronic
967786965 3:193507672-193507694 AGCTGTTTTCTGAGGGGAAATGG + Intronic
1202741406 3_GL000221v1_random:59725-59747 AGCTTTGGTGGGAGGCAAGAGGG - Intergenic
968887348 4:3341656-3341678 GGGTGTGGGGGGAGGGGAGATGG + Intronic
969246753 4:5939610-5939632 AGCTGTGCAGGGTGGGGAGTAGG - Intronic
969365603 4:6692532-6692554 GGCTGTGTTGGGAGAGGTTAGGG + Intergenic
969437033 4:7194152-7194174 ATTTGTATGGGGAGGGGAGATGG + Intronic
969616943 4:8258840-8258862 TGCTGTGGTGGGTGGGGAGGTGG - Intergenic
970042353 4:11810444-11810466 TGATGTGTAGGGAAGGGAGAGGG - Intergenic
970176966 4:13349248-13349270 AGCTGTGGTGGGAGGGGAGAGGG + Intergenic
970317631 4:14845002-14845024 AGCTAGGATGGGAGGGGATAGGG + Intergenic
970865205 4:20750379-20750401 GGCTGTGTTGGAAGGGGACTGGG + Intronic
970993296 4:22237281-22237303 AGAGGTGCTGGGAGGGGAGGTGG + Intergenic
971261683 4:25062983-25063005 GGCTGTGGTGGGAGGGCAGTTGG + Intergenic
971302227 4:25451076-25451098 AGATGTTTTGGGAAGAGAGATGG + Intergenic
971767267 4:30849234-30849256 AGTGGTTTTTGGAGGGGAGAGGG - Intronic
972386379 4:38570402-38570424 AGGTTTGTTGGGATGGGATAGGG - Intergenic
972974143 4:44612903-44612925 AGTTGTGTTGTCAAGGGAGAGGG + Intergenic
973938649 4:55879537-55879559 TGCAGGGTAGGGAGGGGAGATGG + Intronic
975052601 4:69883987-69884009 ACCTGTGATGGGAGGGGATGCGG + Intergenic
975514621 4:75232824-75232846 AGCTGTGAGGAGAGGAGAGACGG + Intergenic
975835055 4:78413876-78413898 CTCTGTCTGGGGAGGGGAGAGGG + Intronic
975864805 4:78715405-78715427 TGATGTGTAGGGAAGGGAGAGGG + Intergenic
976246721 4:83012588-83012610 AGCTGGGTTGCGGGGGGCGAAGG - Intronic
976433769 4:84993228-84993250 TGGTGTGGGGGGAGGGGAGAGGG + Intergenic
976633998 4:87269140-87269162 AGCTATATTGGGAGGATAGAGGG - Intergenic
976998784 4:91468353-91468375 TGGTGTGCAGGGAGGGGAGAGGG + Intronic
977003890 4:91541369-91541391 TGGTGTGCAGGGAGGGGAGAGGG - Intronic
977557134 4:98497750-98497772 AGCTGAGTCTAGAGGGGAGACGG + Intronic
977589101 4:98806897-98806919 AGGGGTGTGGGGAGGGGGGAGGG + Intergenic
977708252 4:100095346-100095368 GGCACTGTTGGGTGGGGAGATGG - Intergenic
978193396 4:105942534-105942556 AGCTCTGTTGGCAGGGGTGGTGG - Exonic
978472210 4:109081652-109081674 GGCTGGGTTGGGGGTGGAGATGG - Intronic
979189131 4:117834868-117834890 ACCCGAGCTGGGAGGGGAGAGGG + Intergenic
979926754 4:126577193-126577215 AACTGTGTTTGGAGGGGTGGAGG - Intergenic
981686358 4:147459058-147459080 ATCTGTGTTGGGATGGCTGAAGG + Intergenic
981730278 4:147889709-147889731 TCCTGTGTTGGGAGGGCAGCTGG + Intronic
982108560 4:152032521-152032543 GGATGTGTGGGGAGAGGAGAGGG + Intergenic
984316275 4:178136831-178136853 AGCTGGGGTCGGAGGGGAGTTGG - Intergenic
984348408 4:178561107-178561129 TGCTGGGTTGGAAGGGGGGAGGG - Intergenic
984583372 4:181535347-181535369 AGGTGTGGTGGGAGTGGAGCAGG - Intergenic
984945885 4:184968549-184968571 TGCTGTTTTTGGTGGGGAGACGG - Intergenic
985021884 4:185700346-185700368 GGCTGTGCTGGGTGGGGGGAGGG + Intronic
985250891 4:188023367-188023389 AGCTGGGTGAGGAGGGGGGATGG + Intergenic
985436023 4:189930230-189930252 TGATGTGTAGGGAAGGGAGAGGG - Intergenic
985680343 5:1252787-1252809 AGCTGGGGTGGCAGGGGTGATGG - Intergenic
985880222 5:2633653-2633675 ATCTGTGTTCAGAGGGCAGAGGG + Intergenic
986302183 5:6486426-6486448 GGCTGTGGTGGGAGAGGACAAGG - Intronic
986365212 5:7022253-7022275 ACCTGAGCTGGGAGGGGAGAGGG + Intergenic
986699576 5:10392814-10392836 AACTGTGGTGGGAGGGAGGAGGG - Intronic
986751381 5:10790905-10790927 GGCTTTGTTGGGAGGTGAGATGG + Intergenic
987206626 5:15634221-15634243 ACCTGTGTGGGGAGGTGGGATGG + Intronic
987282618 5:16426215-16426237 AGCTGTGGTGGCAGGAGAGGGGG + Intergenic
987710819 5:21499133-21499155 AGCTGGCTGGGGAGGGGACAAGG - Intergenic
988550981 5:32200617-32200639 AGTGGAGTTGGGAGGGGGGAAGG + Intergenic
988558657 5:32260683-32260705 AGCTGTGGTGGCAGTGGGGAAGG - Intronic
988635006 5:32973705-32973727 AACTGAGTGGGGAGGGGAAATGG - Intergenic
989081777 5:37630418-37630440 ACATGTCTTGGGAGGGAAGAGGG + Intronic
989231996 5:39097504-39097526 GGGTGTGTTGGGACGGGTGAAGG - Intergenic
989678705 5:44004740-44004762 ACCTGTGTTAGGAGAGGTGAAGG - Intergenic
990314178 5:54568496-54568518 AGCAGTCTGGGGAAGGGAGATGG - Intergenic
990710042 5:58570489-58570511 AGCTGTGTGGAGAAAGGAGAAGG - Intergenic
991761159 5:69918191-69918213 AGCTGGCTGGGGAGGGGACAAGG - Intergenic
991786170 5:70199909-70199931 AGCTGGCTGGGGAGGGGACAAGG + Intergenic
991840387 5:70793241-70793263 AGCTGGCTGGGGAGGGGACAAGG - Intergenic
991878614 5:71200295-71200317 AGCTGGCTGGGGAGGGGACAAGG + Intergenic
992527919 5:77630007-77630029 AGCTGGGTGGGAAGGGAAGAGGG + Exonic
993007279 5:82442204-82442226 AAGGGTATTGGGAGGGGAGATGG + Intergenic
994670019 5:102754075-102754097 AGCTGGGATGGGAGAGGTGAGGG + Intronic
995296951 5:110533998-110534020 TGATGTGTAGGGAAGGGAGAGGG - Intronic
995345879 5:111116768-111116790 AGCTGTGGTGTGTGGGTAGATGG - Intronic
995774762 5:115713101-115713123 ACGTGTTTTGGGAGGGGAGCCGG - Intergenic
995786965 5:115841078-115841100 AGCTGAGTGGGGCGGGGGGAGGG - Intronic
996202977 5:120699135-120699157 TGATGTGTAGGGAAGGGAGAGGG + Intergenic
996866762 5:128132252-128132274 AGGTGTCCTGGGAGAGGAGATGG + Intronic
997112775 5:131093155-131093177 AGGGGTGTGGGGAGGGGGGAGGG + Intergenic
997653784 5:135540558-135540580 AGCTTTCTTGAGAGGTGAGAGGG + Intergenic
997849680 5:137320110-137320132 AGCTGTGCTGGCTTGGGAGAAGG - Intronic
998031120 5:138868985-138869007 GGGTGTTTTGGGAGGGGGGAGGG - Exonic
998511668 5:142718981-142719003 AGCTGGGGTGGGAGGGGGGCCGG + Intergenic
998740676 5:145197488-145197510 AGATGAGTTGGGAAAGGAGAGGG + Intergenic
998819682 5:146047443-146047465 AGATGGGTGGGGTGGGGAGAGGG + Intronic
998855079 5:146386892-146386914 ATCTGTGTTGGGTATGGAGAAGG - Intergenic
998859359 5:146427626-146427648 AGATGTGTGGGTGGGGGAGACGG + Intergenic
998940818 5:147280398-147280420 AGCTGTGTTGGCGGGGGAGGGGG + Intronic
999202541 5:149826516-149826538 AGCTCTGCTGGGTGGGCAGAGGG + Intronic
999988241 5:157024855-157024877 AGGTTTGTTGGGAGGACAGAAGG - Intergenic
1001104899 5:168844502-168844524 GTCTGTGTGGGGAGGAGAGAGGG - Intronic
1001616165 5:173045281-173045303 AGCTGTGGAGAGAGGGGAGCTGG - Intergenic
1002051440 5:176573878-176573900 GGCTGTGTGGGGAGGGGAGGAGG + Intronic
1002074723 5:176701355-176701377 AGCTGTGTAAGGAGGTGAAAAGG + Intergenic
1002336922 5:178485916-178485938 AGCAGTGGTGGGAGGGGTGCCGG + Intronic
1002436173 5:179232993-179233015 ATCTGTGTCGGGAGGCGGGAAGG + Intronic
1002969365 6:1997893-1997915 AGCTGAGTAGGCAGGGGAAACGG + Intronic
1003153194 6:3570097-3570119 AGATGTGGAGGGAGAGGAGAGGG - Intergenic
1003213119 6:4085665-4085687 AGGTGTTTTTGGTGGGGAGAAGG - Intronic
1003458440 6:6306660-6306682 AGGTGGGGTGGGAGGGTAGAAGG + Intronic
1003487072 6:6588949-6588971 AGTTGGGGTGGGAGGGGAGAGGG + Intronic
1004511320 6:16286303-16286325 AGCGGTGGTGGGAGGGCAGCAGG + Intronic
1004660434 6:17705577-17705599 GGCGGTGTTGGGGGGGGGGAGGG + Intronic
1005019784 6:21406761-21406783 AGGTGTGTTGGCTGGGGAGCCGG - Intergenic
1005046996 6:21652290-21652312 TGATGTGTGGGGAGGGGAGATGG + Intergenic
1005066945 6:21827545-21827567 ACCTGTGATGAGAGGGGAAAAGG + Intergenic
1005546868 6:26881370-26881392 AGCTGGCTGGGGAGGGGACAAGG + Intergenic
1005631049 6:27708395-27708417 AGATGTTTGGGGAGGGCAGATGG - Intergenic
1006502373 6:34466753-34466775 AGCTGGGATGGGAGCGGGGAGGG + Intronic
1006503802 6:34475228-34475250 AGCTCTGTGGGCAGGGGTGAGGG - Intronic
1006803905 6:36776520-36776542 GGCAGTGGTGGGAGGGGAGCTGG + Intronic
1006909698 6:37555849-37555871 AGGTGGGGTGGGTGGGGAGACGG + Intergenic
1007211338 6:40195487-40195509 AACAGTGGAGGGAGGGGAGATGG - Intergenic
1007298320 6:40845816-40845838 AGCTGAGCTGGGAGTGGAAATGG - Intergenic
1007410030 6:41656141-41656163 AGCTGGGTTGGGGCGGGACAGGG + Intergenic
1007753926 6:44086693-44086715 AGGTGTGGTGGCAGGGGAGAGGG + Intergenic
1008192472 6:48476259-48476281 AGCTGTCTGGGGCTGGGAGAGGG - Intergenic
1008265873 6:49425759-49425781 AGCTGGGAGGGGAGGGGAAAAGG - Intergenic
1008476913 6:51942878-51942900 TGATGTGTAGGGAGGGGAGGGGG - Intronic
1008525969 6:52407250-52407272 TGCAGTGTAGGGAGAGGAGATGG + Exonic
1008717770 6:54310013-54310035 AGGTGTGGAGGGAGGGAAGAAGG - Intronic
1009017623 6:57922452-57922474 AGCTGGCTGGGGAGGGGACAAGG + Intergenic
1009351846 6:62690057-62690079 GGCGGTGGTGGGAGGGGGGAGGG + Intergenic
1010247617 6:73676449-73676471 AGCTGGGGTGGAAGGAGAGAGGG - Intergenic
1010675902 6:78742570-78742592 TGCGGTGCAGGGAGGGGAGAAGG + Intergenic
1010810027 6:80290248-80290270 GGCTGGGGTGGGAGGGGAGCAGG + Intronic
1011004506 6:82628954-82628976 GGCAGTGTTGGGAGGGGAAGGGG + Intergenic
1012535629 6:100293231-100293253 ATGGGTCTTGGGAGGGGAGAGGG - Intergenic
1013422258 6:109977982-109978004 AGCTGGGAGGGGAGGGGTGAAGG - Intergenic
1013582795 6:111552641-111552663 AGCTGGGGAGAGAGGGGAGAGGG - Intergenic
1013731432 6:113172801-113172823 TTCTGTGTTGGGAGGGGAGAGGG + Intergenic
1014541273 6:122679214-122679236 ACCTGTGTTTGGAGGTGAAAGGG + Intronic
1015262950 6:131259411-131259433 AGCTTAGCTGGGAGGAGAGAAGG + Intronic
1015365145 6:132388925-132388947 AGGTGTGTAGGAATGGGAGAGGG + Intronic
1015837154 6:137432712-137432734 GGCTGTGGTGGGAGGTGGGAGGG + Intergenic
1016329265 6:142939506-142939528 ACCTGGGATGGGAGGGGACAGGG - Intronic
1016430287 6:143977080-143977102 AAGTGTGTTGGGGGGGGGGAAGG - Intronic
1016435099 6:144028452-144028474 AGATGTGGTGGGAGGGGAGCAGG + Intronic
1016501639 6:144726989-144727011 AGGGGTGTGGGGAGGGAAGAGGG - Intronic
1016603482 6:145890569-145890591 AGCTGTTCTAGGAGAGGAGAAGG - Intronic
1017413519 6:154195032-154195054 AGCTGAGGTGGCAGTGGAGACGG - Intronic
1017558101 6:155595307-155595329 AGATGTGTTGGGAGGGCTAAAGG + Intergenic
1018889880 6:167976193-167976215 TGCAGTGTTGGGGGAGGAGAAGG + Intergenic
1019194729 6:170274509-170274531 AGGTGTGTGGGGTGGGGAGCAGG + Intergenic
1019745777 7:2699794-2699816 AGCTCTGCAGGGAGGGGAGGAGG + Intronic
1019928384 7:4207969-4207991 AGCTGTGCTGGGTGGGAAGGTGG - Intronic
1020401980 7:7789614-7789636 GGGTCTGTGGGGAGGGGAGAAGG - Intronic
1021622537 7:22562853-22562875 AGCTGTATTGTGAGGGGGCAGGG - Intronic
1022470717 7:30680522-30680544 AGCTGTGTGGGGTGGGGCAATGG - Intronic
1023062698 7:36343495-36343517 AGATGGGAGGGGAGGGGAGATGG + Intronic
1023062704 7:36343507-36343529 AGGGGAGATGGGAGGGGAGAGGG + Intronic
1023346048 7:39272299-39272321 AACTGTGATGGGAGTGGAGGAGG - Intronic
1023385704 7:39655400-39655422 ATCAGTGTATGGAGGGGAGATGG + Intronic
1023987199 7:45103577-45103599 AGCTGTGTCGGGAACAGAGAAGG + Intronic
1024037525 7:45521243-45521265 TCCTGTCTTGGGAGAGGAGAAGG + Intergenic
1024051674 7:45627701-45627723 AGCTGAGTTGGGCTGGGAGCAGG + Intronic
1024609576 7:51053048-51053070 ATATGTGCTGGGAAGGGAGAGGG - Intronic
1024971765 7:55078165-55078187 TGGCGTGTGGGGAGGGGAGAAGG + Intronic
1025273669 7:57552285-57552307 TGGGGTGGTGGGAGGGGAGAGGG + Intergenic
1026197826 7:68188241-68188263 GTGTGTGTTGGGAAGGGAGAGGG - Intergenic
1028012286 7:85662100-85662122 GCCTGTCGTGGGAGGGGAGAGGG - Intergenic
1028248523 7:88512164-88512186 AGCTGTCCTGGGAGGGGCGGGGG + Intergenic
1028342608 7:89740685-89740707 AGGTGTGTTAGGGGAGGAGATGG - Intergenic
1028589485 7:92480396-92480418 TGATGTGTAGGGAGGGGAGGGGG + Intergenic
1029451278 7:100642867-100642889 AGTTGTGGTGGGAGGTGGGAGGG - Intergenic
1029464123 7:100714846-100714868 TTCTGTGCTGGGAGGGGAGGTGG - Intergenic
1030015992 7:105221716-105221738 AGATGGGTTGAGTGGGGAGAGGG - Intronic
1030828565 7:114191680-114191702 AACTGTGTTGGGAGAGGAAAAGG - Intronic
1032977458 7:137241940-137241962 AACTGTGTTGAGAGAGGTGAGGG - Intronic
1033320041 7:140331174-140331196 GTCTGTGTGGGGAGGGGAGAAGG + Intronic
1033531297 7:142266546-142266568 AGGTGAGTAGGGAGAGGAGAGGG + Intergenic
1033911472 7:146268594-146268616 AGCTGTTTTGGTGGTGGAGATGG - Intronic
1034146142 7:148873920-148873942 AACTTGGTTGGGATGGGAGAGGG + Intronic
1034263895 7:149772495-149772517 AGGGGTGTTCGGAGGGGAGACGG - Intronic
1034275656 7:149822752-149822774 GGCTGTGAGGGGAGGGGAGCAGG - Intergenic
1034334778 7:150314093-150314115 AGCTGTGGTGGTAGGGGTGATGG + Intronic
1034542939 7:151770638-151770660 AGGTGTGCTGGGAGGAGTGAGGG + Intronic
1034692938 7:153028508-153028530 AGGGCTGGTGGGAGGGGAGAGGG - Intergenic
1034760235 7:153665533-153665555 TTCTGTTTTGGGAGGGGAGGGGG + Intergenic
1034936645 7:155204375-155204397 AGGTGTGCTGGGGGGGCAGAGGG + Intergenic
1035026995 7:155832662-155832684 AGCTGGGCTGGGAGGAGAGCTGG + Intergenic
1035300980 7:157896988-157897010 GGCTGTGGTGGGTGGGGAGGTGG - Intronic
1035399489 7:158555495-158555517 CCCTGTGTTGGGATGGGACATGG - Intronic
1035401280 7:158567622-158567644 AGCTGTCTTGGGCGGGGACATGG + Intronic
1035615852 8:1000851-1000873 AGGTGTGGGGGGAGAGGAGAGGG + Intergenic
1035678755 8:1472218-1472240 CGCCATGTTGGGAGGGGAGGGGG + Intergenic
1035768451 8:2127263-2127285 ACCTGACTGGGGAGGGGAGATGG + Intronic
1036293721 8:7518136-7518158 CACTGGGTGGGGAGGGGAGAGGG - Intergenic
1036328840 8:7802859-7802881 CACTGGGTGGGGAGGGGAGAGGG + Intergenic
1036392545 8:8336884-8336906 AGGGGTGTGGGGAGGGGAGTGGG - Intronic
1036457073 8:8919110-8919132 AGAAGTGTTGGGGGGGGAGCGGG - Intergenic
1036470406 8:9047742-9047764 TGCTCTGTTGGAAGGGGAGAGGG - Intronic
1036700352 8:11009079-11009101 AGCTGTGTGGGGAGGGGGGTGGG + Intronic
1037594082 8:20339964-20339986 ATCTGTGGTGGTAGGGGACAGGG + Intergenic
1040109254 8:43559259-43559281 AGATGTGTGGGGAAGGGATAAGG + Intergenic
1041581630 8:59466165-59466187 TGCGGTGGGGGGAGGGGAGAGGG + Intergenic
1042253717 8:66781938-66781960 ATGTGTGAGGGGAGGGGAGAAGG + Intronic
1043267742 8:78287633-78287655 GTATGTGTTGGGAGGGTAGAGGG - Intergenic
1043589231 8:81808461-81808483 AGCTGTGGTGGTGGGGGATATGG + Intronic
1043682303 8:83043875-83043897 AGGGGTGGGGGGAGGGGAGAGGG - Intergenic
1045654968 8:104377201-104377223 AACAGTGGGGGGAGGGGAGAGGG + Intronic
1046694255 8:117320877-117320899 ACCTGAGTGGGGAGGGTAGAAGG + Intergenic
1047610789 8:126518833-126518855 AGCTGTGGAGGGATGAGAGATGG - Intergenic
1048152490 8:131907815-131907837 AGATGGGAGGGGAGGGGAGAAGG - Intronic
1048461080 8:134622633-134622655 AGCTGGGTGGAGAGGGGGGAGGG - Intronic
1049069164 8:140343890-140343912 AGCTGAGTGTGGAGGGCAGAGGG + Intronic
1049299150 8:141860684-141860706 ACAGGTGTTGGGAGGGGACAGGG - Intergenic
1049397064 8:142405804-142405826 AGCTGTGCTGGGAGCAGAGCAGG - Intergenic
1050296119 9:4207184-4207206 CTCTGTGTCGGGAGGGGAGGTGG - Intronic
1051735113 9:20189924-20189946 TGCTGGGAGGGGAGGGGAGATGG + Intergenic
1051842532 9:21414571-21414593 AGCTGGGTTGGGAGTGTAGGGGG - Intronic
1052228746 9:26121371-26121393 AGCTGGGTCGGCAGTGGAGACGG + Intergenic
1052442623 9:28517226-28517248 AGCTGTGGTGGGGGTGGAGGGGG - Intronic
1053169820 9:35870430-35870452 AGCTGGGATGGAAGGAGAGAGGG + Exonic
1053345739 9:37376991-37377013 GGTTGTGGTGGGAGAGGAGATGG + Intergenic
1053653102 9:40189187-40189209 AGTTGTGTTTGGAGGGGACTGGG - Intergenic
1053903505 9:42818490-42818512 AGTTGTGTTTGGAGGGGACTGGG - Intergenic
1054355414 9:64056711-64056733 AGGTGTGCTGGGAGTGGAGGGGG + Intergenic
1054531482 9:66187036-66187058 AGTTGTGTTTGGAGGGGACTGGG + Intergenic
1055648187 9:78380518-78380540 AGCTGTGTTGGGATGAGGGGTGG - Intergenic
1056246465 9:84700391-84700413 ATGTGTGGTGGGAGGAGAGAAGG + Intronic
1056596613 9:88012992-88013014 AGCTGGGTTTGCAGGGGTGAAGG - Intergenic
1056743462 9:89280067-89280089 AGCTGGGGTTGGAGGGTAGATGG - Intergenic
1056760180 9:89408937-89408959 AGCTGCCATGGGATGGGAGAAGG + Intronic
1057143354 9:92741233-92741255 ATCTGTGTTGGGCGTGGAGTTGG - Intronic
1057384967 9:94598908-94598930 AGGGGTGTGGGGAGGGGACAGGG + Intergenic
1057553453 9:96068866-96068888 ATGTGAGTGGGGAGGGGAGAGGG - Intergenic
1057776905 9:98018768-98018790 AGGGGTGTTGGGAGGGCATATGG + Intergenic
1059441853 9:114312238-114312260 AGAAGTGTTGGGAGGGGGGACGG - Exonic
1059954525 9:119501772-119501794 ATGTGTGTTGGGAGGGGATGGGG - Intronic
1060044762 9:120331151-120331173 TGTTGTGTTGGGAGGGAAGATGG - Intergenic
1060149032 9:121275610-121275632 TACTGTGGTGGGAGGGGAGGTGG - Intronic
1060799076 9:126532309-126532331 CTCTGGGCTGGGAGGGGAGAGGG - Intergenic
1060801433 9:126548003-126548025 AGCTTTGGTAGGAGAGGAGAGGG - Intergenic
1061998737 9:134205017-134205039 AGCAGTGTTGGGACGGAAGCAGG - Intergenic
1062609881 9:137369015-137369037 AGCCGTGTGGGGAGGGGCGCAGG + Intronic
1062721043 9:138044208-138044230 AGGTGTGATGGGAAGGCAGATGG - Intronic
1202796824 9_KI270719v1_random:128160-128182 GGCTGTTGTGGGTGGGGAGAGGG + Intergenic
1203743743 Un_GL000218v1:25808-25830 AGGTGTGCTGGGAGTGGAGGGGG + Intergenic
1203441249 Un_GL000219v1:10585-10607 TCCTGTGGTGGGACGGGAGAAGG + Intergenic
1203512058 Un_KI270741v1:129493-129515 TCCTGTGGTGGGACGGGAGAAGG + Intergenic
1203710044 Un_KI270742v1:89649-89671 AGCTTTGGTGGGAGGCAAGAGGG - Intergenic
1203566366 Un_KI270744v1:93727-93749 AGGTGTGCTGGGAGTGGAGGGGG - Intergenic
1203625359 Un_KI270750v1:12926-12948 TGGGGTGGTGGGAGGGGAGAGGG + Intergenic
1185891037 X:3822323-3822345 AGCTGTGTAGGCAGGGGACTTGG + Intronic
1185896141 X:3860739-3860761 AGCTGTGTAGGCAGGGGACTTGG + Intergenic
1185901260 X:3899165-3899187 AGCTGTGTAGGCAGGGGACTTGG + Intergenic
1185906372 X:3937601-3937623 AGCTGTGTAGGCAGGGGACTTGG + Intergenic
1185912949 X:4002435-4002457 AGATGTTTTGAGAGGTGAGAGGG - Intergenic
1186351779 X:8747526-8747548 AGCGGTGGGGGGAGGGGGGAGGG - Intergenic
1186417940 X:9399858-9399880 GGCAGTGTTGAGGGGGGAGATGG - Intergenic
1186487898 X:9947655-9947677 AACTGTGATGTGAGGTGAGAAGG - Exonic
1186502996 X:10066792-10066814 AGCTATGGTGGGAGGAGACAAGG + Intronic
1186516674 X:10171458-10171480 AGTTGATTTGGGAGGGGAGTGGG + Intronic
1186917952 X:14244128-14244150 AGCTGTTGGGGGAGGGGAGGGGG - Intergenic
1187906372 X:24070380-24070402 AGCTGTGTCTTGAGGGGAGTAGG - Intronic
1188200544 X:27289755-27289777 TGCTGTGTAGGGAAGGGAGGGGG + Intergenic
1188655686 X:32692532-32692554 TCCTGTGTTGGGAGGGGATGAGG - Intronic
1188875653 X:35427109-35427131 AGCTGCTTGGGGATGGGAGAGGG - Intergenic
1188878976 X:35468666-35468688 GGCAGTGTGGGGAGGGGAGGAGG + Intergenic
1189234440 X:39476720-39476742 AGCAGTGCTGGGAAGGGAGTGGG + Intergenic
1189275410 X:39781733-39781755 AGCTGAGGTGGGAGGTGAGGTGG - Intergenic
1189718896 X:43894602-43894624 AGCTGTGTTGGCAGGAGACTGGG + Intergenic
1189844259 X:45118019-45118041 AGTTGAATTGGGAGGGAAGAGGG - Intergenic
1190032096 X:46983642-46983664 ATCTTTGCTGGGAGGGAAGATGG + Intronic
1190868105 X:54401595-54401617 AGGGGGGTTGGGAGGGGAGGTGG - Intergenic
1191865083 X:65697448-65697470 AGCTGTTTAGAGAGGAGAGAAGG + Intronic
1192138942 X:68631141-68631163 AGGTCTGTTGAGAGGGTAGACGG - Intergenic
1192244787 X:69363154-69363176 AGCTGTGTGGGGATGAGACACGG + Intergenic
1192442417 X:71184423-71184445 ACGTGTGTTGAGAGGGGAGGAGG - Intergenic
1192546740 X:72020596-72020618 AGCTTTCTAGGGAGGGGGGAAGG + Intergenic
1192674194 X:73177354-73177376 TGCGGTGGGGGGAGGGGAGAGGG + Intergenic
1193323319 X:80150165-80150187 TGCTGTATTGGGAGGGGGCAAGG + Intergenic
1194995973 X:100591780-100591802 AGTTTTTTTGGTAGGGGAGAAGG - Intronic
1195691608 X:107630407-107630429 GGCTATATTGGGAGAGGAGAGGG + Intronic
1196324602 X:114388717-114388739 TGGTGTGGTGGGAGGGGAGGTGG - Intergenic
1198162770 X:134024019-134024041 AGCGGGGTGGGGATGGGAGAGGG - Intergenic
1198295637 X:135283755-135283777 AGGTTTCTTGGGAGTGGAGAAGG + Intronic
1198677593 X:139147320-139147342 AGATGTGTGTGGTGGGGAGATGG - Intronic
1198852084 X:140975435-140975457 CACTGTGTTGGGAGGGCAGGTGG + Intergenic
1200068042 X:153514341-153514363 AGCAGTTGTGGGAGGGGAGCGGG + Intergenic
1201146018 Y:11066238-11066260 AACTGTGTGGGTAGGTGAGAGGG + Intergenic
1201157068 Y:11140789-11140811 AGGTGTGCTGGGAGTGGAGGGGG + Intergenic