ID: 945092628

View in Genome Browser
Species Human (GRCh38)
Location 2:206189817-206189839
Sequence TGTCCCAAATACCACCCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 662
Summary {0: 1, 1: 0, 2: 3, 3: 66, 4: 592}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945092628 Original CRISPR TGTCCCAAATACCACCCCCT GGG (reversed) Intronic
900270497 1:1784801-1784823 TGTCCCAAATAGCCGCTCCTAGG - Intergenic
900777749 1:4597136-4597158 TCTCCCAAATACAAGTCCCTGGG - Intergenic
900780454 1:4614379-4614401 CGTCCCCACTTCCACCCCCTTGG - Intergenic
901639803 1:10687477-10687499 TGGCCCACATACCACGCCCGGGG + Intronic
901839895 1:11947670-11947692 TGACCCAAACACCTCCCACTGGG + Intronic
902818244 1:18928185-18928207 TGCCCCAAGCCCCACCCCCTGGG + Intronic
904544428 1:31257338-31257360 TGACCCAAATACCTCCACCTAGG - Intergenic
904580624 1:31541262-31541284 TGACCCAAACACCTCCCACTAGG + Intergenic
905359847 1:37411604-37411626 TGACCCAAACACCTCCCACTAGG - Intergenic
905965579 1:42092668-42092690 TGACCCAAACACCACCCATTAGG + Intergenic
906098604 1:43241238-43241260 TGACCCAAATACCTCCCTCTAGG + Intronic
906170753 1:43722978-43723000 TGACCCAAAGACCTCCCACTAGG - Intronic
907825836 1:58016003-58016025 TATCTCAACTACCCCCCCCTAGG - Intronic
908199523 1:61780030-61780052 TGACCCAAACACCTCCCACTGGG + Intronic
908469979 1:64434226-64434248 TGACCCAAATACCTCCCATTTGG - Intergenic
909303576 1:74044295-74044317 TGTCCCAAACACCTCTCACTAGG - Intronic
909884197 1:80920161-80920183 TGACCTAAATACCTCCCACTAGG + Intergenic
910270426 1:85388077-85388099 TGACCCAAACACCTCCCACTAGG + Intronic
910633273 1:89379309-89379331 TGACCCAAACACCTCCCACTAGG + Intronic
911071897 1:93838460-93838482 TTACCCAAATACCCCCCACTAGG + Intronic
911393336 1:97274248-97274270 TGGCCCAAATATAACCCACTGGG - Intronic
912025175 1:105160993-105161015 TGACCCAAATAACTCCCACTGGG + Intergenic
913990763 1:143609551-143609573 TGTCCCCAGTACCAGGCCCTAGG + Intergenic
914235467 1:145806558-145806580 TGACCTAAATACCTCCCACTAGG - Intronic
914954252 1:152146878-152146900 TGACCCAAACACCTCCCACTAGG + Intergenic
914954569 1:152149279-152149301 TGACCCAAATACCGCCCACTAGG + Intergenic
916032643 1:160891627-160891649 GGTCCCAAACTCCACCTCCTGGG - Intergenic
916269870 1:162928919-162928941 TGTCTCAAATGTCACCTCCTTGG - Intergenic
916419310 1:164621451-164621473 TGTACTAAATAGCACCCCCCAGG - Intronic
916532253 1:165668258-165668280 TGACCCAAACACCTCCCACTAGG - Intronic
917410978 1:174759884-174759906 TGACCCAAACACCTCCCACTCGG + Intronic
917476269 1:175371977-175371999 TGACCCAAACACCTCCCACTGGG - Intronic
918540056 1:185622196-185622218 TGACCCAAACACCTCCCACTTGG + Intergenic
919176231 1:194021947-194021969 TGTCCCAAACACCCCCCACCAGG - Intergenic
919176942 1:194030928-194030950 TGACCCAAATACCTCCCACTAGG - Intergenic
919199506 1:194336594-194336616 TGACCCAAACACCTCCCACTAGG + Intergenic
919472640 1:197998130-197998152 TGACCCAAATACCTCCCACAAGG - Intergenic
919577594 1:199331055-199331077 TGACCCAAACACCTCCCCCAGGG + Intergenic
919598135 1:199590057-199590079 TGACCCAAACACCTCCCACTAGG - Intergenic
919763478 1:201112399-201112421 TGTCCCCAATGCCCCCGCCTTGG + Exonic
919819953 1:201466537-201466559 TCTCCCCACTACCACCTCCTAGG - Intronic
920371502 1:205482052-205482074 TGCCCCAAATACGGCCCCCCGGG - Intergenic
920831148 1:209466940-209466962 TGGCCCAAATACCTCCCACTGGG + Intergenic
921419949 1:214934762-214934784 TCTCCCAAATACAACCCCAAAGG - Intergenic
921661640 1:217809695-217809717 TGACCCAAACACCTCCCACTAGG + Intronic
921730944 1:218577238-218577260 TGACCCAAAAACCCCCCACTAGG - Intergenic
921812331 1:219529253-219529275 TGACCCAAATACCTCCCACTAGG + Intergenic
921887269 1:220319620-220319642 TGACCCAAATACTTCCCACTAGG - Intergenic
921917888 1:220633177-220633199 TGACTCAAATACCTCCCTCTAGG + Intronic
922349200 1:224721963-224721985 TTTCCCACACACCACCCCGTGGG - Intronic
923150188 1:231226143-231226165 TGACCCAAACACCTCCCACTAGG - Intronic
923385967 1:233465641-233465663 TGACCTAAACACCACCCACTAGG - Intergenic
923651517 1:235878416-235878438 TCTCCCTGATTCCACCCCCTTGG + Intronic
923774130 1:236963239-236963261 TGACCCAAATACCCCTCACTAGG + Intergenic
924514954 1:244758126-244758148 TGTCCCAATTACAAGCTCCTGGG - Intergenic
1062917238 10:1250322-1250344 TGACCCAAACACCTCCCACTAGG - Intronic
1063347880 10:5328077-5328099 TGGCCCAAACACCTCCCCCTAGG + Intergenic
1063525108 10:6778019-6778041 TGACCCAAACACCTCCCACTGGG + Intergenic
1063544317 10:6965305-6965327 TGTAACAAATACCACACGCTGGG + Intergenic
1063767473 10:9159394-9159416 TGACCCAAACACCTCCCACTAGG - Intergenic
1064311621 10:14217200-14217222 TGTCCCAAACATCAATCCCTAGG + Intronic
1064574460 10:16730240-16730262 TGTCCCAAAGACCTCCCACCAGG + Intronic
1064722440 10:18243555-18243577 TGAACCAAACACCACCCACTAGG - Intronic
1064944445 10:20772089-20772111 TGACCCAAACACCTCCCACTAGG - Intergenic
1065436184 10:25706056-25706078 TCTCCCAAACACCAGCCCTTGGG - Intergenic
1066066345 10:31763873-31763895 TGACCCAAACACCACCCACCAGG - Intergenic
1066633147 10:37476537-37476559 TATCCCAAACACCTCCCACTAGG - Intergenic
1067023898 10:42827029-42827051 TGACCCAAATACCTCCCACTAGG - Intronic
1067137754 10:43626312-43626334 TGACCCAAATACCTCCCACCAGG - Intergenic
1067695082 10:48528672-48528694 TGACCCAAATACCTCCCACTAGG - Intronic
1067880753 10:50042590-50042612 TGACCCAAACACCTCCCACTAGG + Intergenic
1068381493 10:56259431-56259453 TAACCCAAATACCTCCCACTAGG + Intergenic
1068712669 10:60151285-60151307 TGACCCAAACACCTCCCACTAGG - Intronic
1069352653 10:67548059-67548081 TGACCCAAACACCTCCCACTGGG - Intronic
1069804879 10:71115645-71115667 TGACCCAAACACCTCCCACTAGG - Intergenic
1071913476 10:90263116-90263138 TGACCCAAACACCTCCCACTAGG - Intergenic
1072280393 10:93860665-93860687 TGTCCCAAACACCTCCCTCTAGG - Intergenic
1072935814 10:99712123-99712145 TGACCCAAATACCTCCTACTAGG + Intronic
1075354698 10:121760952-121760974 TGACCCAAACACCTCCCACTGGG - Intronic
1075662468 10:124207591-124207613 TGTAACAAATACCACACACTTGG + Intergenic
1076251133 10:128984595-128984617 TGACCCAAACACCTCCCCTTAGG - Intergenic
1077956338 11:7023933-7023955 TTACCCAAATACCACCCACCAGG + Intronic
1078171887 11:8934282-8934304 TGTGCCAAATAACTCCGCCTTGG - Intergenic
1079506718 11:21161275-21161297 TGTCCATAATACCAGCACCTTGG + Intronic
1080572828 11:33571707-33571729 TGACCCAAATACCTCCCACCGGG + Intronic
1080998295 11:37633595-37633617 TGACCCAAATACCTGCCACTAGG - Intergenic
1081071064 11:38608829-38608851 TGACCCAAACACCCCCCACTAGG + Intergenic
1081404683 11:42683348-42683370 TGACCCAAATACCTCCCACCAGG - Intergenic
1082862227 11:57867662-57867684 TGACCCAAATACCTCCCACCAGG + Intergenic
1084498539 11:69520501-69520523 TGACCCAAACACCTCCCCCCAGG + Intergenic
1084768082 11:71325330-71325352 TGTCCCAACTCCCCCCACCTGGG + Intergenic
1085750110 11:79154412-79154434 TGTCCCAAACACCTCCCACTAGG + Intronic
1086729177 11:90227232-90227254 TGACCCAAATACCTCCCACCAGG + Intergenic
1087301004 11:96435265-96435287 TGACCCAAATATCTCCCACTGGG + Intronic
1087369645 11:97266626-97266648 TGACCCAAATACCTCCCGTTAGG + Intergenic
1087393757 11:97570886-97570908 TGATCCAATTACCACCCACTAGG + Intergenic
1087936821 11:104043863-104043885 TGACCCAAACACCTCCCACTAGG + Intronic
1088019420 11:105101372-105101394 TGTCCCAAAAACAGGCCCCTGGG - Intronic
1088124155 11:106403902-106403924 TGACCCAAATACCTCCTACTAGG - Intergenic
1089668797 11:120037714-120037736 TGACCCAAATACCTCCCATTAGG - Intergenic
1089939903 11:122405269-122405291 TGTCCCAAACACCCCCCACCAGG + Intergenic
1091285225 11:134405144-134405166 TGTGGCAAATGCCACCCCCGTGG - Intronic
1091356017 11:134938379-134938401 TGACCCAAACACCTCCCACTAGG + Intergenic
1091989837 12:4946514-4946536 TGACCCAAACACCTCCCACTAGG + Intergenic
1092310448 12:7345991-7346013 TGACCCAAATACCTCCCACTAGG + Intergenic
1093478487 12:19580928-19580950 TGACCCAAATACCTCCCACTAGG - Intronic
1093637989 12:21494256-21494278 TGACCCAAACACCTCCCACTAGG + Intronic
1093730398 12:22559661-22559683 TAACCCAAATTCCTCCCCCTAGG - Intergenic
1093734254 12:22601980-22602002 TGACCCAAATACCTCCCTATAGG - Intergenic
1094156905 12:27346828-27346850 TGACCCAAATACCTCCCATTAGG - Intronic
1095709845 12:45276543-45276565 TGTCTCAAATATCACCCCTCAGG + Intronic
1096034180 12:48449886-48449908 TGACTCAATTACCTCCCCCTGGG - Intergenic
1096755972 12:53799837-53799859 TGACCCAAATACCTCCCATTAGG + Intergenic
1097710712 12:62914102-62914124 TGACCCAAACACCTCCCACTAGG - Intronic
1097923787 12:65105758-65105780 TGACCCAAACACCTCCCACTGGG + Intronic
1098120926 12:67237271-67237293 TGGCCCAAACACCACCCATTAGG - Intergenic
1098159021 12:67630156-67630178 TGTCCCAAATACCTGCCTCCAGG + Intergenic
1098296903 12:69013045-69013067 TGACCCAAACACCTCCCACTAGG - Intergenic
1101214962 12:102572071-102572093 TGACCCAAACACCTCCCACTAGG - Intergenic
1101274877 12:103188561-103188583 TGGCCCAAACACCTCCCACTAGG - Intergenic
1101420028 12:104543288-104543310 TGACGCAAACACCTCCCCCTAGG + Intronic
1101703152 12:107194158-107194180 TGACCCAAAAACCTCCCACTAGG + Intergenic
1101844808 12:108354553-108354575 TGACCCAAACACCTCCCTCTAGG + Intergenic
1102962255 12:117100278-117100300 TGTCCCAAATGCAGCCTCCTGGG - Intergenic
1103023252 12:117553678-117553700 TGACCCAAGTACCTCCCACTAGG - Intronic
1103829476 12:123767499-123767521 TGGGCCACATACCAACCCCTTGG + Intronic
1104112175 12:125714379-125714401 TGACCCAAATACCTCCCACTAGG - Intergenic
1104364230 12:128162521-128162543 TGACTCAATTACCTCCCCCTGGG - Intergenic
1105446960 13:20465832-20465854 TGACCCAAACACCTCCCTCTGGG - Intronic
1106130688 13:26936889-26936911 TGACCCAACTACCTCCCACTAGG - Intergenic
1106215345 13:27692873-27692895 CTTCCCAACTACCACCACCTTGG - Intergenic
1106861303 13:33911809-33911831 TGACCCAAATACCTCCCACTAGG + Intronic
1107119646 13:36782139-36782161 TGACCCAAACACCTCCCACTAGG + Intergenic
1107139920 13:36987391-36987413 TGACCCAAACACCTCCCACTGGG - Intronic
1107667994 13:42712677-42712699 TGATCCAATTACCTCCCCCTGGG + Intergenic
1107777750 13:43864657-43864679 TGACCCAAACACCTCCCACTGGG + Intronic
1107998654 13:45886881-45886903 TGACCCAAACACCTCCCACTAGG + Intergenic
1108031298 13:46232194-46232216 TGACCCAAACACCTCCCTCTGGG + Intronic
1108392832 13:49964526-49964548 TGACCCAAATACCTCCCACCAGG - Intergenic
1109811719 13:67520985-67521007 TGACTCAAATACCTCCCACTAGG - Intergenic
1109870067 13:68322352-68322374 TGAGCCAATTACCTCCCCCTGGG + Intergenic
1110278220 13:73662323-73662345 TCTCCCAAATCCCACATCCTGGG - Intergenic
1110301598 13:73935462-73935484 TGACCCAAACACCTCTCCCTAGG - Intronic
1110551927 13:76820387-76820409 TGACCCAAATGCCTCCCCCTAGG + Intergenic
1110758647 13:79205306-79205328 TGACCCAAATACCTCCCACCAGG + Intergenic
1110994446 13:82087972-82087994 TGACCCAAATACCTCCCACCAGG + Intergenic
1111527428 13:89491187-89491209 TGACCCAAATACCTCCTCTTAGG - Intergenic
1112008325 13:95273365-95273387 GGTCCCAAATAACACCCTCTAGG + Intronic
1112182938 13:97103302-97103324 TGACCCAAACACCTCCCACTAGG + Intergenic
1112356332 13:98677221-98677243 TGACCCAAACACCTCCCACTGGG - Intergenic
1112998327 13:105601116-105601138 TGACCCAAACACCTCCCACTAGG + Intergenic
1113092168 13:106627649-106627671 TGTCCCATTTCCCACCCTCTAGG - Intergenic
1115151126 14:30286916-30286938 TGACCCAAATACCTCCCACTAGG + Intergenic
1115309089 14:31961509-31961531 TGACCCAAACACCTCCCACTAGG + Intergenic
1115469720 14:33756013-33756035 TGACCCAAACACCTCCCACTAGG + Intronic
1115597632 14:34924463-34924485 TGACCCAAATACCTCCCACCAGG - Intergenic
1115889426 14:38010588-38010610 TGACCCAAACACCTCCCACTGGG - Intronic
1116256618 14:42564727-42564749 TGACCCACATACCTCCCACTAGG - Intergenic
1116364059 14:44038673-44038695 TGACCCAAACACCTCCCACTAGG - Intergenic
1116539969 14:46089808-46089830 TGACCCAAACACCTCCCCTTAGG + Intergenic
1117070294 14:52049932-52049954 GGTGCCAAAGACCATCCCCTGGG - Intronic
1117610798 14:57481070-57481092 TGTTCCAAATTCCTCCCTCTAGG - Intronic
1117805886 14:59490326-59490348 TGACCCAAATACTTCCCACTAGG + Intronic
1117933394 14:60872300-60872322 TGACCCAAACACCTCCCACTAGG + Intronic
1118103321 14:62629811-62629833 TGACCCAAACACCACCCACTAGG - Intergenic
1118418020 14:65565268-65565290 TAACCCAAATACCTCCCACTAGG + Intronic
1118647091 14:67850965-67850987 TGCCCCAAAAACCACTCCCCTGG - Intronic
1118942991 14:70355807-70355829 TGACCCAAACACCTCCCACTAGG - Intronic
1119308053 14:73623719-73623741 TGACCCAAACACCACCCATTAGG - Intergenic
1119326481 14:73762520-73762542 TATACCAAATAGCCCCCCCTTGG + Intronic
1119364184 14:74077681-74077703 TGACCCAAACACCTCCCACTAGG + Intronic
1120049375 14:79847492-79847514 TGTCCCCCATGCCAACCCCTGGG + Intronic
1120231215 14:81843614-81843636 TGACCCAAACACCTCCCACTAGG + Intergenic
1120515317 14:85463634-85463656 TGATCGAAATACCTCCCCCTAGG - Intergenic
1120724519 14:87922903-87922925 TGACCCAAATACCTCCCACTAGG + Intronic
1121467741 14:94126882-94126904 TGACCCAAACACCTGCCCCTAGG - Intergenic
1122542680 14:102506902-102506924 TGTCCCAAAATCCAGCGCCTAGG + Exonic
1123425045 15:20164077-20164099 TGACCCAAATACCTCCCACTAGG - Intergenic
1123534270 15:21170610-21170632 TGACCCAAATACCTCCCACTAGG - Intergenic
1123770742 15:23525820-23525842 TGACCCAAATGCCCCCCACTAGG - Intergenic
1124699463 15:31900090-31900112 TGGCCCAAACACCTCCCACTAGG - Intergenic
1125751433 15:42031933-42031955 TGACCCAAATACTTCCCACTAGG - Intronic
1126188668 15:45855844-45855866 TGACCCAAACACCTCCCACTAGG - Intergenic
1126252926 15:46589330-46589352 TGACCCAAATACCTCTCACTAGG + Intergenic
1127028573 15:54835337-54835359 TGGCCCAAACACCTCCCTCTAGG - Intergenic
1128930062 15:71696456-71696478 TGACCCAAACACCTCCCACTAGG + Intronic
1129840664 15:78741523-78741545 TGGCCCACTGACCACCCCCTGGG + Intergenic
1131428007 15:92362795-92362817 TGACCCAAATACCACCCACTAGG - Intergenic
1131606773 15:93913361-93913383 TGACCCAAACACCTCCCACTAGG - Intergenic
1133644683 16:7753503-7753525 TGACCCAAACACCTCCCACTAGG + Intergenic
1133952965 16:10413248-10413270 TGTTTCAATTACCTCCCCCTGGG - Intronic
1134010728 16:10850515-10850537 TGACCCAAACACCTCCCACTAGG + Intergenic
1134605063 16:15563886-15563908 TGACCCAAACACCTCCCACTGGG - Intronic
1135072826 16:19367363-19367385 TGACCCAAATGCCTCCCACTAGG + Intergenic
1135818462 16:25657659-25657681 TTTCCCAAATATAACCCCTTAGG - Intergenic
1135874657 16:26186966-26186988 TGACCCAAACACCACCCACCAGG - Intergenic
1135885051 16:26298165-26298187 TGACCCAAATGCCTCCCACTAGG + Intergenic
1135893650 16:26379157-26379179 TGCCCCAAACACCTCCCACTAGG + Intergenic
1136859813 16:33691668-33691690 TGACCCAAATACCTCCCACTAGG + Intergenic
1137271657 16:46906356-46906378 GCTCCAAAATAGCACCCCCTGGG - Intronic
1137560974 16:49502258-49502280 AGTCCCACATCCCAGCCCCTTGG - Intronic
1137569715 16:49557513-49557535 TGTCCCCACCACCACCCCCTGGG - Intronic
1138215372 16:55200012-55200034 TGACCTAAATACCTCCCACTAGG - Intergenic
1138613564 16:58146475-58146497 TGACCCAAATACCTCCCACCAGG - Intergenic
1138735609 16:59247250-59247272 TGACCCAAACACCTCCCACTAGG - Intergenic
1139396085 16:66640346-66640368 TGTCTCAAATAGCACCCTCCAGG - Intronic
1139658368 16:68403123-68403145 TGTTTCAAATATCACCCCCTTGG + Intronic
1139766757 16:69237091-69237113 TGGCCCCAATCCCACCACCTGGG - Intronic
1139812922 16:69637667-69637689 TGACTCAAATACCACCTCCTGGG + Intronic
1139967433 16:70753649-70753671 TGTGAAAAATACCAGCCCCTGGG + Intronic
1140582489 16:76248080-76248102 TGACCCAAATACCTCCCATTAGG - Intergenic
1203121318 16_KI270728v1_random:1539847-1539869 TGACCCAAATACCTCCCACTAGG + Intergenic
1143404051 17:6665078-6665100 TGGTCCAAATACCTCCCACTAGG - Intergenic
1143439250 17:6955735-6955757 TGACCCACATACCTCCCACTGGG - Intronic
1143663015 17:8338923-8338945 TGACCCAAACACCACCCACTAGG + Intergenic
1144030560 17:11318462-11318484 TGTACCATCTGCCACCCCCTAGG + Intronic
1144588311 17:16502475-16502497 TGACCCAAACACCTCCCCTTAGG + Intergenic
1144846897 17:18224902-18224924 AGTCCCAAATGCCACCTCCTGGG + Intergenic
1145851656 17:28104824-28104846 TATCCAAAATACCACCCCAGGGG - Intronic
1149025201 17:52018849-52018871 TGACCCAAACACCTCCCACTAGG - Intronic
1149175616 17:53867171-53867193 TGACCCAAACACCTCCCACTAGG + Intergenic
1149404145 17:56329774-56329796 AGTTCCTAATACCACCACCTTGG - Intronic
1150027505 17:61692067-61692089 TGACCCACATACCTCCCACTAGG - Intronic
1150171370 17:62999087-62999109 TGACCCAAATACCTCCCACAAGG - Intergenic
1150732184 17:67705261-67705283 TGACCCAAATACCTCCCATTAGG + Intergenic
1150890862 17:69147793-69147815 TGACCCAAACACCTCCCACTGGG + Intronic
1151094927 17:71486162-71486184 TGACCCAATTACCACTCCGTGGG - Intergenic
1153885811 18:9464748-9464770 TGACCCAAACACCTCCCACTAGG - Intergenic
1154210265 18:12373891-12373913 TGGCCCAAACACCTCCCACTGGG + Intronic
1155338515 18:24790533-24790555 TGACCCAAACACCTCCCACTAGG - Intergenic
1155379501 18:25203891-25203913 TGACCCAAATACCTCCCACCAGG - Intronic
1155769685 18:29681082-29681104 TGACCCAAACACCTCCCACTAGG - Intergenic
1155837535 18:30604766-30604788 TGTCCCAAATGACACTGCCTAGG + Intergenic
1156047964 18:32898283-32898305 TGACCCAAACACCTCCCACTAGG - Intergenic
1156116687 18:33794335-33794357 TGACCCAAAAACCTCCCACTAGG - Intergenic
1156125553 18:33900335-33900357 TGACCCAAACACCTCCCACTAGG + Intronic
1156170745 18:34482141-34482163 TGACCCAAACACCTCCCACTAGG - Intergenic
1156495225 18:37521040-37521062 TCTCCCACATCCCATCCCCTAGG - Intronic
1156812227 18:41266549-41266571 TGACCCAAACACCTCCCCCTAGG + Intergenic
1157042470 18:44057074-44057096 TGACCCAAACACCTCCCACTAGG - Intergenic
1157448603 18:47767888-47767910 TGACCCAAACACCTCCCACTAGG + Intergenic
1157779344 18:50423648-50423670 TGACCCAAATACCTCCCCTCAGG - Intergenic
1157990661 18:52491977-52491999 TGTCCCTAATACCATGTCCTGGG + Intronic
1158374292 18:56846345-56846367 TGATCCAATTACCTCCCCCTGGG - Intronic
1158898761 18:61941124-61941146 TGACCCAAACACCGCCCACTGGG + Intergenic
1159643905 18:70894816-70894838 TGACCCAAATATCTTCCCCTAGG + Intergenic
1160943317 19:1630079-1630101 TGTCCCACCTGCCACCCCCACGG - Intronic
1162139753 19:8578664-8578686 TGTCCCAAAGACCAGCTCATAGG - Intergenic
1162373768 19:10293436-10293458 CCGCCCAAATACCACGCCCTAGG - Intronic
1163825167 19:19519421-19519443 TGCCCTAAATACCACTGCCTGGG + Intronic
1164020919 19:21304368-21304390 TGACCCAAACACCACCCACCAGG + Intronic
1164685568 19:30164330-30164352 TGACCCAAACACCTCCCCTTAGG - Intergenic
1164941205 19:32253276-32253298 TGCACCCAATTCCACCCCCTGGG + Intergenic
1165709098 19:37997055-37997077 ACTCCCAAATACCACCTTCTTGG - Intronic
1166651551 19:44578999-44579021 TGACCCAAAAACCTCCCACTAGG - Intergenic
1167781772 19:51602922-51602944 TCTCCCAAACCCCACCCCATAGG + Intergenic
1167873215 19:52390509-52390531 TGTCCCAAATTCCATCCCACAGG + Intergenic
1168306721 19:55439849-55439871 TTGCTCAAATACCTCCCCCTCGG + Intronic
926248043 2:11135128-11135150 TGACCCAAACACCTCCCACTAGG + Intronic
927894970 2:26775763-26775785 TGTGCCATATACCAAGCCCTGGG + Intronic
928514667 2:32034540-32034562 TGACCCAAACACCTCCCACTAGG + Intronic
929378997 2:41326922-41326944 TGACCCAAATACCTCCCATTAGG - Intergenic
929421868 2:41799094-41799116 TGACCCAAACACCTCCCACTAGG + Intergenic
929766426 2:44847746-44847768 TGTGCCAGCCACCACCCCCTTGG - Intergenic
930207620 2:48603760-48603782 TGACCCAAACACCTCCCACTAGG + Intronic
930363425 2:50410539-50410561 TCTCCCAAAGACCAGCCCCATGG + Intronic
930499857 2:52200641-52200663 TGACCCAAACACCTCCCACTAGG + Intergenic
931056796 2:58481649-58481671 TGACCCAAATACCTCCCTCTAGG + Intergenic
931081534 2:58777559-58777581 ATTGCCAAATACCACCCCCGAGG + Intergenic
931111987 2:59120797-59120819 TGACCCAAACACCTCCCACTAGG - Intergenic
931552397 2:63461247-63461269 TGACCCAAATACCTCCCCGCAGG - Intronic
931831213 2:66053347-66053369 TGACCCAAATACCTTCCACTAGG + Intergenic
931955536 2:67419740-67419762 TGACCCAAACACCTCCCACTGGG + Intergenic
932018599 2:68059277-68059299 TGACCCAAATATCTCCCACTAGG + Intronic
932070143 2:68611904-68611926 TGACCCAAACACCTCCCACTAGG + Intronic
932516823 2:72359796-72359818 TGACCCAAACACCTCCCACTAGG - Intronic
932524194 2:72445722-72445744 TGTTCCAATTACCTCCCACTGGG + Intronic
933184451 2:79263242-79263264 TGACCCAAACACCTCCCACTAGG - Intronic
933640043 2:84749096-84749118 TGACCCAAACACCGCCCACTAGG + Intronic
933998774 2:87689146-87689168 TGACCCAAACACCTCCCACTAGG + Intergenic
934458172 2:94192776-94192798 TGACCCAAATAACTCCCACTAGG + Intergenic
934624937 2:95838665-95838687 TGACCCAAACACCTCCCACTAGG + Intronic
934658781 2:96132168-96132190 TGTACCAGATACCACCACCATGG - Intronic
934808641 2:97262648-97262670 TGACCCAAACACCTCCCACTAGG - Intronic
934828870 2:97494543-97494565 TGACCCAAACACCTCCCACTAGG + Intronic
935062507 2:99620723-99620745 TGACCCAAACACCTCCCACTAGG - Intronic
935073785 2:99720245-99720267 TGACCCAGACACCACCCTCTGGG - Intronic
935181501 2:100694993-100695015 TGACCCAAATACCTCCCACTAGG + Intergenic
935239258 2:101164131-101164153 TGACCCAAACACCTCCCACTTGG - Intronic
935564883 2:104595650-104595672 TGGCCCAAATACCTCCCACTAGG - Intergenic
936237225 2:110753017-110753039 TGACCCAAACACCTCCCACTAGG - Intronic
936292128 2:111234362-111234384 TGACCCAAACACCTCCCACTAGG + Intergenic
936295076 2:111261732-111261754 TGACCCAAACACCTCCCACTAGG - Intergenic
936438629 2:112530492-112530514 TTTCCCAAACACCAACCCATCGG - Exonic
936456063 2:112675206-112675228 TGACCCAAACACCTCCCACTAGG - Intergenic
936721599 2:115257570-115257592 TGTCCCAGAAACCACCCACCAGG + Intronic
937450273 2:121996512-121996534 TGACCCAAACACCTCCCACTAGG + Intergenic
938134121 2:128739831-128739853 TGACCCAAACACCTCCCCCTAGG + Intergenic
938666431 2:133543075-133543097 TGACCCAAATACCTCCCACTAGG - Intronic
938878894 2:135564085-135564107 TGACCCAAACACCACCCACCAGG + Intronic
939023911 2:136989287-136989309 TAACCCAAATACCTCCCACTAGG - Intronic
939445255 2:142301956-142301978 TGACCCAAATATCTCCCTCTAGG - Intergenic
939739041 2:145883741-145883763 TGACCCAAACACCACCCACCAGG - Intergenic
940119415 2:150246741-150246763 TAACCCAAACACCACCCACTAGG + Intergenic
940337725 2:152546498-152546520 TGACCCAAATACCTCCCACTAGG + Intronic
940374843 2:152946203-152946225 TGACCCAAATACCTCCCACCAGG - Intergenic
940406229 2:153305642-153305664 TTTCCAAAATGCCACTCCCTAGG + Intergenic
940487082 2:154309666-154309688 TGACCCAAACACCTCCCACTAGG + Intronic
941097877 2:161261332-161261354 TGACCCAAACACCTCCCACTAGG - Intergenic
941359109 2:164530366-164530388 TGACCCAAACACCTCCCACTAGG + Intronic
941405376 2:165080649-165080671 TGACCCAAACACCTCCCACTAGG - Intergenic
941879366 2:170465456-170465478 TGACCCAAACACCTCCCACTGGG + Intronic
942229666 2:173848555-173848577 TGACCCAAACACCTCCCACTGGG + Intergenic
942871152 2:180735976-180735998 TGACCCAAATACCTCCCACCAGG - Intergenic
942896639 2:181064208-181064230 TGCCCCATATACCACAACCTTGG - Intronic
943171106 2:184401564-184401586 TGACCCAAACACCTCCCACTAGG - Intergenic
943769116 2:191695748-191695770 AGACCCAAACACCTCCCCCTAGG + Intronic
945092628 2:206189817-206189839 TGTCCCAAATACCACCCCCTGGG - Intronic
945558259 2:211305945-211305967 TGTCCCAAACACCTCCCATTAGG - Intergenic
945668335 2:212770302-212770324 TGACCCAAACACCTCCCCCTAGG - Intergenic
945716405 2:213362884-213362906 TGACCCAAACACTTCCCCCTAGG + Intronic
949063024 2:241972355-241972377 TGTCTCAATTACCTCCCACTGGG - Intergenic
1169148872 20:3273669-3273691 TGACCCAAACACCTCCCACTAGG + Intronic
1169390742 20:5188930-5188952 TGACCCAAACACCTCCCACTAGG + Intronic
1169751281 20:8997275-8997297 TGACCCAAATACCTCCCACTGGG - Intergenic
1169765128 20:9140548-9140570 TGACCCAAATACCTCCCACCAGG - Intronic
1170339456 20:15307078-15307100 TGACCCAAACACCTCCCACTAGG + Intronic
1170443889 20:16405394-16405416 TGTACCAAAAACGACCCTCTAGG + Intronic
1170805135 20:19623016-19623038 TGACCCAAACACCTCCCACTTGG + Intronic
1172217884 20:33249360-33249382 TGACCCAAACACCTCCCACTGGG + Intergenic
1172361950 20:34318994-34319016 TGACCCAAATACCTCCCATTAGG + Intergenic
1172729237 20:37071691-37071713 TGACCCAAACACCTCCCACTAGG - Intronic
1173807560 20:45935593-45935615 TGGCCGAAGTACCAGCCCCTGGG - Intronic
1174171583 20:48621072-48621094 TGTCCCAAATACCTGCACCCAGG + Intergenic
1174285845 20:49472692-49472714 TGACCCAAAGACCTCCCACTAGG - Intronic
1174784333 20:53418624-53418646 TGATCCAATTACCACCCCCCAGG + Intronic
1174884027 20:54311953-54311975 TGACCCAAACACCTCCCACTAGG + Intergenic
1175343955 20:58256820-58256842 TGACCCAAATACCTCCCACCAGG - Intergenic
1175953000 20:62593466-62593488 TGTCCCAGATAACACCACCATGG - Intergenic
1177206712 21:18018375-18018397 TGACCCAAATACCTCCCACTAGG - Intronic
1177335884 21:19726486-19726508 TCTTCCAAATACCACTCCCCTGG - Intergenic
1177517449 21:22174274-22174296 TGACACAAAAACCACCCACTAGG - Intergenic
1177966858 21:27738378-27738400 TGACCCAAACACCTCCCACTGGG + Intergenic
1178505722 21:33161461-33161483 TGACCCAAATACCACCCACCAGG - Intergenic
1179267048 21:39812943-39812965 TGGCCCAAACACCTCCCACTAGG + Intergenic
1179348566 21:40584879-40584901 TGACCCAAACACCTCCCACTGGG - Intronic
1179484396 21:41700430-41700452 TGACTCAATTACCTCCCCCTGGG - Intergenic
1180259175 21:46656042-46656064 TGACCCAAACACCTCCCACTAGG - Intronic
1180582397 22:16851839-16851861 TGGCCCAAACACCTCCCACTAGG + Intergenic
1181358037 22:22313651-22313673 TGACCCAAATACCTCCCACTAGG - Intergenic
1181428704 22:22863318-22863340 TGACCCAAACACCTCCCACTAGG + Intronic
1181851937 22:25755606-25755628 TGACCCAAACACCTCCCACTAGG - Intronic
1181995414 22:26877080-26877102 TGACCCAAACACCTCCCACTAGG + Intergenic
1182456740 22:30456624-30456646 TGACCCAAACACCTCCCACTAGG + Intronic
1182937417 22:34238436-34238458 TGACCCAAACACCACCTGCTAGG + Intergenic
1183049643 22:35250534-35250556 TGACCCAAACACCTCCCACTAGG + Intergenic
1183724301 22:39580051-39580073 TGACCCAAACACCTCCCTCTAGG + Intronic
1183879155 22:40811805-40811827 TGACCCAAACACCTCCCACTAGG + Intronic
1184319474 22:43729210-43729232 TGACACAAATACCTCCCACTAGG + Intronic
1185243389 22:49759201-49759223 TGACCCAAATGCCTCCCACTAGG - Intergenic
949362494 3:3246108-3246130 TTTCCTAAAAACCACCTCCTAGG + Intergenic
949813992 3:8039144-8039166 TGACCCAAACACCTCCCACTAGG + Intergenic
950201062 3:11044371-11044393 TGACCCAAACACCTCCCACTAGG - Intergenic
950898474 3:16474985-16475007 TGACCCAAACACCTCCCACTAGG - Intronic
951891643 3:27573145-27573167 TGACCCAAACACCTCCCACTAGG - Intergenic
952110901 3:30122980-30123002 TGACCCAAACACCTCCCACTAGG - Intergenic
952784838 3:37142938-37142960 TGACCCAAATACCTCCCACCAGG - Intronic
953926708 3:46986229-46986251 TGTCCCTAGAACCACACCCTTGG - Intronic
954894777 3:53966036-53966058 TGGCCCAAGTACCAGCCCCCTGG + Intergenic
955171456 3:56569539-56569561 TGACCCAAACACCTCCCCTTAGG + Intronic
955456085 3:59123186-59123208 TGACCCAAAAACCTCCCACTAGG + Intergenic
955552672 3:60101032-60101054 TGTCTCAAAGTCTACCCCCTAGG + Intronic
955568553 3:60276943-60276965 TGTCCCAAACACCTCCCACCAGG + Intronic
956470276 3:69559356-69559378 TGTCTCCAATACCATCACCTTGG - Intergenic
956545756 3:70400286-70400308 TGACCCAAACACCTCCCACTAGG - Intergenic
956564146 3:70616448-70616470 TGACCCAAACACCTCCCACTAGG + Intergenic
956607005 3:71083140-71083162 TGACCCAAATACCTCCCACCAGG - Intronic
957510821 3:81185623-81185645 TGCCCCAAACACCTCCCACTAGG - Intergenic
957511027 3:81187424-81187446 TGACCCAAACACCTCCCACTAGG - Intergenic
957680294 3:83425156-83425178 TGATCCAAATACCTCCCCCCAGG + Intergenic
957756473 3:84494660-84494682 TGACCCAAATACCTCTCACTAGG - Intergenic
958043736 3:88257659-88257681 TGTAACAAATACCACCAACTTGG + Intergenic
958439820 3:94142559-94142581 TGACCGAAATGCCACCCACTAGG + Intergenic
958729748 3:97949141-97949163 TGACCCAAACACCTCCCCTTAGG - Intronic
959245639 3:103863690-103863712 TGACCCAAACACCTCCCGCTAGG - Intergenic
959526840 3:107386974-107386996 TTTCCCAAATCCCCCTCCCTAGG + Intergenic
959699224 3:109282573-109282595 TGACTCAAATACCTCCCACTAGG + Intergenic
960524301 3:118692012-118692034 TGACCCAAACACCTCCCACTGGG - Intergenic
960764949 3:121115992-121116014 TGATCCAAATACCTCCCACTAGG + Intronic
961217324 3:125169796-125169818 TGTCACAACTGCCACCCACTTGG + Intronic
962712462 3:138099607-138099629 TGACCCAGATACCTCCCACTGGG - Intronic
962750682 3:138432943-138432965 TGTCCCAATTCCAAACCCCTTGG - Intergenic
963064451 3:141252604-141252626 TGACCCAAACACCTCCCACTAGG + Intronic
963818251 3:149857929-149857951 TGACCCAAACACCTCCCACTGGG - Intronic
963931702 3:151010193-151010215 TGACCCAAACACCTCCCACTAGG + Intergenic
963999194 3:151748501-151748523 TGTCCCAAACACCTCTCACTAGG - Intronic
964450194 3:156805083-156805105 TGTCCCAAATCCCACCTGCTTGG + Intergenic
964852786 3:161112909-161112931 TGACCCAAATACCTCCCACAAGG - Intronic
964871103 3:161314430-161314452 TGACCCAAACACCTCCCACTAGG - Intergenic
965305758 3:167061008-167061030 TGACTCAAATACCTCCCACTCGG - Intergenic
965433781 3:168621548-168621570 TGACCCAGACACCACCCACTAGG + Intergenic
965562243 3:170072776-170072798 TGACCCAAACACCTCCCACTAGG + Intronic
965582042 3:170278928-170278950 TGACCCAAACACCTCCCACTAGG + Intronic
965795485 3:172434388-172434410 TGGCCCAAACACCTCCCACTAGG + Intergenic
966577918 3:181524192-181524214 TGACCCAAACACCTCCCACTAGG - Intergenic
966617009 3:181924461-181924483 TGTTCAAAATACAACCTCCTGGG + Intergenic
967005933 3:185382592-185382614 TGACCCAAACACCTCCCACTAGG - Intronic
967551481 3:190800715-190800737 TGATTCAATTACCACCCCCTGGG + Intergenic
967602322 3:191404761-191404783 TGACCCAAACACCTCCCACTAGG + Intergenic
967701853 3:192602396-192602418 TTGCACAAATACCACCTCCTGGG - Intronic
967770533 3:193329587-193329609 AGGGCCAAATAACACCCCCTTGG - Intronic
967931376 3:194692967-194692989 TGACCCAAATACCTCCCATTAGG + Intergenic
968482328 4:839787-839809 TGACCCAAACACCTCCCACTAGG + Intergenic
969055128 4:4396870-4396892 GGTCTCCAATACCACCCCCACGG - Intronic
969464766 4:7349674-7349696 TGGCCCAAAAGCCACCCACTGGG - Intronic
969886751 4:10221866-10221888 TGTCTCAATTCCCATCCCCTTGG + Intergenic
969896906 4:10313799-10313821 TGACCCAAATACCACCCACCAGG - Intergenic
970047225 4:11868479-11868501 GGTCCCAAATACCACACCTTGGG + Intergenic
970979106 4:22075816-22075838 TGATCCAATTACCTCCCCCTGGG - Intergenic
971693322 4:29866065-29866087 TGACCAAAATACCTCCCACTAGG - Intergenic
972741330 4:41889531-41889553 TGACCTAAATACCTCCCACTAGG - Intergenic
972921123 4:43943082-43943104 TGGTCCAAATACCTCCACCTAGG - Intergenic
974125209 4:57687806-57687828 TGACCCAAACACCTCCCACTAGG + Intergenic
974610296 4:64207838-64207860 TATCCAAAATACCACACACTGGG - Intergenic
974670543 4:65024510-65024532 TGACCCAGACACCACCCACTAGG + Intergenic
974845709 4:67348960-67348982 TGACCCAAACACCTCCCACTAGG + Intergenic
975394391 4:73857798-73857820 TGACCCAAACACCTCCCACTAGG + Intergenic
976015401 4:80546589-80546611 TGACCCAAATACCTCCCACCAGG - Intronic
977837906 4:101666584-101666606 TGTTTCAATTACCTCCCCCTGGG - Intronic
977941408 4:102863450-102863472 TGACCCAAACACCTCCCACTAGG + Intronic
979820101 4:125160665-125160687 TGACCCAAACACCTCCCACTAGG + Intergenic
980277361 4:130671387-130671409 TGACCCAAACACCTCCCACTAGG - Intergenic
980804384 4:137792978-137793000 TGACCCAAACACCACCCACTAGG + Intergenic
981061569 4:140430854-140430876 TGACCCAAATACCTCCCATTAGG - Intergenic
981409024 4:144405867-144405889 TGACCCAAACACCTCCCACTAGG + Intergenic
981612860 4:146614142-146614164 TGACCCAAACACCTCCCACTAGG - Intergenic
981821113 4:148888540-148888562 TGACCCAAAGACCTCCCACTAGG + Intergenic
981906345 4:149925600-149925622 TGACCCAAACACCACCCACTAGG - Intergenic
982580218 4:157168012-157168034 TGACCCAAACACCTCCCACTAGG + Intronic
982890437 4:160842587-160842609 TTTCCCAAATACCTCCCTCATGG + Intergenic
982904672 4:161052908-161052930 TGACCCAAACACCTCCCCCTAGG + Intergenic
982986019 4:162207355-162207377 TGACCAAAATACCTCCCACTTGG + Intergenic
983236583 4:165187322-165187344 TGACTCAATTACCTCCCCCTAGG + Intronic
983549507 4:169001548-169001570 TGACCCAAACACCTCCCGCTAGG - Intronic
984435603 4:179706329-179706351 TGACCCAAACACCTCCCACTAGG - Intergenic
984810139 4:183788761-183788783 TGACCCAAACACCTCCCACTAGG + Intergenic
984841608 4:184073276-184073298 TGACCCAAACACCTCCCACTAGG - Intergenic
985727900 5:1525259-1525281 TGTCCCAAGTGCCACACCCACGG + Intergenic
986119093 5:4814125-4814147 TGACCCAAATACCTCCCACCAGG - Intergenic
986410369 5:7473486-7473508 TGACCCAAACACCTCCCACTAGG + Intronic
987228006 5:15863659-15863681 TGACCCAAATACCTCCCACTAGG - Intronic
987382297 5:17296540-17296562 TGTCCTAAATACCTACTCCTTGG + Intergenic
988307357 5:29509665-29509687 TGTTCCAAATACCTTCCCCCAGG - Intergenic
988593244 5:32567544-32567566 TGACCCAAATTCCTCCCACTAGG + Intronic
988717895 5:33845998-33846020 TGACCCAAATACCTCCCACCAGG + Intronic
989382360 5:40822008-40822030 TGACCCAAATACCTCCCACCTGG + Intergenic
989532408 5:42523794-42523816 TGATTCAATTACCACCCCCTGGG - Intronic
989644836 5:43620047-43620069 TGACCCAAACACCTCCCACTAGG + Intronic
990553176 5:56904482-56904504 TGACCCAAACACCTCCCACTAGG + Intergenic
991008023 5:61850403-61850425 TGACCAAAACACCTCCCCCTAGG - Intergenic
991071539 5:62488011-62488033 TATCTCAAATGCCACCCCCTTGG - Intronic
991243789 5:64488216-64488238 TAGCCCAAATACCTCCCACTGGG + Intergenic
991299843 5:65119701-65119723 TGACCCAAATACCTCCCACCAGG - Intergenic
991605855 5:68400272-68400294 TGACCCAAACACCTCCCACTAGG - Intergenic
992176737 5:74156757-74156779 TGTGAAAAATACCACTCCCTGGG + Intergenic
992313612 5:75529396-75529418 TGACCCAAACACCTCCCACTAGG + Intronic
992779965 5:80118898-80118920 TCTCCCAAATACCATCACCCTGG + Intronic
993274224 5:85835587-85835609 TAACCCAAATACCTCCCACTAGG + Intergenic
993446624 5:88020546-88020568 TGACCCAAACACCTCCCTCTAGG + Intergenic
993754735 5:91714440-91714462 TGACCAAAATACCTCCCACTAGG + Intergenic
993940967 5:94058840-94058862 TGACCCAAACACCTCCCACTAGG - Intronic
994698152 5:103098788-103098810 TGTCTCAAAAACAACCCACTAGG + Intronic
994746792 5:103687872-103687894 TGACCCAAATACCTCCCAGTAGG + Intergenic
994865088 5:105258346-105258368 TGGCCCAAACACCTCCCACTAGG + Intergenic
995033550 5:107507759-107507781 TATCCAAAATACGACCTCCTGGG - Intronic
995751612 5:115458256-115458278 TGACCCAAACACCTCCCACTAGG - Intergenic
995761495 5:115566462-115566484 TGACCCAAATACCTCCCATTTGG - Intergenic
995798512 5:115965632-115965654 TGTTCCAATTACCTCCCACTGGG - Intronic
996343621 5:122466103-122466125 TGTCCCAACTGCCACCCAATGGG + Intergenic
996363281 5:122674115-122674137 TGACCCAAACACCTCCCACTAGG + Intergenic
996951798 5:129135749-129135771 TGACCCAAACACCTCCCACTAGG - Intergenic
998277415 5:140770017-140770039 TGACCAAAATACCTCCCACTAGG - Intergenic
999067128 5:148699825-148699847 TGACTCAATTACCTCCCCCTGGG + Intergenic
999436392 5:151566729-151566751 TGTCCCTATCAACACCCCCTTGG - Exonic
999566426 5:152867656-152867678 TGACCCAAATACCTCCCATTAGG - Intergenic
999710254 5:154311966-154311988 TGTAGCAAATACCACTCACTAGG - Intronic
1000373364 5:160557956-160557978 GGTCCAAAATATCACCCACTAGG - Intergenic
1001033575 5:168280604-168280626 TGAGCCAAATACCACCCGCTAGG + Intergenic
1001695855 5:173669319-173669341 TGACCCAGATACCTCCCACTAGG + Intergenic
1001719826 5:173847830-173847852 TGACCCAAACACCTTCCCCTAGG + Intergenic
1002008581 5:176257605-176257627 TGACCCAAATACCTCCCACCAGG + Intronic
1003082784 6:3035448-3035470 CGTCCCAAACACCTCCCACTAGG - Intergenic
1003438806 6:6121056-6121078 TGATCCAAATACCTCCCACTAGG - Intergenic
1003545960 6:7058629-7058651 ACTGCCAAATACCACACCCTGGG - Intergenic
1003601200 6:7519076-7519098 TGTCTCTAATCCCAGCCCCTTGG - Intergenic
1003675837 6:8203588-8203610 TGTCCCAAGGAGCAGCCCCTGGG + Intergenic
1004160081 6:13205323-13205345 TGACCCAAATGCCTCCCACTAGG + Intronic
1004248007 6:13998767-13998789 TGACCCAAATACCTCCCACCAGG + Intergenic
1004294224 6:14395393-14395415 TATCACAAATACCACCCCCTAGG - Intergenic
1004700064 6:18070239-18070261 TGACCCAAACACCTCCCACTAGG - Intergenic
1004959579 6:20771649-20771671 TGACCCAAATACCTCCCACCAGG - Intronic
1005142505 6:22649596-22649618 TAACCCAAATACCTCCCACTAGG - Intergenic
1005489680 6:26335967-26335989 TGACCCAAACACCTCCCCCAAGG + Intergenic
1007225334 6:40309774-40309796 TGACCCAAACACCTCCCACTAGG + Intergenic
1007880535 6:45160939-45160961 TGACCCAAACACCTCCCACTAGG - Intronic
1008160331 6:48068686-48068708 TCTCCCCCATCCCACCCCCTGGG + Exonic
1009354694 6:62727914-62727936 GGTCCCATATCCCACCCCCCAGG - Intergenic
1009514392 6:64596182-64596204 TGACCCAAATTCCTCCCCCCAGG + Intronic
1009559380 6:65220366-65220388 TGTTTCAATTACCACCCACTGGG - Intronic
1009694919 6:67089951-67089973 TGACCCAAACACCTCCCACTAGG + Intergenic
1009755273 6:67931013-67931035 TGTTTCAATTACCTCCCCCTGGG + Intergenic
1010003383 6:70970511-70970533 TGACCCAAACACCTCCCACTAGG + Intergenic
1010125035 6:72421634-72421656 TAACCCAAATACCTCCCACTAGG + Intergenic
1010266615 6:73875017-73875039 TGACCCAAACACCTCCCACTGGG + Intergenic
1010508573 6:76689548-76689570 TGACCCAAACACCTCCCACTAGG - Intergenic
1010588622 6:77685950-77685972 TGACCCAAACACCTCCCACTAGG - Intergenic
1011435600 6:87333316-87333338 TGACCCAAACACCTCCCACTAGG + Intronic
1012078448 6:94725622-94725644 TGGCCCAAATACCTCCCACTAGG + Intergenic
1012080518 6:94752272-94752294 TACCCCAAATACCACCCACTAGG + Intergenic
1012490098 6:99773336-99773358 TGACCCAAACACCTCCCACTAGG + Intergenic
1012571327 6:100733336-100733358 TGACCCAAACACCACCCACGAGG - Intronic
1013120574 6:107137173-107137195 TGACCCAAACACCTCCCACTAGG + Intergenic
1013126379 6:107188634-107188656 TGACCCAAACACCTCCCGCTAGG - Intronic
1013469914 6:110454070-110454092 TGGCCCAAACACCTCCCACTAGG + Intronic
1013485631 6:110593716-110593738 TCACCCAAATACCTCCCACTAGG - Intergenic
1013960990 6:115899921-115899943 TGACCCAAACACCACCCACTAGG - Intergenic
1014136560 6:117896353-117896375 TGACCCAAATACCTCCCAGTAGG - Intergenic
1014720894 6:124917203-124917225 TGACCCAAACACCTCCCACTAGG - Intergenic
1014742854 6:125166867-125166889 TGTCACAAATTCCTCCCACTGGG - Intronic
1015988422 6:138910085-138910107 TGACCCAAACACCTCCCACTAGG - Intronic
1017934890 6:158996886-158996908 TGTTCCAAACACCTCCCACTAGG - Intronic
1018263464 6:161993991-161994013 TGACCCAAACACCTCCCACTAGG + Intronic
1019226676 6:170517053-170517075 TGGCCCCCATTCCACCCCCTAGG + Intergenic
1022512437 7:30948830-30948852 TGACCCAAATACCTCCCATTAGG - Intronic
1023107352 7:36775351-36775373 TGACCCAAATACCTCCCACTAGG - Intergenic
1023215543 7:37858826-37858848 TGACCCAAACACCTCCCACTAGG - Intronic
1024275939 7:47677029-47677051 TGACCCAAACACCTCCCGCTAGG - Intergenic
1024885683 7:54139504-54139526 TGACCCAAATACCTCCCACTAGG - Intergenic
1026078022 7:67191190-67191212 TGACCCAAACACCTCCCACTGGG + Intronic
1026278932 7:68904611-68904633 CGACCCAAATACCTCCCACTAGG + Intergenic
1026672134 7:72399810-72399832 TGACCCAAACACCTCCCACTAGG - Intronic
1026763381 7:73143525-73143547 TGACCCAAACACCTCCCACTTGG + Intergenic
1027039851 7:74953299-74953321 TGACCCAAACACCTCCCACTTGG + Intergenic
1027083788 7:75249065-75249087 TGACCCAAACACCTCCCACTTGG - Intergenic
1027148573 7:75716065-75716087 TGACCCAAACACCTCCCACTCGG + Intronic
1027716141 7:81673074-81673096 TGACCCAAACACTACCCGCTAGG - Intergenic
1027948082 7:84776940-84776962 TGACCCAAACACCTCCCACTAGG - Intergenic
1028334230 7:89631117-89631139 TGACCCAAATACCTCCCACTAGG - Intergenic
1029065456 7:97843740-97843762 TGACCCAAATACATCCCACTAGG + Intergenic
1029131012 7:98330935-98330957 TGACACAAATACCTCCCACTAGG + Intronic
1029391383 7:100276915-100276937 TGACCCAAACACCTCCCACTTGG - Intergenic
1029813370 7:103070867-103070889 TGACTCAAATACCTCCCACTGGG + Intronic
1031545256 7:123044309-123044331 TGTCTGAAATCCCAGCCCCTCGG - Intergenic
1031571899 7:123369552-123369574 TGACCCAAACACCTCCCACTAGG - Intergenic
1032660967 7:133983230-133983252 TGACCCAAACACCTCCCACTAGG + Intronic
1032770941 7:135055166-135055188 TGACCCAAACACCTCCCGCTAGG + Intronic
1033542114 7:142366755-142366777 TGACCCAAATACCACCCACCAGG + Intergenic
1033776651 7:144619061-144619083 TGTCCCAAACACCTCCCACCAGG - Intronic
1034526663 7:151668064-151668086 TGGCCCAAACACCTCCCACTAGG - Intronic
1034707871 7:153162609-153162631 TGGCCCAAACACCTCCCACTAGG + Intergenic
1035639980 8:1177636-1177658 TGTCACAAATACCCCACACTAGG + Intergenic
1037780588 8:21865752-21865774 TGTCCCAAACACTTCCCACTAGG - Intergenic
1038101131 8:24377267-24377289 TGTCCCAAATAGTACTGCCTAGG - Intergenic
1038222537 8:25624394-25624416 TGCCCCAAATACCTTCCACTAGG - Intergenic
1038534013 8:28340889-28340911 TGACCCAAACACCACCCACTAGG + Intronic
1038856906 8:31343973-31343995 GGCCCCAAATACCTCCCACTAGG - Intergenic
1039429026 8:37511343-37511365 TGACCCAAACACCTCCCACTAGG + Intergenic
1039951251 8:42174514-42174536 TGGCCCAAATACCAGCTTCTAGG + Intergenic
1040715278 8:50244250-50244272 TGACCCAAATACCTCCCACCAGG + Intronic
1040906016 8:52470433-52470455 TGGCCCAAACACCTCCCACTAGG - Intergenic
1042728222 8:71902326-71902348 TGACTCAATTACCTCCCCCTGGG + Intronic
1042856276 8:73271296-73271318 TGACCCAAACACCTCCCACTAGG - Intergenic
1043092100 8:75917772-75917794 TGACCCAAACACCTCCCCCCAGG - Intergenic
1043483331 8:80674667-80674689 TGACCCAAACACCTCCCACTAGG + Intronic
1043948983 8:86286776-86286798 TGACCCAAATATCCCCCACTAGG + Intronic
1044169603 8:89032990-89033012 TGTCCCAAATACCTCCCACTTGG - Intergenic
1044708400 8:95031054-95031076 TGACCCAAATACCTCCCACTAGG + Intronic
1045158228 8:99504045-99504067 TGACCCAAATATCTCCCACTAGG - Intronic
1045280067 8:100742430-100742452 TGTCCCAAATATCACTGCCATGG - Intergenic
1045439072 8:102192065-102192087 TGACCCAAACACCTCCCACTAGG + Intergenic
1045880198 8:107029422-107029444 TGACCCAAACACCTCCCACTAGG - Intergenic
1046767371 8:118084295-118084317 TGTCCCAGATGCTACCTCCTGGG + Intronic
1047218649 8:122900456-122900478 TGACCCAAACACCTCCCCCTAGG + Intronic
1047549269 8:125851987-125852009 TGACCCAAACACCTCCCTCTAGG - Intergenic
1048926997 8:139280410-139280432 TGTCTTAAATACCACCAACTGGG + Intergenic
1049033967 8:140060455-140060477 TGCCCCAAATTTCAGCCCCTTGG + Intronic
1050657507 9:7845148-7845170 TGACCCAAACACCTTCCCCTAGG + Intronic
1050816796 9:9823429-9823451 TGACCCAAACACCTCCCACTAGG + Intronic
1050994828 9:12203328-12203350 TGACCCAAACACCTCCCACTAGG + Intergenic
1051844635 9:21437973-21437995 TGTCACAAATACAAGCACCTGGG + Intronic
1052512893 9:29444434-29444456 TGACCCACATACCACCCACCAGG - Intergenic
1052549702 9:29932193-29932215 TGCCCCAAATACCTCCCACTAGG + Intergenic
1053177275 9:35936857-35936879 TGACCCAAACACCTCCCACTAGG - Intergenic
1053688680 9:40568581-40568603 TGACCCAAATAACTCCCACTAGG + Intergenic
1054299921 9:63369492-63369514 TGACCCAAATAACTCCCACTAGG + Intergenic
1054854053 9:69879052-69879074 TGACCCAAACACCTCCCCCCAGG + Intronic
1055102827 9:72482716-72482738 TGACCCAAATACCTCCCACCAGG - Intergenic
1055118567 9:72632317-72632339 TGACCCAAACACCTCCCACTAGG + Intronic
1055163622 9:73163232-73163254 GGACCCAAATACCTCCCTCTAGG + Intronic
1055171478 9:73264762-73264784 TGACCCAAACACCTCCCACTAGG - Intergenic
1055798041 9:79997485-79997507 TGGCCCAAACACCTCCCACTAGG - Intergenic
1056004255 9:82250351-82250373 TGGCCCAAATACCTCCCATTAGG - Intergenic
1056223941 9:84477133-84477155 TGGCCCAAACACCTCCCACTAGG + Intergenic
1056639206 9:88356264-88356286 TGACTCAATTACCTCCCCCTGGG - Intergenic
1056949518 9:91030877-91030899 TGACCCAAACACCTCCCACTGGG - Intergenic
1056995062 9:91448531-91448553 TGACTCAAATACCTCCCACTAGG + Intergenic
1058852524 9:109026731-109026753 TGGCCCAAACACCTCCCACTAGG - Intronic
1058892293 9:109371354-109371376 TTCTCCAAATACCACCCCATGGG - Intergenic
1059071458 9:111141788-111141810 TGTCCCCAAGACTACCCCCAAGG + Intergenic
1059920694 9:119157102-119157124 TGTTTCAATTACCTCCCCCTGGG - Intronic
1061634065 9:131894824-131894846 TGACCCAAACACCCCCCACTAGG - Intronic
1061866868 9:133496772-133496794 TGACCCAAAGACCACCCACCTGG - Intergenic
1185670226 X:1803650-1803672 TGTCCCGAGGATCACCCCCTGGG + Intergenic
1185742565 X:2545518-2545540 TCACCCAAATACCTCCCACTAGG - Intergenic
1186006507 X:5078122-5078144 AGTCCCTAATACCATCCCCTTGG + Intergenic
1186194727 X:7099001-7099023 TGGCCCAGATACCATGCCCTGGG + Intronic
1186300488 X:8195424-8195446 TGACCCAAACACCTCCCCCCAGG + Intergenic
1186449565 X:9660892-9660914 ACCCCCAAATACCATCCCCTTGG - Intronic
1186688009 X:11945794-11945816 TGACCCAAATGCCTCCCACTAGG + Intergenic
1187110559 X:16294795-16294817 TGACCCAAATACCTCCCATTAGG - Intergenic
1189061533 X:37758678-37758700 TGTCCTAAATACCAGTACCTTGG - Intronic
1189234102 X:39474565-39474587 TGTCCCAGTTCCCAGCCCCTGGG - Intergenic
1189245855 X:39562826-39562848 TGACCCAAACACCTCCCACTAGG + Intergenic
1189426999 X:40910691-40910713 TGACCCAAACACCTCCCACTAGG + Intergenic
1189858769 X:45251083-45251105 TGTCCCAAACACCTCCCATTAGG + Intergenic
1189928098 X:45978427-45978449 TGACCCAAATACCTCTCACTAGG + Intergenic
1190130252 X:47741594-47741616 TGACCCAAACACCTCCCACTAGG + Intergenic
1190369195 X:49725552-49725574 TGACCCAAATACCTCCCACTAGG - Intergenic
1191117440 X:56866428-56866450 TGACCCAAACACCTCCCACTAGG - Intergenic
1191886980 X:65899018-65899040 TGTTTCAATTACCTCCCCCTGGG + Intergenic
1192402185 X:70846976-70846998 TGTCCTAAACACCTCCCACTGGG - Intronic
1192451094 X:71245590-71245612 GATCACCAATACCACCCCCTCGG + Intronic
1192552105 X:72062734-72062756 TTTCCCACATACCTCCCCCTTGG - Intergenic
1192604915 X:72506592-72506614 TGACCCAAATACCTCCCATTAGG + Intronic
1192626108 X:72730455-72730477 TGACCCAAACACCACCCACCAGG - Intergenic
1193230657 X:79041635-79041657 TGATTCAATTACCACCCCCTAGG + Intergenic
1193393200 X:80954022-80954044 TGACCCAAACACCTCCCACTAGG - Intergenic
1193533858 X:82688628-82688650 TGACCCAAACACCTCCCACTAGG - Intergenic
1193563637 X:83050609-83050631 TGACCCAAACACCTCCCACTAGG - Intergenic
1193572314 X:83159855-83159877 TGTTGCAAGTAACACCCCCTTGG + Intergenic
1193851167 X:86538722-86538744 TGACCCAAACACCTCCCCTTAGG + Intronic
1193998847 X:88401119-88401141 TGACCCAAATACTTCCCACTTGG - Intergenic
1194528375 X:95010430-95010452 TGACCCAGATACCTCCCCATAGG - Intergenic
1194559133 X:95398657-95398679 TGACCCAAACACATCCCCCTAGG + Intergenic
1195436624 X:104851977-104851999 TGACCCAAACACCTCCCACTAGG + Intronic
1195647338 X:107247131-107247153 TGACCCAAACACCTCCCACTAGG - Intergenic
1196003669 X:110812776-110812798 TGACCCAAACACCTCCCGCTAGG - Intergenic
1196015919 X:110939751-110939773 TGACCCAAACACCTCCCACTAGG - Intergenic
1197006322 X:121504420-121504442 TGATCCAAATACCTCCCACTAGG + Intergenic
1197031282 X:121818909-121818931 TGACCCAAACACCTCCCACTAGG + Intergenic
1197667371 X:129238392-129238414 TGACCCAAACACCTCCCACTAGG + Intergenic
1197831573 X:130648660-130648682 TGACCCAAACACCTCCCACTAGG - Intronic
1198264932 X:135000140-135000162 TGACCCAAATACCTCCCACCAGG - Intergenic
1198550189 X:137737013-137737035 TGACCCAAACACCTCCCACTAGG - Intergenic
1198611599 X:138407424-138407446 TGACCCAAACACCTCCCACTAGG + Intergenic
1198681131 X:139183433-139183455 TGACCCAAACACCTCCCACTAGG - Intronic
1198988763 X:142486444-142486466 TGACCCAAATACCTCCCATTAGG + Intergenic
1199025903 X:142937525-142937547 TGACCCAAATACCTCCCACTAGG + Intergenic
1199048475 X:143206367-143206389 TGACCCAAATACCTCCCGCTTGG + Intergenic
1199051694 X:143243520-143243542 TCTCCCAACTCCCACTCCCTTGG - Intergenic
1199561698 X:149170382-149170404 TGACCCAAATACCTTCCACTAGG - Intergenic
1199733446 X:150660945-150660967 TGACCCAAACACCTCCCACTAGG + Intronic