ID: 945094719

View in Genome Browser
Species Human (GRCh38)
Location 2:206208243-206208265
Sequence AACTATGTTATGTTTAGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 184}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945094716_945094719 -10 Left 945094716 2:206208230-206208252 CCTCAATCAACAAAACTATGTTA 0: 1
1: 0
2: 1
3: 24
4: 252
Right 945094719 2:206208243-206208265 AACTATGTTATGTTTAGGCTGGG 0: 1
1: 0
2: 0
3: 13
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945094719 Original CRISPR AACTATGTTATGTTTAGGCT GGG Intronic