ID: 945094719 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:206208243-206208265 |
Sequence | AACTATGTTATGTTTAGGCT GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 198 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 13, 4: 184} |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
945094716_945094719 | -10 | Left | 945094716 | 2:206208230-206208252 | CCTCAATCAACAAAACTATGTTA | 0: 1 1: 0 2: 1 3: 24 4: 252 |
||
Right | 945094719 | 2:206208243-206208265 | AACTATGTTATGTTTAGGCTGGG | 0: 1 1: 0 2: 0 3: 13 4: 184 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
945094719 | Original CRISPR | AACTATGTTATGTTTAGGCT GGG | Intronic | ||