ID: 945097990

View in Genome Browser
Species Human (GRCh38)
Location 2:206237827-206237849
Sequence CTGGTCATAAAGATCTAACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945097986_945097990 7 Left 945097986 2:206237797-206237819 CCATAACTTTGCTTAGAAATCTT No data
Right 945097990 2:206237827-206237849 CTGGTCATAAAGATCTAACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945097990 Original CRISPR CTGGTCATAAAGATCTAACA GGG Intergenic
No off target data available for this crispr