ID: 945097990 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:206237827-206237849 |
| Sequence | CTGGTCATAAAGATCTAACA GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 945097986_945097990 | 7 | Left | 945097986 | 2:206237797-206237819 | CCATAACTTTGCTTAGAAATCTT | No data | ||
| Right | 945097990 | 2:206237827-206237849 | CTGGTCATAAAGATCTAACAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 945097990 | Original CRISPR | CTGGTCATAAAGATCTAACA GGG | Intergenic | ||
| No off target data available for this crispr | |||||