ID: 945102901

View in Genome Browser
Species Human (GRCh38)
Location 2:206279000-206279022
Sequence GCTCTCTTGAGCCTATGTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 490
Summary {0: 1, 1: 0, 2: 1, 3: 38, 4: 450}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945102900_945102901 -9 Left 945102900 2:206278986-206279008 CCGTGGTGTCACTGGCTCTCTTG 0: 1
1: 0
2: 1
3: 18
4: 241
Right 945102901 2:206279000-206279022 GCTCTCTTGAGCCTATGTGTTGG 0: 1
1: 0
2: 1
3: 38
4: 450

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945102901 Original CRISPR GCTCTCTTGAGCCTATGTGT TGG Intronic
900566172 1:3333080-3333102 GCTCTCTTGGGTCTATATCTAGG + Intronic
901819949 1:11822462-11822484 GATCACTTGAGCCTAAGAGTTGG - Intronic
902183935 1:14711104-14711126 GCTCACTTGAGCCCAGGAGTTGG + Intronic
903087194 1:20872345-20872367 GATCACTTGAGCCTAGGAGTTGG - Intronic
903176473 1:21584474-21584496 GATCGCTTGAGCCTAGGAGTTGG + Intergenic
904062472 1:27722635-27722657 GATCACTTGAGCCTAGGAGTTGG + Intergenic
904296088 1:29520732-29520754 GCTGTGTTAAGCCTCTGTGTGGG - Intergenic
904680728 1:32227189-32227211 GATCTCTTGAGCCCAGGGGTTGG + Intronic
906274265 1:44504564-44504586 GCTCTCTGGAGCTTCTGGGTGGG + Intronic
906306995 1:44725745-44725767 GATCTCTTGAGCCCAAGAGTTGG + Intergenic
906412084 1:45586508-45586530 GATCCCTTGAGCCTAGGCGTTGG - Intronic
907154861 1:52324160-52324182 GCTCACTTGAGCCCAAGAGTTGG + Intronic
907947358 1:59147597-59147619 TCTCTTGGGAGCCTATGTGTGGG + Intergenic
908498473 1:64719034-64719056 GATCTCTTGAGCCCAGGGGTTGG + Intergenic
909184509 1:72469375-72469397 GATCTCTTGAGGGTAGGTGTTGG + Intergenic
910107393 1:83646241-83646263 GATCTCTTGAGCCTAGGAGTTGG + Intergenic
910807378 1:91202488-91202510 GCTCCCTTGAGCCCAGGAGTTGG - Intergenic
910943094 1:92558201-92558223 GCTCTCTTGACCCTAAAGGTTGG + Intronic
911523199 1:98952868-98952890 ACTCTCATGAGATTATGTGTGGG - Intronic
912356943 1:109061948-109061970 GATCTCTTGAGCCCAGGAGTTGG - Intergenic
913172238 1:116243432-116243454 GCTCTGTTGAGACTGTGTGGTGG + Intergenic
913361878 1:117989799-117989821 GTTCTCTTGAGCCCAGGTGTTGG - Intronic
913390754 1:118309249-118309271 GATCGCTTGAGCCTAGGAGTTGG + Intergenic
914199699 1:145473973-145473995 GATCTCTTGAGCCCAGGAGTTGG + Intergenic
914327339 1:146632350-146632372 GATCTCTTGAGCCCAGGAGTTGG + Intergenic
914478815 1:148047106-148047128 GATCTCTTGAGCCCAGGAGTTGG + Intergenic
914508672 1:148310914-148310936 CTGCTGTTGAGCCTATGTGTTGG - Intergenic
914761712 1:150604443-150604465 GCTCTGTTGACCCTAGCTGTGGG - Intronic
915348849 1:155212282-155212304 GCTTTCCTGAGCCTGTGTGTGGG - Intronic
915352041 1:155232908-155232930 GCTCTCCTGAGTCTCTGTGTGGG - Intergenic
917807448 1:178626436-178626458 GCTCTATCGACCCTATGGGTTGG + Intergenic
921671051 1:217924519-217924541 GCTCGCTAGAGCCCATGGGTTGG - Intergenic
921776139 1:219102358-219102380 GACCTCTTGAGACTATGTCTTGG + Intergenic
922032898 1:221821288-221821310 GGTCTATTGAGCTGATGTGTTGG + Intergenic
922850001 1:228724536-228724558 GATCACTTGAGCCCATGAGTTGG - Intergenic
923037004 1:230291580-230291602 GATCGCTTGAGCCTAGGAGTTGG + Intergenic
923429023 1:233903013-233903035 GATCACTTGACTCTATGTGTGGG + Intergenic
924210239 1:241757703-241757725 GGTCACTTGAGCCCAGGTGTTGG - Intronic
924454691 1:244209922-244209944 GATCTCTTGAGCCCAGGAGTTGG - Intergenic
1064730141 10:18322067-18322089 GATCTCTTGAGCCCAGGAGTTGG + Intronic
1064852308 10:19722501-19722523 GATCTCTTGAGCCCAGGAGTTGG + Intronic
1065097443 10:22295778-22295800 GCTCACTTGAGCCTAGGGGCTGG - Intergenic
1065141773 10:22725279-22725301 GATCCCTTGAGCCTAGGAGTTGG - Intergenic
1065639889 10:27770836-27770858 GATCGCTTGAGCCCAGGTGTTGG - Intergenic
1065693653 10:28359471-28359493 GATCACTTGAGCCCAGGTGTTGG + Intergenic
1065717540 10:28587038-28587060 GCTCGCTTGAGCCCAGGAGTTGG + Intronic
1066099634 10:32106335-32106357 GATCACTTGAGCCTAGGAGTTGG + Intergenic
1066324080 10:34338200-34338222 GCCCGCTTGAGCCACTGTGTTGG - Intronic
1066690991 10:38028043-38028065 GATCTCTTGAGCCCAGGAGTTGG + Intronic
1068670078 10:59713514-59713536 GATCTCTTGAGCCCAGGTGTTGG - Intronic
1069845833 10:71370619-71370641 GATCACTTGAGCCTAGGAGTTGG - Intergenic
1069925747 10:71849728-71849750 GATCGCTTGAGCCTAGGAGTTGG - Intronic
1071103975 10:82072851-82072873 GCTCACTTGAGCCCAGGAGTTGG - Intronic
1072071067 10:91918094-91918116 GCTCGCTTGAGCCCAGGAGTTGG - Intergenic
1073245246 10:102085839-102085861 GATCTCTTGAGCCTAGGAGTTGG + Intergenic
1073446441 10:103583492-103583514 GATCGCTTGAGCCTAGGAGTTGG + Intronic
1074546790 10:114407572-114407594 GATCACTTGAGCCTAGGAGTTGG - Intergenic
1075380886 10:122017593-122017615 GATCGCTTGAGCCTAGGAGTTGG + Intronic
1077204237 11:1334327-1334349 GTTCTCTTGGGCATATATGTGGG + Intergenic
1078509673 11:11976099-11976121 CCTCTCCTGAGCTTAAGTGTGGG + Intronic
1080436928 11:32253613-32253635 GATCACTTGAGCCTAGGAGTTGG + Intergenic
1080462212 11:32464689-32464711 GATCGCTTGAGCCTAGGAGTTGG + Intergenic
1080497584 11:32835033-32835055 GATCGCTTGAGCCTAGGAGTTGG - Intronic
1080623817 11:34010276-34010298 GCTCACTTGAGCCCAGGAGTTGG + Intergenic
1082709831 11:56541167-56541189 GGTCACTTGAGCCTAGGAGTTGG + Intergenic
1082996998 11:59262752-59262774 GCTCTCTTGAGGCCCTGTCTGGG - Intergenic
1083034481 11:59624103-59624125 GCTCTCTTGAGCCTGGGAGCTGG + Intergenic
1083442628 11:62687353-62687375 GATCTCTTGAGCCCAGGAGTTGG - Exonic
1083460598 11:62808525-62808547 GATCACTTGAGCCTAGGAGTTGG + Intronic
1087012553 11:93527680-93527702 GATCACTTGAGCCTAGGAGTTGG - Intronic
1087464126 11:98484044-98484066 GATCACTTGAGCCTAGGAGTTGG - Intergenic
1087754046 11:102036590-102036612 GATCACTTGAGCCTAGGAGTTGG + Intergenic
1087754610 11:102041973-102041995 GATCTCTTGAGCCCAGGAGTTGG - Intergenic
1089242508 11:117094519-117094541 GATCTCTTGAGCCTGGGAGTTGG + Intronic
1091858625 12:3758947-3758969 GCTCTTTACAGCCTATTTGTGGG - Intronic
1093116223 12:15214758-15214780 GATCTCTTGAGCCCAGGAGTTGG + Intronic
1094606601 12:31954840-31954862 GATCTCTTGAGCCCAGGAGTTGG + Intergenic
1095489505 12:42718341-42718363 GATCTCTTGAGCCCAGGAGTTGG + Intergenic
1095755971 12:45767605-45767627 GATCACTTGAGCCTAGGAGTTGG + Intronic
1098256282 12:68619011-68619033 GATCTCTTGAGCCCAGGAGTTGG + Intronic
1098912612 12:76225090-76225112 GATCACTTGAGCCTAGGAGTTGG - Intergenic
1099146654 12:79053933-79053955 ACTCTCTTAGGCTTATGTGTGGG - Intronic
1101700931 12:107173002-107173024 GATCACTTGAGCCTAGGAGTTGG + Intergenic
1101743424 12:107519639-107519661 GCTCTCTTGCGCCTCTGCCTTGG - Intronic
1101952069 12:109184931-109184953 GATCGCTTGAGCCTAGGAGTTGG - Intronic
1102062130 12:109940790-109940812 GATCTCTTGAGCCTAGGAGGCGG + Intronic
1102746571 12:115253928-115253950 GCTCTCTTTAGCTTATGTCAAGG - Intergenic
1103273741 12:119694718-119694740 GCTCTCTTGAGCCCAGGAGGCGG + Intronic
1103324193 12:120109529-120109551 GATCACTTGAGCCTAGGAGTTGG - Intronic
1103417229 12:120750926-120750948 GATCTCTTGAGCCTAGGAATTGG - Intergenic
1105524402 13:21162817-21162839 GATCTCTTCAGGCTATGAGTTGG + Intronic
1108365347 13:49705874-49705896 GCTATCTTGAGCCCAGGAGTTGG + Intronic
1109136221 13:58654768-58654790 GATCTCTTGAACCTAGGAGTTGG + Intergenic
1110602817 13:77395551-77395573 GATCGCTTGAGCCCAGGTGTTGG + Intergenic
1110893864 13:80724289-80724311 GATCTCTTGAGGCAATGAGTTGG + Intergenic
1111265175 13:85801816-85801838 GATCTCTTGAGCCTAGGAGTTGG - Intergenic
1114999930 14:28409875-28409897 GATCACTTGAGCCCATGAGTTGG + Intergenic
1115200446 14:30848644-30848666 GCTCTCTTGAGCCCAGGAGTTGG - Intergenic
1115401390 14:32964881-32964903 GATCTCTTGAGCCCAGGAGTTGG + Intronic
1115573530 14:34689464-34689486 ACTCACTTGAGCCTAGGAGTTGG + Intergenic
1115813461 14:37135446-37135468 GATCTTTTGAGCCTAGGAGTTGG - Intronic
1115972836 14:38965261-38965283 GATCTCTTTACCCTTTGTGTGGG - Intergenic
1116001670 14:39249361-39249383 GATCCCTTGAGCCTAGGAGTTGG - Intronic
1116245971 14:42412435-42412457 GCTCTCTTGCTCCCAAGTGTTGG + Intergenic
1117698929 14:58394603-58394625 GATCACTTGAGCCTAGGAGTTGG - Intergenic
1119047975 14:71337730-71337752 GTTCACTTGAGCCTAGGAGTTGG + Intronic
1120115953 14:80617718-80617740 GATCTCTTGAGCCCAGGAGTCGG + Intronic
1120312722 14:82851312-82851334 GATCACTTGAGCCCAGGTGTTGG - Intergenic
1120401140 14:84033457-84033479 ACTTTCTTCAGCCTATGTGCTGG - Intergenic
1121074376 14:91055556-91055578 GATCTCTTGAGCCCAGGAGTTGG + Intronic
1121336385 14:93079912-93079934 GCACACTTGAGCCTGTCTGTGGG - Intronic
1122217444 14:100213752-100213774 GATCGCTTGAGCCTAGGAGTTGG - Intergenic
1122717844 14:103706114-103706136 GGTCTCCTGAGCCTCCGTGTCGG - Intronic
1123665172 15:22603314-22603336 GATCACTTGAGCCTAAGAGTTGG + Intergenic
1124319003 15:28697736-28697758 GATCACTTGAGCCTAAGAGTTGG + Intergenic
1125001828 15:34778824-34778846 GATCCCTTGAGCCTGTGTGGTGG - Intergenic
1125561867 15:40639984-40640006 GATCGCTTGAGCCTAGGAGTTGG + Intronic
1126615944 15:50579993-50580015 GATCGCTTGAGCCCAGGTGTTGG - Intronic
1127986244 15:64073686-64073708 GATCTCTTGAGCCCAGGAGTTGG - Intronic
1128165559 15:65461363-65461385 GATCACTTGAGCCTAGGAGTTGG - Intronic
1128221546 15:65972485-65972507 GATCTCTTGAGCCCAGGAGTTGG + Intronic
1129145922 15:73647296-73647318 GATCTCTTGAGCCCATGAATTGG - Intergenic
1129307178 15:74674189-74674211 GATCACTTGAGCCTAGGAGTTGG - Intronic
1131402308 15:92134986-92135008 GCTCACTTGAGCCCAGGAGTTGG + Intronic
1131720876 15:95166914-95166936 GATCTCTTGAGGCTAGGTATTGG - Intergenic
1132740960 16:1413156-1413178 GATCACTTGAGCCTAGGAGTTGG + Intronic
1133048615 16:3103532-3103554 GCTCACTTGAGCCCAGGAGTTGG + Intergenic
1133133914 16:3696062-3696084 GCTCTCTGTAGCCTAAGTGGGGG - Intronic
1133151736 16:3838053-3838075 GATCACTTGAGCCTGTGAGTTGG - Intronic
1133200196 16:4199590-4199612 GATCTCTTGAGCCCAGGAGTTGG - Intronic
1133682061 16:8129048-8129070 GATCTCCTGAGCCTGTGTCTTGG - Intergenic
1133849058 16:9484983-9485005 GCTATGTTTAGCCTTTGTGTGGG - Intergenic
1133963206 16:10512176-10512198 GATCTCTTGAGCCCAAGAGTTGG - Intergenic
1135021237 16:18964826-18964848 GCTCTCTTGAGCCCAGGAGTTGG + Intergenic
1135083639 16:19457305-19457327 GATCACTTGAGCCTAGGAGTTGG + Intronic
1135507511 16:23051630-23051652 CTTCTCTTGAGCCTGCGTGTTGG - Intergenic
1135535845 16:23293835-23293857 GATCTCTTGAGCCTAGGAGGTGG + Intronic
1135889641 16:26345600-26345622 GATCACTTGAGCCCATGAGTTGG + Intergenic
1136131648 16:28225716-28225738 GATCTCTTGAGCCCAGGAGTTGG + Intergenic
1138168583 16:54827289-54827311 GTTCTCTTGAGCATATATGTAGG + Intergenic
1138478568 16:57286420-57286442 GATCACTTGAGCCTAGGGGTTGG - Intergenic
1138517660 16:57545463-57545485 GATCGCTTGAGCCCAGGTGTTGG + Intronic
1139402469 16:66693933-66693955 GGTCTCTTGAGCCCAGGTGGCGG + Intronic
1139735575 16:68985092-68985114 GATCACTTGAGCCCAGGTGTTGG - Intronic
1140006220 16:71078589-71078611 GATCTCTTGAGCCCAGGAGTTGG - Intronic
1140840415 16:78833126-78833148 GATCGCTTGAGCCTAGGAGTTGG - Intronic
1141484681 16:84330795-84330817 GCTGTCTGGAGCCTGAGTGTGGG - Intergenic
1142685113 17:1573087-1573109 GATCCCTTGAGCCCATGAGTTGG + Intronic
1143228386 17:5328421-5328443 GATCACTTGAGCCTAGGAGTTGG + Intronic
1143827908 17:9627805-9627827 GATCTCTTGAGCCTAGGGGTTGG - Intronic
1144747833 17:17627405-17627427 TATCTCTTGAGCCTATGAGTTGG - Intergenic
1145187820 17:20810732-20810754 GATCTCTTGAGCCCAGGAGTTGG - Intergenic
1145363476 17:22231438-22231460 GATCTCTTGAACCTAGGAGTTGG + Intergenic
1146018374 17:29251698-29251720 GATCGCTTGAGCCCATGAGTTGG - Intronic
1146591292 17:34130074-34130096 GCACTCTTCAGGCTATCTGTGGG + Intronic
1146851158 17:36222887-36222909 GATCTCTTGAGCCCAGGAGTTGG + Intronic
1146867075 17:36346755-36346777 GATCTCTTGAGCCCAGGAGTTGG + Intronic
1147026267 17:37587231-37587253 GATCTCTTGAGCCCAAGAGTTGG - Intronic
1147069945 17:37947364-37947386 GATCTCTTGAGCCCAGGAGTTGG + Intergenic
1147081474 17:38026902-38026924 GATCTCTTGAGCCCAGGAGTTGG + Intronic
1147097420 17:38150859-38150881 GATCTCTTGAGCCCAGGAGTTGG + Intergenic
1148375201 17:47137885-47137907 GATCACTTGAGCCTAGGTGGCGG - Intronic
1149747107 17:59109086-59109108 GATCTCTTGAGCCCAGGAGTTGG + Intergenic
1149826336 17:59831968-59831990 GCTCTCTTGAGCCCAGGAGTTGG - Intronic
1150029719 17:61720055-61720077 GTTTTCTTGAGCTTATGAGTTGG - Intronic
1150079124 17:62220983-62221005 GATCTCTTGAGCCCAGGAGTTGG + Intergenic
1150083453 17:62261401-62261423 GCTGTCTTGCTTCTATGTGTTGG - Intergenic
1150341956 17:64375596-64375618 GATCTCTTGAGCCCAGGAGTTGG + Intronic
1151463691 17:74271090-74271112 GATCGCTTGAGCCTAGGAGTTGG + Intergenic
1151734249 17:75929075-75929097 GCTCGCTTGAGCCTAGGAGTTGG - Intronic
1152047615 17:77948133-77948155 GATCACTTGAGCCTAAGAGTTGG + Intergenic
1152847092 17:82607885-82607907 GCTCACTTGAGCCCAGGAGTTGG + Intronic
1153146485 18:2038728-2038750 GCTCTCTTGAAGATATGTTTGGG - Intergenic
1153163919 18:2240738-2240760 GCACTGTGGAGCCTATGTCTAGG - Intergenic
1153448593 18:5200272-5200294 GATCTCTTGAGCCTAGGAGGCGG - Intergenic
1154140793 18:11822381-11822403 GATCGCTTGAGCCTAAGAGTTGG + Intronic
1154267594 18:12892673-12892695 GCTCTCTTGAGCCCAAGAGTTGG - Intronic
1155850213 18:30765282-30765304 GCTCTCCTAACCCTATATGTCGG + Intergenic
1157653947 18:49366568-49366590 GATCTCTTGAGCCCAGGAGTTGG + Intronic
1158500171 18:57993784-57993806 GATCTCTTGAGCCCAGGAGTTGG + Intergenic
1158666545 18:59438036-59438058 GCTCTGATGAGCCTATAGGTTGG - Intronic
1159216404 18:65396755-65396777 GATCTCTTGAGCCCAGGAGTTGG + Intergenic
1160203108 18:76811305-76811327 GCTCTCTTGAGCCCAAGAGTTGG - Intronic
1160403205 18:78626569-78626591 GATCTCTTGAGCCCAGGAGTTGG + Intergenic
1160961599 19:1724362-1724384 GATCTCTTGAGCCCAGGAGTTGG - Intergenic
1161157946 19:2743720-2743742 GATCTCTTGAGCCCAGGAGTTGG + Intergenic
1161359883 19:3842097-3842119 GATCTCTTGAGCCCAGGAGTTGG - Intronic
1161516867 19:4701379-4701401 GATCACTTGAGCCTAGGAGTTGG + Intronic
1161993012 19:7695828-7695850 GATCTCTTGAGCCCAGGAGTTGG + Intronic
1162342072 19:10097182-10097204 GATCACTTGAGCCTAGGAGTTGG + Intronic
1162568349 19:11456748-11456770 GATCGCTTGAGCCTAGGAGTTGG - Intronic
1162686147 19:12386329-12386351 GATCTGTTGAGCCTAGGAGTTGG + Intronic
1162749263 19:12818474-12818496 GCTCACTTGAACCCATGTGGCGG - Intronic
1162929662 19:13951412-13951434 GATCACTTGAGCCCAGGTGTTGG + Intronic
1163004315 19:14388139-14388161 GATCTCTTGAGCCTAGGAATTGG + Intronic
1163027193 19:14519009-14519031 GATCTCTTGAGCCTAGGAGTTGG + Intronic
1163259839 19:16182386-16182408 GATCACTTGAGCCTGGGTGTAGG - Intergenic
1163615640 19:18326390-18326412 GATCTCTTGAGCCCAGGAGTTGG - Intergenic
1165169730 19:33883430-33883452 GTTCTCTTGAGCCCAGGAGTTGG - Intergenic
1165178931 19:33951230-33951252 GATCTCTTGAGCCCAGGAGTTGG + Intergenic
1165370816 19:35404791-35404813 GATCACTTGAGCCTAGGAGTTGG - Intergenic
1165450356 19:35878817-35878839 GCTCTCTTGGGCCCTTGGGTAGG + Intronic
1165795736 19:38518030-38518052 GATCTCTTGAGCCCAGGAGTTGG + Intronic
1165905763 19:39193760-39193782 GATCACTTGAGCCTAGGAGTTGG - Intergenic
1166082668 19:40454148-40454170 GATCCCTTGAGCCTAGGAGTTGG + Intronic
1166092110 19:40516387-40516409 GATCGCTTGAGCCTAGGTGTTGG - Intronic
1166521056 19:43480367-43480389 GATCACTTGAGGCTATGAGTTGG + Intronic
1166868485 19:45855772-45855794 GATCGCTTGAGCCTAGGAGTCGG + Intronic
1167656840 19:50770460-50770482 GATCTCTTGAGCCTAGGAGGTGG + Exonic
1167755815 19:51412852-51412874 GATCTCTTGAGCCTGGGAGTTGG - Intronic
1167835859 19:52069158-52069180 GATCGCTTGAGCCTGTGAGTTGG - Intronic
1168106765 19:54170247-54170269 GATCGCTTGAGCCCAGGTGTCGG + Intronic
1168515625 19:57008335-57008357 GCTCGCTTGAGCCTAGGAGTTGG + Intergenic
1168675011 19:58271378-58271400 GATCACTTGAGCCTAAGAGTTGG + Intronic
925331638 2:3063124-3063146 GCTCTGTTGAGCCTCTGAGAGGG + Intergenic
926672568 2:15589843-15589865 GATCTCTTGAGCCTAGGAGGTGG - Intergenic
927356146 2:22175743-22175765 GCTTGCTTGAGCCTAAGTCTGGG + Intergenic
928045385 2:27925805-27925827 GCTCTCATGCGCCTGAGTGTGGG + Intronic
928138677 2:28708698-28708720 GGTCTCTGGAGCCTAAGAGTTGG + Intergenic
930640405 2:53848640-53848662 GATCGCTTGAGCCCATGAGTTGG + Intergenic
930660739 2:54050460-54050482 GATCTCTTGAGCCCAGGAGTTGG + Intronic
930662699 2:54070821-54070843 GATCACTTGAGCCTGGGTGTTGG - Intronic
932106680 2:68949639-68949661 GATCTCTTGAGCCCAGGAGTTGG - Intronic
932186431 2:69700293-69700315 GATCTCTTGAGCCCAGGAGTTGG + Intronic
932293257 2:70601852-70601874 GATCACTTGAGCCTAGGAGTTGG - Intergenic
932482490 2:72054384-72054406 TTTCTCTTGAGTATATGTGTAGG + Intergenic
933258328 2:80105641-80105663 GATCTCTTGAGCCTAGGAGGTGG + Intronic
933615984 2:84483045-84483067 GATCACTTGAGCCTAGGAGTTGG - Intergenic
933816508 2:86072989-86073011 GATCTCTTGGGCCTAGGAGTTGG + Intronic
933910791 2:86939819-86939841 GATCTCTTGAGGCTAGGTGTTGG - Intronic
933914300 2:86972639-86972661 GATCACTTGAGCCTAGGAGTTGG - Intronic
934008693 2:87797260-87797282 GATCACTTGAGCCTAGGAGTTGG + Intronic
934021938 2:87963591-87963613 GATCTCTTGAGGCTAGGTGTTGG + Intergenic
935649486 2:105370149-105370171 GATCTCTTGAGCCCAGGAGTTGG + Intronic
935772339 2:106438261-106438283 GATCACTTGAGCCTAGGAGTTGG + Intronic
935907733 2:107857654-107857676 GATCACTTGAGCCTAGGAGTTGG - Intronic
935990678 2:108716434-108716456 GATCTCTTGAGGCTAGGTGTTGG - Intergenic
936129525 2:109822800-109822822 GATCACTTGAGCCTAGGAGTTGG - Intronic
936215172 2:110548685-110548707 GATCACTTGAGCCTAGGAGTTGG + Intronic
936424309 2:112403258-112403280 GATCACTTGAGCCTAGGAGTTGG + Intronic
936594594 2:113835806-113835828 GATCTCTGGAGCCTAGGAGTTGG - Intergenic
936597350 2:113861362-113861384 GATCGCTTGAGCCTAGGAGTTGG + Intergenic
937160653 2:119758519-119758541 GATCTCTTGAGCCCAGGAGTTGG + Intergenic
937372956 2:121314988-121315010 GATCTCTTGAGCCTGGGTGGTGG - Intergenic
940221280 2:151354662-151354684 GATCACTTGAGCCTAGGAGTTGG - Intergenic
941774531 2:169377718-169377740 GCTCGCTTGAGCCCAAGAGTTGG + Intergenic
942639189 2:178042833-178042855 GCGCTCTTGCCCCTAAGTGTAGG - Intronic
944076830 2:195742311-195742333 GCTCACTTGGACCTGTGTGTAGG - Intronic
944586414 2:201177685-201177707 GATCACTTGAGCCTAGGAGTTGG - Intergenic
944759411 2:202798312-202798334 GATCTCTTGAGCCTGGGAGTTGG - Intronic
945102901 2:206279000-206279022 GCTCTCTTGAGCCTATGTGTTGG + Intronic
945838881 2:214865255-214865277 GCTCTCTGGTGGCTATGTGGAGG + Intergenic
946782422 2:223205313-223205335 GCTCTGTTGAGCCCATGCTTTGG - Intergenic
947164743 2:227250461-227250483 GGTCTCTTGAGCCTAGTTATAGG + Intronic
1169212345 20:3773994-3774016 GCTCACTTGAACCTAGGAGTTGG + Intergenic
1169452874 20:5727194-5727216 GCACTCTGGAGGCCATGTGTTGG - Intergenic
1169699547 20:8430869-8430891 GCTCTCTTGAGCCCAGAAGTAGG + Intronic
1172026581 20:31952880-31952902 GTTCACTTGAGCCCCTGTGTTGG + Intergenic
1172253775 20:33498660-33498682 GATCGCTTGAGCCCAGGTGTTGG + Intronic
1172642355 20:36448128-36448150 GATCACTTGAGCCTAGGAGTTGG + Intronic
1172809649 20:37638134-37638156 GATCACTTGAGCCTAGGAGTTGG - Intergenic
1173995167 20:47332486-47332508 GATCACTTGAGCCCATGAGTTGG + Intronic
1176126246 20:63476306-63476328 GCTCACTTGAGCCCAGGAGTTGG + Intergenic
1176133017 20:63504621-63504643 GATCACTTGAGCCCATGAGTTGG - Intergenic
1177091989 21:16780652-16780674 GATCTCTTGAGCCCAGGAGTTGG + Intergenic
1179528112 21:41997141-41997163 GATCTCTTGAGCCCACGAGTTGG - Intronic
1179778217 21:43681728-43681750 GATCACTTGAGCCTAGGAGTTGG + Intronic
1179954899 21:44733122-44733144 GCTCTCTGCATCCTCTGTGTGGG + Intergenic
1180036562 21:45253319-45253341 GCTCTCCTGGGGCTATGTCTTGG + Intergenic
1180964979 22:19783461-19783483 GATCACTTGAGCCTATTAGTTGG + Exonic
1181271214 22:21659750-21659772 AATCTCTTGAGCCTAGGAGTTGG + Intronic
1181403515 22:22666108-22666130 GCTCTTTTGAGCCCCTGTCTTGG - Intergenic
1181543212 22:23585222-23585244 GATCGCTTGAGCCTAAGAGTTGG - Intergenic
1181543260 22:23585602-23585624 GATCACTTGAGCCTAGGAGTTGG - Intergenic
1181997679 22:26895717-26895739 GATCTCTTGAGCCCAGGAGTTGG + Intergenic
1182629250 22:31672062-31672084 GATCACTTGAGCCTAGGAGTTGG - Intergenic
1183290540 22:36999407-36999429 GCTTTCTTGAGCCTGTGAGGTGG + Intronic
1183857177 22:40642744-40642766 GATCGCTTGAGCCCAGGTGTTGG - Intergenic
1183876260 22:40784685-40784707 GATCTCTTGAGCCCAGGAGTTGG + Intronic
1183918165 22:41140583-41140605 GATCACTTGAGCCTAGGAGTTGG + Intronic
1183998339 22:41653180-41653202 GATCACTTGAGCCTAGGAGTTGG + Intronic
1185005528 22:48274450-48274472 GATCTCTTGAGCCCAGGAGTTGG + Intergenic
1203325251 22_KI270738v1_random:8010-8032 GATCTCTTGAGTCTAGGGGTTGG - Intergenic
952275474 3:31871647-31871669 GATCGCTTGAGCCCATGAGTTGG + Intronic
953067444 3:39487025-39487047 GATCTCTTGAGCCTGGGAGTTGG - Intronic
953642899 3:44726328-44726350 GATCGCTTGAGCCCAGGTGTTGG + Intergenic
954082669 3:48221746-48221768 GCTCAGATGAGCCTATGTGATGG + Intergenic
955189624 3:56748249-56748271 GATCTCTTGAGCCCAGGAGTTGG - Intronic
956435211 3:69228611-69228633 GATCTCTTGAGCCCAGGAGTTGG + Intronic
956740800 3:72274262-72274284 GATCTCTTTAACCTATGAGTGGG + Intergenic
957429846 3:80089363-80089385 GATCTCTTGAGCCCAGGAGTTGG - Intergenic
959047554 3:101491477-101491499 GATCTCTTGAGCCCAGGAGTTGG - Intronic
959991578 3:112637761-112637783 GCTCTCCTGGGCTCATGTGTAGG + Intronic
960054687 3:113268691-113268713 GATCTCTTGAGCCTTGGTGATGG - Intronic
960118015 3:113917047-113917069 GATCTCTTGAGCCTGGGAGTTGG + Intronic
960644804 3:119867623-119867645 GCTCCGTTGTGCCTAGGTGTTGG - Intronic
960976268 3:123177757-123177779 GCTCACTTGAGCCCAGGAGTTGG - Intronic
961775391 3:129280322-129280344 GATCACTTGAGCCTAGGAGTTGG + Intronic
962118249 3:132534556-132534578 GCTCTCTTGAGCCTAGGAGGTGG + Intronic
962261536 3:133912033-133912055 GATCTCTTGAGCCCAGGAGTTGG + Intergenic
963143231 3:141965408-141965430 GTTCTCTTGAGCCTAGGAGTTGG + Intronic
963229388 3:142894235-142894257 GATCACTTGAGCCTAGGAGTTGG + Intergenic
963883594 3:150555148-150555170 GATCTCTTGAGCCCAGGAGTTGG - Intronic
965570333 3:170165879-170165901 GATCACTTGAGCCCAAGTGTTGG + Intronic
966303389 3:178503608-178503630 GATCTCTTGAGCCTAGGAGGAGG - Intronic
966392717 3:179469229-179469251 GATCTCTTGAGACTATGTCATGG + Intergenic
966723236 3:183085540-183085562 GATCACTTGAGCCTGGGTGTTGG + Intronic
967839209 3:193991123-193991145 GATCACTTGAGCCTAGGAGTTGG - Intergenic
968113595 3:196070853-196070875 GCTCACTTGAGCCTGGGTGGTGG + Intronic
968122049 3:196132642-196132664 GATCTCTTGAGCCCAAGAGTTGG - Intergenic
968778209 4:2558466-2558488 GATCTCTTGAGCCTAGGAGTTGG - Intronic
971298015 4:25417209-25417231 GGTCACTTGAGCCCATGAGTTGG - Intronic
971407281 4:26333886-26333908 GATCGCTTGAGCCCAGGTGTTGG - Intronic
972482262 4:39508318-39508340 GATCACTTGAGCCTAGGAGTTGG - Intronic
973106290 4:46342740-46342762 GCTCACTTGAGCCCAGGAGTTGG - Intronic
973742432 4:53931065-53931087 GATCACTTGAGCCCAGGTGTTGG + Intronic
975325901 4:73058532-73058554 TCTCTCTTGAGCCTCTGCCTAGG - Intronic
975873878 4:78812809-78812831 GATCACTTGAGCCTAGGAGTTGG + Intronic
976385546 4:84453647-84453669 GATCACTTGAGCCCAGGTGTTGG - Intergenic
977328682 4:95609026-95609048 GCTCACTTGAGCCCAGGAGTTGG - Intergenic
978029856 4:103927917-103927939 ACTCTTTTTATCCTATGTGTGGG - Intergenic
978967987 4:114766197-114766219 GATCTCTTGAGCCCAGGAGTTGG + Intergenic
979225231 4:118277473-118277495 GCTCGCTTGAGCCTAGGAGGTGG + Intergenic
980116871 4:128687682-128687704 GATCCCTTGAGCCTAAGAGTTGG + Intergenic
980151992 4:129059515-129059537 ACTCTCTTGAGCATTTCTGTAGG + Intronic
980951591 4:139384253-139384275 GATCTCTTGAGCCCAGGAGTTGG + Intronic
980986994 4:139705102-139705124 GCTCGCTTGAGCCCATGTGTTGG - Intronic
981063816 4:140459991-140460013 GCTCACTTGAGCCCAGGAGTTGG - Intronic
981657851 4:147132338-147132360 GCTCTCTTGGGGCTGTGTGAGGG + Intergenic
982317088 4:154042924-154042946 TCTCTCTTGGGCCTATGTTGAGG - Intergenic
983224107 4:165070127-165070149 AATCTCTTGAGCCTAGGAGTTGG - Intergenic
983974880 4:173921764-173921786 GATCTCTTGAGCCTAAGAGTTGG - Intergenic
984807120 4:183761811-183761833 AATCTCTTGAGCCCAGGTGTTGG + Intergenic
986070894 5:4281373-4281395 GATCACTTGAGCCTAGGAGTTGG - Intergenic
987168446 5:15225762-15225784 GATCTCTTGAGCCCAGGCGTTGG + Intergenic
988586877 5:32514802-32514824 GATCGCTTGAGCCTAGGAGTTGG - Intergenic
989212170 5:38866764-38866786 GCTCTCTGGAGCCTGTGTGATGG - Intronic
989383919 5:40835983-40836005 GATCTCTTGAGCCCAGGCGTTGG + Intergenic
990781179 5:59365235-59365257 GATCTCTTGAGCCCAGGAGTTGG + Intronic
991076248 5:62541592-62541614 GATCTCTTGAGCCTGGGGGTTGG + Intronic
992248643 5:74855280-74855302 GATCTCTTGAGCCTAGGAGATGG - Intronic
992791089 5:80214673-80214695 GATCACTTGAGGCTATGAGTTGG + Intronic
993698928 5:91095284-91095306 GCTCTCTTGAGCCTGGGAGGTGG - Intronic
995858493 5:116618146-116618168 GCTCTCTTGTGACTTTCTGTGGG - Intergenic
995879432 5:116827376-116827398 GATCACTTGAGCCTAGGAGTTGG + Intergenic
996847634 5:127917916-127917938 GGTCACTTGAGCCCAGGTGTTGG + Intergenic
996868189 5:128154188-128154210 GATCACTTGAGCCTAGGAGTTGG + Intronic
997520023 5:134517158-134517180 GATCTCTTGAGCCTAGGAGGTGG + Intergenic
998623405 5:143819282-143819304 GCTCTTTTCAGCTTAAGTGTTGG - Intronic
1000473904 5:161680767-161680789 TCTCTCTGGGGCCTCTGTGTGGG + Intronic
1001977948 5:176015756-176015778 GCTCACTTGAGCCTAGGAATTGG - Intronic
1002239471 5:177828006-177828028 GCTCACTTGAGCCTAGGAATTGG + Intergenic
1002492400 5:179587939-179587961 GATCACTTGAGCCTAGGAGTTGG + Intronic
1003277354 6:4664085-4664107 GCTCTCTTGTGCCTTGGAGTTGG + Intergenic
1004206391 6:13595285-13595307 GATCGCTTGAGCCCATGAGTTGG + Intronic
1006498909 6:34444834-34444856 GATCTCTTGAGCCCAGGAGTTGG + Intergenic
1006741177 6:36310158-36310180 TCTTTCATGGGCCTATGTGTTGG + Intergenic
1006957365 6:37885827-37885849 GATCACTTGAGCCTAGGAGTTGG - Intronic
1006995587 6:38256994-38257016 GATCACTTGAGCCTAGGAGTTGG - Intronic
1008106692 6:47446318-47446340 GATCACTTGAGCCTATGAGGTGG + Intergenic
1008276319 6:49548753-49548775 GGTGTCTTGAGCCTAGGAGTTGG - Intergenic
1008942479 6:57062016-57062038 GATCTCTTGAGCCCAGGTGGTGG - Intergenic
1009631550 6:66207639-66207661 GGTCTCTTCAGCTTATGTGGTGG + Intergenic
1009949221 6:70376263-70376285 GCTCTCTTGTTTCTATGTTTTGG - Intergenic
1010876284 6:81110731-81110753 GCACTCTTGAGCCCAGGAGTGGG - Intergenic
1011531163 6:88322562-88322584 GCTTTGCTGAGCCTCTGTGTAGG - Intergenic
1013093392 6:106921497-106921519 GATCTCTTGAGCCCAGGAGTTGG + Intergenic
1014146738 6:118006530-118006552 GATCACTTGAGCCTAGGGGTTGG + Intronic
1014215742 6:118751074-118751096 GATCTCTTGAGCCTAGGAGGCGG + Intergenic
1014404662 6:121036428-121036450 GATCACTTGAGCTTATGTGTTGG - Intergenic
1014959382 6:127663791-127663813 GCTCTCTTGTGCCTCAGTGGTGG + Intergenic
1015104062 6:129515864-129515886 GATCTCTTGAGCCCAGGAGTTGG + Intronic
1016672255 6:146722464-146722486 GCTCTCTTGAAACTGTGGGTTGG - Intronic
1017080952 6:150668142-150668164 TCTCACTTCAGGCTATGTGTGGG - Intronic
1017462452 6:154664230-154664252 GATCACTTGAGCCTAGGAGTTGG - Intergenic
1018184296 6:161252599-161252621 GATCTCTTGAGCCCAGGAGTTGG + Intronic
1018750638 6:166801427-166801449 GATCACTTTAGCCTATGAGTTGG - Intronic
1018792596 6:167160753-167160775 GATCCCTTGAGCCTAGGAGTTGG - Intronic
1018953562 6:168393667-168393689 GGTCTCTCCAGCCTGTGTGTGGG + Intergenic
1019177429 6:170167246-170167268 GCTCTCTTGCGCCTCTGCGGAGG - Intergenic
1019187027 6:170226742-170226764 GCTCTCTCCTGCCTGTGTGTGGG + Intergenic
1019682111 7:2356151-2356173 GCTCTCTTAAGCCTTTAAGTTGG + Intronic
1020040960 7:5000703-5000725 GATCTCTTGAGCCCAGGCGTTGG + Intronic
1020183309 7:5939359-5939381 GATCACTTGAGCCCAGGTGTTGG + Intronic
1020466879 7:8489953-8489975 ACTCTATTGAGCCTATGTCTTGG + Intronic
1020708004 7:11569948-11569970 GATCACTTGAGCCTAGGAGTTGG + Intronic
1022706913 7:32810410-32810432 GATCTCTGGAGCCTAGGGGTTGG + Intergenic
1022722195 7:32951273-32951295 GATCTCTTGAGCCCAGGAGTTGG + Intergenic
1023125782 7:36952721-36952743 CCTCTCTTGAGACTCTGTGATGG - Intronic
1024006423 7:45227877-45227899 GGTCTCTTGAGTCTATGGGAAGG - Intergenic
1024533108 7:50409453-50409475 GCTTTGTTGAACCTATTTGTGGG - Intergenic
1024687681 7:51765018-51765040 GATCGCTTGAGCCTAGGAGTTGG + Intergenic
1025111561 7:56221203-56221225 GATCCCTTGAGCCTAGGAGTTGG + Intergenic
1025851740 7:65250032-65250054 CCACTCTTGGGACTATGTGTAGG + Intergenic
1025995973 7:66527842-66527864 GATCCCTTGAGCCTAGGAGTTGG + Intergenic
1026121898 7:67545044-67545066 GATCTCTTGAGCCTAGGAGTTGG + Intergenic
1026121986 7:67545805-67545827 GATCTCTTGAGCCTAGGAGTTGG - Intergenic
1026171009 7:67953835-67953857 GATCTCTTGAGCCCAGGAGTTGG + Intergenic
1026325506 7:69305956-69305978 GGTCTCTTGAGCCCAGGAGTTGG - Intergenic
1026657978 7:72273730-72273752 GATCACTTGAGCCTAGGAGTTGG - Intronic
1026913877 7:74108249-74108271 GCTCGCTTGAGCCCAGGAGTTGG + Intronic
1027166419 7:75837631-75837653 GATCACTTGAGCCCAGGTGTTGG - Intergenic
1027700056 7:81458740-81458762 GATCTCTTGAGACCATGAGTTGG - Intergenic
1028105299 7:86869432-86869454 GTTTTCTTGACCCTCTGTGTTGG - Intergenic
1029002432 7:97168055-97168077 GGTCTCTTCAGCTTATGTGTGGG + Intronic
1030357715 7:108560822-108560844 GATCTCTTGAGCCTAGGTCAAGG - Intronic
1031597465 7:123664618-123664640 GATCTCTTGAGCCCAGGAGTTGG - Intergenic
1032234291 7:130106754-130106776 GATCTCTTGAGCCCAAGAGTTGG + Intronic
1033093284 7:138406507-138406529 GATCTCTTGAGCCTATGTTGAGG - Intergenic
1033141632 7:138832281-138832303 GATCGCTTGAGCCAATGAGTTGG - Intronic
1033145435 7:138867022-138867044 GATCGCTTGAGCCCAGGTGTTGG - Intronic
1034143965 7:148851782-148851804 GATCTCTTGAGCCTGTGAGGTGG + Intronic
1034713918 7:153221626-153221648 GCTCTTTTGAGCCTTGTTGTGGG + Intergenic
1035338351 7:158144414-158144436 GATTTCTTGAGCCTAGGAGTTGG + Intronic
1036125499 8:6058148-6058170 GATCACTTGAGCCTAGGAGTTGG + Intergenic
1036128348 8:6084598-6084620 GATCTCTTGAGCCCAGGAGTTGG + Intergenic
1036822849 8:11953960-11953982 ACTCTGTTGAGCCTTTGTGCAGG - Intergenic
1037801465 8:22038130-22038152 GATCTCTTGAGCCCAGGAGTTGG - Intergenic
1038978596 8:32730224-32730246 GATCTCTTGAGCCCAGGAGTTGG + Intronic
1039010892 8:33091426-33091448 GCTCTCTTGAGCCCAGGTGAAGG - Intergenic
1039096304 8:33889992-33890014 GATCACTTGAGCCTAGGAGTTGG - Intergenic
1039179201 8:34845645-34845667 CCTCTCTTGAGACTGTGGGTTGG - Intergenic
1040482921 8:47842451-47842473 GCTCTCCTGAGGCTCTGTATAGG - Intronic
1041269308 8:56095103-56095125 GCTCTCTTGCCACTATGTTTTGG - Intergenic
1041437681 8:57860471-57860493 GCTCACTTGAACCTAGGAGTTGG + Intergenic
1042143481 8:65703297-65703319 GATCACTTGAGCCTAGGAGTTGG + Intronic
1042151028 8:65784120-65784142 GATCCCTTGAGCCTAGGAGTTGG + Intronic
1042180151 8:66079685-66079707 GTTCTCTTGAACCCATGTGATGG - Intronic
1043154676 8:76763399-76763421 GATCACTTGAGCCTAGGAGTTGG + Intronic
1043275910 8:78392492-78392514 CCTCTCAGTAGCCTATGTGTGGG - Intergenic
1044054983 8:87557569-87557591 GATCTCTTTAGCATTTGTGTTGG - Intronic
1045465665 8:102467611-102467633 GGTCTCTTGAGCCCAGGAGTTGG - Intergenic
1045470043 8:102504249-102504271 GATCACTTGAGCCTAGGAGTTGG + Intergenic
1045536756 8:103036363-103036385 CCTCCCTAGAGCCTAGGTGTTGG - Intronic
1045625991 8:104051150-104051172 GATGTCTTGAGCCTAGGAGTTGG + Intronic
1045648014 8:104318062-104318084 GGTCTCTTGAGCCCAGGAGTTGG - Intergenic
1045715735 8:105042396-105042418 GGTCACTTGAGCCTAGGTGTTGG - Intronic
1046071471 8:109260279-109260301 GATCTCTTGAGCCCAAGAGTTGG - Intronic
1046307014 8:112382055-112382077 GATCTCTTGAGGCCATGAGTTGG + Intronic
1048080044 8:131116938-131116960 ACTCACTTGAGCCTAGGAGTTGG - Intergenic
1048308833 8:133302655-133302677 GATCTCTTGAGCCCAGGAGTTGG - Intergenic
1050094503 9:2049696-2049718 GCTCTCTTCTGCCTATTTGAAGG + Intronic
1050337041 9:4599700-4599722 GCTCCCTTGAGCCTATTTATAGG + Intronic
1050923636 9:11235799-11235821 GCTCTGTTGAGGCTATGGGTGGG + Intergenic
1051350066 9:16190794-16190816 GATCACTTGAGCCCAGGTGTTGG - Intergenic
1051448503 9:17168169-17168191 CCTCTTTTGATTCTATGTGTTGG + Intronic
1052077404 9:24159868-24159890 GATCTCTTGAGCCCAGGAGTTGG - Intergenic
1054883011 9:70164733-70164755 GCTCTCTTGAACCCAGGAGTTGG - Intronic
1055323478 9:75104451-75104473 GATCTCTTGAGCCCAGGAGTTGG + Intronic
1055725250 9:79220989-79221011 GGTCACTTGAGACTTTGTGTGGG - Intergenic
1055780008 9:79810762-79810784 GATCACTTGAGCCTAGGAGTTGG - Intergenic
1056573743 9:87838988-87839010 GATCGCTTGAGCCTAGGAGTTGG - Intergenic
1056597272 9:88017919-88017941 GATTGCTTGAGCCTAGGTGTTGG - Intergenic
1056982160 9:91324414-91324436 GATCTCTTGAGCCCAGGAGTTGG + Intronic
1057560701 9:96125954-96125976 GATCACTTGAGCCTAGGAGTTGG + Intergenic
1057856032 9:98601428-98601450 GATCACTTGAGCCTATGAGTTGG + Intronic
1058596849 9:106624079-106624101 GATCCCTTGAGCCTAGGAGTTGG + Intergenic
1058812242 9:108652346-108652368 GATCACTTGAGCCTAGGAGTTGG - Intergenic
1059487682 9:114639356-114639378 GATCTCTTGAGCCCAGGAGTTGG - Intronic
1061036325 9:128116225-128116247 GATCACTTGAGCCCATGAGTTGG + Intergenic
1062669596 9:137699760-137699782 GATCTCTTGAGCCCAGGAGTTGG + Intronic
1185502116 X:604892-604914 GATCTCTTGAGCCCAGGAGTTGG + Intergenic
1185802473 X:3026213-3026235 GCTCGCTTGAGCCCAGGAGTTGG + Intronic
1185807127 X:3068504-3068526 GATCTCTTGAGCCCAGGAGTTGG - Intronic
1185862752 X:3594351-3594373 GATCTCTTGAGCCCAGGAGTTGG + Intergenic
1186027582 X:5329950-5329972 GCTGTCTTCAGTCTCTGTGTGGG - Intergenic
1186490879 X:9970968-9970990 ACTCTCTTGAGCCCAAGAGTTGG + Intergenic
1186735798 X:12462765-12462787 GATCACTTGAGCCCAGGTGTTGG + Intronic
1187276547 X:17820984-17821006 GATTTCTTGAGCCTAGGAGTTGG - Intronic
1187410395 X:19045969-19045991 GATCCCTTGAGCCCATGAGTGGG - Intronic
1187832023 X:23391941-23391963 GATCTCTTGAGCCTCGGAGTTGG - Intronic
1188628683 X:32322474-32322496 GATCTCCTGAGCCTAGGAGTTGG + Intronic
1189121884 X:38404048-38404070 GCTTTCTTCAGCCTTTGTGGTGG - Intronic
1189162771 X:38827493-38827515 GATCACTTGAGCCCAGGTGTTGG + Intergenic
1189500345 X:41550673-41550695 GATCACTTGAGCCTAGGAGTTGG + Intronic
1189778459 X:44491181-44491203 GATCACTTGAGCCTAGGAGTTGG + Intergenic
1191989577 X:67019625-67019647 ACTCTCTGGAGACTAAGTGTTGG + Intergenic
1192118686 X:68434466-68434488 GCTGTCTTGAGACTAAGGGTAGG + Intergenic
1192253084 X:69429780-69429802 GGTCCCTTGAGGCTAGGTGTGGG + Intergenic
1192419076 X:71012830-71012852 GATCACTTGAGCCTAGGAGTTGG - Intergenic
1194672065 X:96746120-96746142 GATGTCTTGAGCCTAGGAGTTGG - Intronic
1195689187 X:107609950-107609972 GATCGCTTGAGCCTAGGAGTTGG + Intergenic
1196860218 X:120020323-120020345 GCTCTCTTGAGCCCAGGAGCTGG - Intergenic
1199769191 X:150963344-150963366 GATCGCTTGAGCCTAGGAGTTGG + Intergenic
1200890371 Y:8317213-8317235 GCTGTCTTGTCTCTATGTGTAGG + Intergenic
1200900209 Y:8423967-8423989 GCTCTCTGAAGCCTACGTGCTGG + Intergenic
1201576837 Y:15470018-15470040 GATCCCTTGAGCCTAGGAGTTGG + Intergenic
1201585855 Y:15560348-15560370 ACTCTCTTGAGCCTCAGAGTTGG + Intergenic
1201781707 Y:17730099-17730121 GATCACTTGAGCCAATGAGTCGG + Intergenic
1201819846 Y:18175891-18175913 GATCACTTGAGCCAATGAGTCGG - Intergenic