ID: 945105345

View in Genome Browser
Species Human (GRCh38)
Location 2:206307162-206307184
Sequence AATTAGTCACTGAATGAAGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 320
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 292}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945105345_945105349 25 Left 945105345 2:206307162-206307184 CCCTCTTCATTCAGTGACTAATT 0: 1
1: 0
2: 1
3: 26
4: 292
Right 945105349 2:206307210-206307232 AAATCCTCAAAAAGAAGAGCAGG 0: 1
1: 0
2: 3
3: 23
4: 379

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945105345 Original CRISPR AATTAGTCACTGAATGAAGA GGG (reversed) Exonic
902491892 1:16788724-16788746 AATGAGTGACTGAATGAATGAGG - Intronic
902665668 1:17935906-17935928 AAATAATGAATGAATGAAGATGG - Intergenic
903756004 1:25661276-25661298 AATGAGTCAGTGAATGAAATGGG - Intronic
903856430 1:26340196-26340218 AATGAGTGAGTGAATGAAAATGG - Intronic
905590717 1:39160917-39160939 AGTCAGTAACTAAATGAAGAGGG - Intronic
905951056 1:41951150-41951172 AATTAAATACTGAAAGAAGAAGG + Intronic
906467371 1:46094803-46094825 AACTAATCTCTGAATGAAAATGG + Intronic
907920320 1:58905402-58905424 AGATGTTCACTGAATGAAGACGG + Intergenic
908914787 1:69113953-69113975 AGTTAACCACTGAAGGAAGATGG - Intergenic
909316198 1:74222905-74222927 AATTAGTCACTGAGTCAACAAGG + Intronic
912669408 1:111610456-111610478 AACTAGTTACTGAAAGAAAAAGG + Intronic
915016182 1:152736437-152736459 AATGAGTGACTGTATGAAGGTGG + Intergenic
915492722 1:156260286-156260308 AATGGCTCACTGAATGAAGAAGG + Intronic
915680986 1:157581848-157581870 AATGATTCACTGAAGGTAGAGGG - Intronic
919010559 1:191956236-191956258 AAATAGGCATTGAATAAAGAGGG + Intergenic
919201133 1:194356751-194356773 AATTAGTGGGTGAATGAAAAGGG + Intergenic
920296494 1:204960483-204960505 ACTTAGACACTGGAGGAAGAAGG - Intronic
920408855 1:205742004-205742026 CAGTAGTCACTCAAGGAAGAGGG + Intronic
920758281 1:208756588-208756610 AGTCAGTCACTGAAAGATGAGGG + Intergenic
921008759 1:211119943-211119965 AATTTGATGCTGAATGAAGATGG - Intronic
923430647 1:233916972-233916994 ATTTGATGACTGAATGAAGAAGG - Intronic
923528554 1:234793815-234793837 AATGAGTGACTGAATGAATGAGG + Intergenic
923881965 1:238113382-238113404 AATTCCTTACTGCATGAAGAGGG + Intergenic
924543212 1:245000836-245000858 TATTATTGAATGAATGAAGAGGG + Intronic
1065009620 10:21409720-21409742 AATTTGTAACTGACTTAAGATGG + Intergenic
1065568818 10:27046697-27046719 AATTAGTGAATGAATTGAGATGG - Intronic
1068765273 10:60756410-60756432 AATTAGTCAGTGAAGGAAATGGG + Intergenic
1069119985 10:64557401-64557423 AATTAGTGAATGGATGAATACGG + Intergenic
1071820692 10:89277542-89277564 AATTAATGAATGAATAAAGATGG + Intronic
1074071751 10:110077864-110077886 AATTATTCACTGACTGAAGTGGG + Intronic
1076802774 10:132839038-132839060 AAGGAGACACTGATTGAAGATGG - Intronic
1078881299 11:15451524-15451546 AATTAGTAACAGGATGTAGATGG - Intergenic
1079002653 11:16770785-16770807 AATTAGTCACAGAATTAATAAGG + Intergenic
1079720854 11:23812074-23812096 TATTAGTCCCTGAATGAGCAGGG + Intergenic
1081028074 11:38040545-38040567 AAGTAGTCCATGAACGAAGAAGG - Intergenic
1081961380 11:47140173-47140195 AATTATCCACTGAATAATGAGGG - Intronic
1082697766 11:56390909-56390931 TATTAGTCAATAAATGAATAGGG - Intergenic
1084064869 11:66698203-66698225 AATAAGTGAATGAATGAACATGG - Intronic
1085298975 11:75447558-75447580 AATGACTCACATAATGAAGAAGG - Intronic
1086294197 11:85346852-85346874 AAGTAGTCAATGAATGGAGAAGG + Intronic
1086642475 11:89176889-89176911 AATTAGTGAGTGAATGAAAAAGG - Intergenic
1087321493 11:96665145-96665167 ATTTAGTTTCTGAATGAAAATGG - Intergenic
1087466157 11:98509238-98509260 AATTAGTGTCTTAATGAACAGGG + Intergenic
1087570349 11:99919432-99919454 ATGTAGTAGCTGAATGAAGAGGG - Intronic
1088373175 11:109113415-109113437 AATAAATGAATGAATGAAGAGGG - Intergenic
1089105460 11:115999729-115999751 AATTATTCACTGGATGTACATGG + Intergenic
1089336432 11:117727049-117727071 AATCAGTCAATGAATGTACAAGG - Intronic
1090046241 11:123336705-123336727 AATTAGTAAGTGAATTAAGCAGG + Intergenic
1091096673 11:132829420-132829442 AATGAGTCAATTAATGAAGATGG + Intronic
1091876200 12:3935366-3935388 AAACAGTCACAGAATGAAAAGGG + Intergenic
1091970935 12:4786375-4786397 AATTAGTACCTTAATGAAGATGG - Intronic
1092618651 12:10238385-10238407 AATTATTCAGTGAATGAAAAAGG - Intergenic
1093636849 12:21480854-21480876 ACTTAGAAACTTAATGAAGAGGG - Intronic
1093936334 12:25004894-25004916 AAATTATCTCTGAATGAAGATGG + Intergenic
1094630829 12:32172162-32172184 GATCAGTTACTGAAAGAAGAGGG + Intronic
1095837596 12:46655374-46655396 AATTATTCACAGAAAGCAGAGGG + Intergenic
1096028905 12:48394117-48394139 AACTAGTTACTGATTGAAGATGG - Intergenic
1096747227 12:53737008-53737030 AATTAGTAACTGCAATAAGAGGG - Intergenic
1097524932 12:60720888-60720910 AATTGGTCACTGTAAGAATAGGG - Intergenic
1098308947 12:69128860-69128882 AATTAGTTACTGAATGACATTGG - Intergenic
1098719336 12:73875731-73875753 AAATATTCACTGAATGTTGAGGG + Intergenic
1099207686 12:79746932-79746954 AATTGGACAATGAATGAATACGG + Intergenic
1099985409 12:89657189-89657211 ACTTAGTAACTGACTGAAGCCGG - Intronic
1100000314 12:89826771-89826793 AATTAGTCACTAATTGCAGTTGG - Intergenic
1100760885 12:97805412-97805434 AATTATTTTCTGAATGTAGAAGG - Intergenic
1101071837 12:101083548-101083570 AATTAGTCAACCAATGAAGTGGG - Intronic
1101143680 12:101821300-101821322 AAGTAGTCACTGAATGAATGAGG + Intronic
1101291931 12:103378966-103378988 AATTAAACAGTGAATGAAAAAGG + Intronic
1102143973 12:110640402-110640424 ATTTAGAGACTGAATGACGATGG - Exonic
1102904642 12:116665154-116665176 AATGAGTGAGTGAATGAAAAAGG - Intergenic
1104326565 12:127804386-127804408 AAAGAGTCAATGAATGAAGTGGG + Intergenic
1104516771 12:129434341-129434363 AAATTGTGACTGAATGAACATGG + Intronic
1105256583 13:18747326-18747348 AATGAGTCCCTGAATTTAGAAGG + Intergenic
1106674642 13:31945426-31945448 AATAAGACACTGACTAAAGAAGG + Intergenic
1107026445 13:35806641-35806663 AGTTAGAAACTGAATGAAGAAGG - Intronic
1107347435 13:39476983-39477005 AAATAGTAACAGATTGAAGATGG + Intronic
1107430905 13:40339410-40339432 AGTAAGTCAATGAATGAAGGTGG - Intergenic
1108201494 13:48048664-48048686 AATAAGTCAATGAATGAAGCAGG + Intergenic
1108805425 13:54149107-54149129 AATTAACTAATGAATGAAGAGGG - Intergenic
1109098708 13:58150883-58150905 AAGGAGTCAATGAATGAAAATGG - Intergenic
1109170217 13:59086168-59086190 AATGAGTCATTGAAGGAAAAAGG + Intergenic
1109309959 13:60681062-60681084 AATTATTCACTAAATGATGTTGG - Intergenic
1109744803 13:66610987-66611009 AATTTTTCAATGAATGAAAAAGG - Intronic
1109924487 13:69118631-69118653 ACTTAGTGACTGAATGGAGTGGG + Intergenic
1111612852 13:90626205-90626227 AATAATTTAATGAATGAAGAAGG - Intergenic
1112543082 13:100336492-100336514 AATTAGTGGCTTAATGAACAAGG + Intronic
1112681641 13:101773633-101773655 ATTTAGTTATGGAATGAAGAAGG + Intronic
1113024211 13:105922413-105922435 AGATAGTCCTTGAATGAAGATGG - Intergenic
1113630168 13:111876907-111876929 AATTAGTCACTGTACGATTAAGG - Intergenic
1114029531 14:18565544-18565566 AATTAGAGAATGTATGAAGAAGG - Intergenic
1114034080 14:18605278-18605300 AATATGTCACTGAGTGAAAATGG + Intergenic
1115636132 14:35291932-35291954 ATTTAGGCACTGAAGGAAGCGGG - Intronic
1115689928 14:35832082-35832104 AATTAGTTGCTCAATGAACAAGG - Intronic
1116067426 14:40001820-40001842 AATTAGACCTTGAAGGAAGAGGG + Intergenic
1116107502 14:40528645-40528667 AGGTGATCACTGAATGAAGAGGG - Intergenic
1116642466 14:47482655-47482677 AATAAATGAATGAATGAAGAAGG - Intronic
1117517240 14:56514047-56514069 AATTAGTCACTGTTTGCAGCTGG + Intronic
1120157329 14:81107953-81107975 AATTAGGAATGGAATGAAGATGG - Intronic
1123510792 15:20997257-20997279 AATATGTCACTGAGTGAAAATGG - Intergenic
1123568012 15:21571014-21571036 AATATGTCACTGAGTGAAAATGG - Intergenic
1123604120 15:22006338-22006360 AATATGTCACTGAGTGAAAATGG - Intergenic
1124807482 15:32900173-32900195 TATTTGTTACTGAATGAACATGG - Intronic
1125141767 15:36416367-36416389 CACTGGTCACTGAATGAGGAAGG + Intergenic
1126204960 15:46035096-46035118 AAATAGGCACTACATGAAGAGGG - Intergenic
1126387183 15:48106313-48106335 AAATATTTACTGAATGAACAAGG - Intergenic
1129863724 15:78885496-78885518 CATTTGTGACTGAATGAAGGTGG + Intronic
1131761958 15:95633914-95633936 AATTAGTCACTGTCAGAGGAAGG + Intergenic
1131809480 15:96157982-96158004 ATTTATTCACTGAATTAACAGGG - Intergenic
1131851158 15:96544608-96544630 AATTAGTCACTCTATGTACATGG + Intergenic
1131865362 15:96702939-96702961 AATTAGTTCCTGACTGTAGATGG - Intergenic
1202976371 15_KI270727v1_random:298104-298126 AATATGTCACTGAGTGAAAATGG - Intergenic
1134336173 16:13301728-13301750 AATGAGTGAATGAATGAAGTTGG + Intergenic
1134742269 16:16558587-16558609 AATTAATAAATGAATAAAGAAGG - Intergenic
1134919883 16:18106251-18106273 AATTAGTTAATGTTTGAAGATGG - Intergenic
1134925295 16:18153871-18153893 AATTAATAAATGAATAAAGAAGG + Intergenic
1135020369 16:18957872-18957894 ATTTAGTCACTGAAAGAGGATGG - Intergenic
1138751301 16:59425144-59425166 AATGAGTCAGTTAATGAAAATGG - Intergenic
1141279394 16:82617367-82617389 AATGAATGAATGAATGAAGAAGG + Intergenic
1143939318 17:10523447-10523469 AATAAGGCACTGAAAGCAGATGG + Intronic
1148656625 17:49288728-49288750 AATGAATGACTGAATGAAGGGGG + Intergenic
1148969409 17:51466318-51466340 AATGAGTGAATGAATGAAGGAGG + Intergenic
1150517750 17:65831807-65831829 AATTACTCACAGAAGGAAAAAGG + Intronic
1150787646 17:68175903-68175925 AATGAATCAATGAATGAAGGAGG + Intergenic
1151487242 17:74408676-74408698 AAGTAGCCAGTGAATGAGGATGG - Intergenic
1152027334 17:77819605-77819627 TTTCAGACACTGAATGAAGATGG + Intergenic
1152419265 17:80183243-80183265 AATTACTCCCTGAAGGAAAATGG - Intronic
1152558142 17:81064792-81064814 AAACAGTCTCTGACTGAAGACGG - Intronic
1153017148 18:594199-594221 TATAATTCACTGAATGAGGAGGG + Intergenic
1153157528 18:2166605-2166627 AAATCGTCACTAAATTAAGAAGG + Intergenic
1154051536 18:10964076-10964098 AATTATTCAATCAATGATGATGG + Intronic
1158778087 18:60611614-60611636 AATGGGACATTGAATGAAGATGG + Intergenic
1159051690 18:63426427-63426449 AGGTAGTGACAGAATGAAGAGGG - Intergenic
1159457663 18:68681841-68681863 AGCTAGTCTCTAAATGAAGATGG - Intronic
1159575858 18:70176381-70176403 AATTATTCACTGAATGAACAAGG + Intronic
1162060008 19:8089204-8089226 AATTGGTAAGTGAATGAATAAGG + Intronic
1165652530 19:37503925-37503947 ATTTACTCACTGAATGATTACGG + Intergenic
1167175943 19:47864463-47864485 AGTTTGTTAATGAATGAAGATGG + Intergenic
1168427549 19:56251225-56251247 AGTCAGTCACTGAATACAGAAGG - Intronic
1168549193 19:57279327-57279349 AAATAGTCAAGGAATGGAGATGG - Intergenic
926171977 2:10558304-10558326 AATAAGTGAATGAATGGAGAAGG - Intergenic
926995185 2:18727643-18727665 AATTAGTTTCTAAATGAAGATGG + Intergenic
927418526 2:22904835-22904857 AATTAGTGAAAGAATGAATAGGG - Intergenic
928182040 2:29075001-29075023 AATAAGATAGTGAATGAAGAAGG + Intergenic
928569449 2:32588857-32588879 AAATAGTCACTCTGTGAAGATGG + Intronic
928856770 2:35811984-35812006 AATTGGTAACTGAATGATAATGG + Intergenic
929903651 2:46027389-46027411 AAATAGGGACTGAATGAGGATGG + Intronic
930443760 2:51444456-51444478 AATTTGTAAATGAATTAAGATGG - Intergenic
930443763 2:51444507-51444529 AATTTGTAAATGAATTAAGATGG - Intergenic
932882043 2:75511733-75511755 AGTTAATCAGTGAATGAATATGG - Intronic
933211649 2:79577239-79577261 ATTTATTCACAGAATGAAGAAGG - Intronic
933466888 2:82663091-82663113 AATTATTAACTGAATAAAAATGG + Intergenic
934629014 2:95894943-95894965 AATTATTTTCCGAATGAAGACGG - Intronic
934629428 2:95900559-95900581 AATTATTTTCCGAATGAAGACGG - Intronic
934629843 2:95906175-95906197 AATTATTTTCCGAATGAAGACGG - Intronic
934630246 2:95911788-95911810 AATTAATTTCCGAATGAAGACGG - Intronic
934630520 2:95915524-95915546 AATTATTTTCCGAATGAAGATGG - Intronic
934803671 2:97195351-97195373 AATTATTTTCTGAATGAAGACGG + Intronic
934804087 2:97200959-97200981 AATTATTTTCTGAATGAAGACGG + Intronic
934832960 2:97550833-97550855 AATTATTTTCTGAATGAAGACGG - Intronic
935088965 2:99875984-99876006 GAATAGTCACTGAAGGAGGAGGG - Intronic
935274533 2:101464563-101464585 AATTTGTGACTAAATGGAGAAGG - Intronic
935985195 2:108665848-108665870 AATTAGTCAGGGGATGAAAAAGG - Intronic
936137630 2:109909492-109909514 AATTAGTCAGGGGATGAAAAAGG - Intergenic
936207067 2:110461993-110462015 AATTAGTCAGGGGATGAAAAAGG + Intronic
936962456 2:118089522-118089544 AGTGAACCACTGAATGAAGATGG + Intronic
937799697 2:126068753-126068775 AATTACTTTTTGAATGAAGATGG + Intergenic
939542818 2:143514292-143514314 AAATAGTCACTGAATGGAATTGG + Intronic
940486674 2:154304577-154304599 AATTTTCCACTGAATGAAAAAGG + Intronic
940489518 2:154340242-154340264 AATAAGTAAATAAATGAAGAAGG - Intronic
940794957 2:158068104-158068126 ATTTAGTTACTTAATGAAAATGG + Intronic
941019975 2:160397613-160397635 AAAGAGTGAATGAATGAAGAGGG - Intronic
941399615 2:165014644-165014666 AATCAATCACAGAATGAAGCTGG + Intergenic
943294816 2:186124319-186124341 AATTATACACTGATTGGAGAGGG - Intergenic
943677230 2:190727843-190727865 AATTAGTCAGTTAATACAGAAGG + Intergenic
943737593 2:191373813-191373835 AATTATTTACTGCATGTAGAAGG - Intronic
944968184 2:204960310-204960332 ATTTGGTCACTGGATGAAGCAGG - Intronic
945105345 2:206307162-206307184 AATTAGTCACTGAATGAAGAGGG - Exonic
945506867 2:210652499-210652521 AATTAGTGAATGAATGGAGGTGG + Intronic
945813789 2:214579024-214579046 AATTAGTCATTAAATAATGAGGG - Intergenic
946534770 2:220614861-220614883 AATTATTCACTGCATGGAGAAGG + Intergenic
946999142 2:225433156-225433178 AATTAGACAATTAATGAAGTTGG - Intronic
947198726 2:227595918-227595940 AAGTAGTCATTGTAGGAAGAGGG + Intergenic
947430663 2:230024826-230024848 AATGAGTGAATGAATGAAAAAGG - Intergenic
947457578 2:230269549-230269571 AATCACCCAATGAATGAAGAAGG + Exonic
948165142 2:235855435-235855457 AATCTGTAACTGAATGAATAAGG - Intronic
948731885 2:239969849-239969871 AATTAGGCACAGAAAGAAAAAGG + Intronic
1170417079 20:16156216-16156238 AATGATTTAATGAATGAAGATGG - Intergenic
1170447555 20:16444470-16444492 AATTTGTAAATGAATGAACATGG - Intronic
1171254726 20:23680898-23680920 AATTAGTCACAGAATAATAATGG - Intergenic
1172826275 20:37789542-37789564 AATTAGTCAGGAAATGAGGATGG + Intronic
1174485436 20:50858101-50858123 AATGAATGAATGAATGAAGATGG - Intronic
1174844860 20:53934592-53934614 GTTAAGCCACTGAATGAAGAAGG + Intergenic
1175015792 20:55788570-55788592 AAATTGTCACTGAAAGAAGATGG - Intergenic
1175613927 20:60376424-60376446 AATGAGTGAATGAATGAAGATGG - Intergenic
1176042530 20:63072937-63072959 TTTTAGTGACTGAAGGAAGAGGG - Intergenic
1176209049 20:63908513-63908535 GATTGGTCACGGAATGAACAGGG + Intronic
1177292029 21:19125871-19125893 AATCAGTCACTGGATTGAGAAGG - Intergenic
1178069346 21:28945592-28945614 ATTTGGTCACTGAATGATGCTGG + Intronic
1180453646 22:15492594-15492616 AATTAGAGAATGTATGAAGAAGG - Intergenic
1180458197 22:15532321-15532343 AATATGTCACTGAGTGAAAATGG + Intergenic
1184522678 22:45004701-45004723 AAGCAGCCACTGAATGAAGCTGG - Intronic
1185163247 22:49242342-49242364 AATTAATCACGTAATGAATATGG + Intergenic
949269806 3:2201522-2201544 AAGTAGTCACTGGAGGAAGAAGG - Intronic
951029848 3:17869486-17869508 AATCAGTCATGGAATGAAGCTGG - Intronic
951041606 3:17994240-17994262 AATTAGTCACTGACAGAGAATGG + Intronic
951143577 3:19198204-19198226 AATTAATAAATGAATAAAGAGGG + Intronic
952231475 3:31435374-31435396 AATCAGCCACTGGATGATGAGGG + Intergenic
952907703 3:38153448-38153470 ACTTAGTGACTGAAAGAAAATGG - Intergenic
954443180 3:50532867-50532889 CATTAGTCACTGACTGTACAGGG - Intergenic
957415478 3:79897272-79897294 AAACAGTCAAAGAATGAAGATGG - Intergenic
958704613 3:97639899-97639921 AATAAGTCTCTGAATTTAGAAGG + Intronic
960429334 3:117549506-117549528 AGTTAGCCACTTAATGCAGAGGG - Intergenic
960480918 3:118189168-118189190 TCTGAGTCAGTGAATGAAGAGGG + Intergenic
964077351 3:152707478-152707500 CCTCAGTCACTGATTGAAGAGGG + Intergenic
966238102 3:177725296-177725318 AATTAGTCCCTGTGTGGAGAAGG + Intergenic
966657874 3:182379888-182379910 AATTAGACACTGAATTAGAAGGG - Intergenic
966995576 3:185276765-185276787 TGTTAGTCACTGAGTGAAGTGGG + Intronic
969986805 4:11219796-11219818 AATCACACACTGAATGAAAATGG - Intergenic
969994344 4:11296103-11296125 AATTTTGCACTGACTGAAGATGG + Intergenic
970554989 4:17222271-17222293 AATGAGTTATTGAATAAAGAAGG + Intergenic
970862753 4:20722472-20722494 AAGTAAACACTGCATGAAGAAGG - Intronic
971423156 4:26492099-26492121 ATTTAGTCACAGAAACAAGAAGG + Intergenic
972508672 4:39746171-39746193 AAATAATGACTGAATGTAGAAGG - Intronic
972646141 4:40969178-40969200 AATTTGTCTCTAAATGGAGATGG - Intronic
972650082 4:41008437-41008459 AATGACACACTGAATGAAAATGG - Intronic
976534720 4:86198036-86198058 AATTAGTCATTGTATGGGGATGG + Intronic
976565090 4:86543813-86543835 AATGAGTTACTAAGTGAAGAAGG + Intronic
977223336 4:94364714-94364736 AATTAGTCAAACAATCAAGAAGG - Intergenic
978974369 4:114850830-114850852 AATTTGACTCTGAATGATGAAGG + Intronic
979713484 4:123808865-123808887 ACATAGTCACTGAATGAGGGAGG + Intergenic
981272509 4:142861030-142861052 AAGTAGTGCCTCAATGAAGAAGG + Intergenic
983083573 4:163415884-163415906 AATTGGTCAAAGAATGCAGAGGG + Intergenic
983967162 4:173826285-173826307 AAATGATCACTGAATAAAGAGGG + Intergenic
984676558 4:182555159-182555181 AATTAGTCTATGACTGAAGGAGG + Intronic
984829257 4:183955989-183956011 AATCAGTTACTGAATGAAATAGG - Intronic
985263519 4:188137224-188137246 AATAACACACTGAATGGAGATGG + Intergenic
985597175 5:798991-799013 GATTAGTGACTGAAACAAGATGG - Intronic
986515036 5:8552352-8552374 AATTAATCAATGTATGAATATGG + Intergenic
987098547 5:14571980-14572002 AATTTGTAAATGAATGAACATGG - Intergenic
987268676 5:16282192-16282214 AATTCATCACAGAATGAAAAAGG - Intergenic
987641218 5:20614959-20614981 AATGTGTCACTGATTGAACATGG - Intergenic
989771147 5:45147269-45147291 AATGAGTGAATGAATGAATAAGG + Intergenic
990095804 5:52110851-52110873 AATCATTAACTGAATGAATAAGG - Intergenic
990379772 5:55211658-55211680 AATGAGGCACTGGATGAAAATGG + Intergenic
991122964 5:63037046-63037068 AGATAGTCACTGGATCAAGATGG - Intergenic
993680378 5:90870668-90870690 AGTTTGTCAATGAAAGAAGAAGG + Intronic
994562174 5:101388989-101389011 AATAAGTGAGTAAATGAAGAAGG - Intergenic
994703999 5:103176869-103176891 AATGATTCTCAGAATGAAGATGG + Intronic
996042323 5:118829088-118829110 CATTCCCCACTGAATGAAGAAGG - Intergenic
997632542 5:135379728-135379750 ACTTTGTCACTGAAAGGAGAAGG - Intronic
997860513 5:137411285-137411307 AATTATCCACAGAATGAGGACGG + Intronic
998031461 5:138873289-138873311 AATTACCCGCTGAGTGAAGATGG + Exonic
998687164 5:144541469-144541491 AATTAGTCACTGTATTTAAATGG - Intergenic
999840967 5:155426073-155426095 AATGAGACAGTGAAGGAAGAGGG + Intergenic
1001585749 5:172833105-172833127 AATGAGTGAATGAATGAAAAGGG + Intergenic
1003992237 6:11497772-11497794 AACTTATCAATGAATGAAGAAGG - Intergenic
1004487542 6:16081563-16081585 AATCAGTCACTCAATCATGAGGG + Intergenic
1004492781 6:16131861-16131883 ATTTTGTTTCTGAATGAAGATGG + Intronic
1004600163 6:17141982-17142004 AATTAATCAATGAATGGATAAGG - Intergenic
1008537630 6:52518786-52518808 AATTGGTCTCTTTATGAAGAAGG - Intronic
1008785928 6:55168026-55168048 AAATATTCACTGTTTGAAGAAGG + Intronic
1008877744 6:56348098-56348120 AATAAATGAATGAATGAAGAGGG - Intronic
1010149334 6:72711931-72711953 AATCAGTCAGTGAATGAATCTGG + Intronic
1011717933 6:90126462-90126484 ATTTAGTTACGGGATGAAGAGGG + Intronic
1011940243 6:92833992-92834014 CATAAATAACTGAATGAAGAAGG + Intergenic
1015633940 6:135257406-135257428 AATTAGTCACAGAAGGGAGGTGG + Intergenic
1016878180 6:148884456-148884478 GAATAGAGACTGAATGAAGAGGG + Intronic
1017809113 6:157971595-157971617 TTTTAGCTACTGAATGAAGAAGG + Intergenic
1017877894 6:158538574-158538596 CATTGGTCAGTGAATAAAGATGG - Intronic
1018496984 6:164358927-164358949 GAATAGAGACTGAATGAAGAAGG - Intergenic
1020552715 7:9626688-9626710 ACTTAATTACTTAATGAAGAGGG - Intergenic
1020675614 7:11181552-11181574 AATGTGTCAGTGAAAGAAGAAGG - Intergenic
1021477985 7:21084507-21084529 AATGAGTCTCTGAATGATTATGG + Intergenic
1022269317 7:28790716-28790738 AAGCAGTCACTAAATGCAGAAGG + Intronic
1023738862 7:43259806-43259828 AATAGGTCACTGATTGATGATGG - Intronic
1025827832 7:65024958-65024980 TATAAGTCAGTGAATGTAGATGG - Intergenic
1025915361 7:65861400-65861422 TATAAGTCAGTGAATGTAGATGG - Intergenic
1027598331 7:80205129-80205151 AATTAGTCATTGACTTCAGACGG - Intronic
1031044217 7:116869445-116869467 ATTTAGTAAATGAATGAAGATGG - Intronic
1032651779 7:133886390-133886412 ATTTAATCAGTGAATGAATAAGG - Intronic
1032976031 7:137223732-137223754 ATTTTGTCTCTTAATGAAGATGG - Intergenic
1036973987 8:13389100-13389122 AATAAGTAACTGAAGGAACAAGG - Intronic
1037002534 8:13737339-13737361 AATCAGTCACTTAACCAAGATGG - Intergenic
1037414195 8:18631205-18631227 TATTATTCAATGTATGAAGAAGG + Intronic
1042170954 8:65990255-65990277 AATTATACACTGACTGATGAGGG - Intergenic
1042594071 8:70426741-70426763 AATGAGTGAATGAATGAATATGG + Intergenic
1045658716 8:104413654-104413676 AATTACTCACTGAATAAATGTGG + Intronic
1048557885 8:135498650-135498672 AATAAATCAATGAATGAAAATGG + Intronic
1048746507 8:137620154-137620176 ACTGAGTCACTAAATGATGATGG - Intergenic
1048790403 8:138098442-138098464 AATGAGGCACAGATTGAAGATGG - Intergenic
1051503458 9:17803108-17803130 AATTAGTGGCTGCCTGAAGATGG - Intergenic
1051873236 9:21763344-21763366 AACTAAACTCTGAATGAAGATGG - Intergenic
1052486623 9:29109692-29109714 AATTTGTTACGAAATGAAGATGG - Intergenic
1052989217 9:34508990-34509012 AATGAGTAAGTGAATGAATAAGG - Intronic
1055040452 9:71865327-71865349 AATTTGTAAATGAATGAATATGG - Intronic
1057231246 9:93322817-93322839 AAACAGTCACTGAGTGAAGCTGG + Intronic
1058025658 9:100140274-100140296 AAAGAGTCAGTGAAGGAAGATGG + Intronic
1058593009 9:106585107-106585129 AATCAGTCACTGGATGCAGATGG - Intergenic
1059924914 9:119199383-119199405 AATTAAACACTGTATGGAGAAGG + Intronic
1060417061 9:123438315-123438337 AATCTGTCACCTAATGAAGAAGG + Intronic
1060508929 9:124218223-124218245 AATGAGTGAATGAATGAATATGG + Intergenic
1187019579 X:15366501-15366523 AATGAATCTCTGAATGAAAATGG - Intronic
1187421327 X:19136439-19136461 AATATGTGAATGAATGAAGAAGG + Intergenic
1187839430 X:23471517-23471539 AAGTAGTAACAGAATGAAGCAGG + Intergenic
1188060965 X:25601462-25601484 AAATATTCACTCAATAAAGAAGG + Intergenic
1188689000 X:33105937-33105959 AATAAGTCACTATATGAAAAAGG + Intronic
1188905128 X:35782491-35782513 ACTTAGCCACTGCATGAAAATGG - Intergenic
1190291933 X:48999038-48999060 AATTAATCACTAAATTAAGCAGG + Intronic
1192089607 X:68139988-68140010 AAATAATCACTGAGTAAAGAGGG + Intronic
1192932487 X:75822495-75822517 AATAAGTCACTGTCTGAAAAAGG + Intergenic
1193652928 X:84160745-84160767 TATTATTCACTGAATGAGAAGGG - Intronic
1193837447 X:86362097-86362119 AAATACTTACTGAGTGAAGAGGG - Intronic
1196552039 X:117040188-117040210 AGTTAGTATATGAATGAAGAAGG - Intergenic
1197371694 X:125634766-125634788 ACTTAGTCAATAAATGAAAAGGG - Intergenic
1197604669 X:128571409-128571431 AATAAATGAATGAATGAAGAAGG + Intergenic
1197690709 X:129497753-129497775 AATAAGTGAATGAATGAATATGG + Intronic
1199143983 X:144343729-144343751 AATTGGTCAATAAATTAAGAAGG - Intergenic
1200312432 X:155091605-155091627 AATTAGACAATGAATGAACATGG - Intronic
1200692657 Y:6322553-6322575 CATTGATCACTCAATGAAGATGG - Intergenic
1201042616 Y:9852173-9852195 CATTGATCACTCAATGAAGATGG + Intergenic