ID: 945119132

View in Genome Browser
Species Human (GRCh38)
Location 2:206440771-206440793
Sequence AATCAAATCAGCATTCATAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945119132_945119136 0 Left 945119132 2:206440771-206440793 CCTCTATGAATGCTGATTTGATT No data
Right 945119136 2:206440794-206440816 CCAGGTACTATACTAGGCTGTGG No data
945119132_945119134 -6 Left 945119132 2:206440771-206440793 CCTCTATGAATGCTGATTTGATT No data
Right 945119134 2:206440788-206440810 TTGATTCCAGGTACTATACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945119132 Original CRISPR AATCAAATCAGCATTCATAG AGG (reversed) Intergenic
No off target data available for this crispr