ID: 945119371

View in Genome Browser
Species Human (GRCh38)
Location 2:206442911-206442933
Sequence CGCCGCAGGCTGGCGCGGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 324
Summary {0: 1, 1: 0, 2: 5, 3: 19, 4: 299}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945119371_945119381 29 Left 945119371 2:206442911-206442933 CCACTCCGCGCCAGCCTGCGGCG 0: 1
1: 0
2: 5
3: 19
4: 299
Right 945119381 2:206442963-206442985 CGCTGCTGGCAATCTGAATGAGG 0: 1
1: 0
2: 0
3: 3
4: 84
945119371_945119375 15 Left 945119371 2:206442911-206442933 CCACTCCGCGCCAGCCTGCGGCG 0: 1
1: 0
2: 5
3: 19
4: 299
Right 945119375 2:206442949-206442971 GCCGCAGTCCCACCCGCTGCTGG 0: 1
1: 0
2: 1
3: 11
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945119371 Original CRISPR CGCCGCAGGCTGGCGCGGAG TGG (reversed) Intergenic
902973503 1:20072066-20072088 TGCCCCAGGCTGGAGCGCAGCGG - Intronic
904523876 1:31117239-31117261 CGCCCCAGGCTGGAGTGCAGTGG - Intergenic
904696960 1:32336214-32336236 GGCGGCATTCTGGCGCGGAGCGG - Exonic
904715385 1:32464083-32464105 CGCCCCAGGCTGGAGTGCAGTGG + Intergenic
905449004 1:38045433-38045455 CGCCGCCGGCGGGGGCGGTGGGG + Exonic
905759986 1:40548276-40548298 CCCCGCAGGCTGGAGTGCAGTGG + Intergenic
906197260 1:43936732-43936754 AGCCGCAGGCGGTGGCGGAGAGG - Exonic
907010636 1:50959900-50959922 CGCCGCCGCCGGGCGCCGAGGGG + Exonic
908273616 1:62445937-62445959 CGCCCCAGGCTGGAGTGCAGTGG - Intronic
911219030 1:95227916-95227938 CGCCCCAGGCTGGAGTGCAGTGG + Intronic
912548269 1:110466571-110466593 AGCCCCAGGCTGGCACAGAGAGG + Intergenic
913993533 1:143636407-143636429 CCCCGCAGGCTGGAGTGCAGTGG - Intergenic
914030262 1:143952653-143952675 TCACGCAGGCTGGAGCGGAGTGG + Intronic
914159188 1:145115298-145115320 TCACGCAGGCTGGAGCGGAGTGG - Intergenic
915326822 1:155085077-155085099 CGCCGCAGGCTGTGGGGAAGAGG - Exonic
919104554 1:193132939-193132961 CGCCCCAGGCTGGAGTGCAGTGG + Intronic
920465729 1:206183539-206183561 TCACGCAGGCTGGAGCGGAGTGG + Intergenic
920805619 1:209231580-209231602 GGGCGCAGGGCGGCGCGGAGAGG - Intergenic
920856689 1:209668556-209668578 CGCCCCAGGCTGGAGTGCAGTGG + Intergenic
922056091 1:222043813-222043835 AGCCGCAGGCTGGGCAGGAGGGG + Intergenic
922479615 1:225930244-225930266 CGCCCCAGGCTGGAGTGCAGTGG + Intergenic
1065099538 10:22320644-22320666 GGCCGCGGGCTGGCGGGCAGGGG + Intronic
1065343020 10:24723779-24723801 CGCCGCAGGAGGGCGTGGGGCGG + Intergenic
1065517472 10:26538599-26538621 CGCCCCAGGCTGGAGTGCAGTGG - Intronic
1068688173 10:59890169-59890191 CACTGCAGGCTGGCGAGGAAAGG + Intronic
1070579962 10:77711596-77711618 CGCCACCGCCTGGCGGGGAGCGG + Intergenic
1070946878 10:80399514-80399536 CGCCCCAGGCTGGAGTGCAGTGG - Intergenic
1073007468 10:100335924-100335946 CGCCCCAGGCTGGAGTGCAGTGG + Intergenic
1073035139 10:100559456-100559478 CGACGCAGGCTGGAGTGCAGTGG + Exonic
1073209955 10:101792056-101792078 CGCCCCAGGCTGGAGTGCAGTGG + Intronic
1074104197 10:110376467-110376489 CGCCGGAGGCAGGAGGGGAGTGG - Intergenic
1075888048 10:125919243-125919265 TCCCGCAGGCTGGAGCGCAGTGG + Intronic
1077093585 11:790129-790151 CGGCGCAGGAGGGCGGGGAGGGG + Intergenic
1077709977 11:4526146-4526168 CGCCCCAGGCTGGAGTGCAGTGG - Intergenic
1078245690 11:9572267-9572289 CGCCCCAGGCTGGAGTGCAGTGG - Intergenic
1078561585 11:12377621-12377643 CGGCGCAGGCTGCCGCGGGCCGG - Exonic
1079035192 11:17014420-17014442 CGCCGCGGGGTGGGGGGGAGGGG + Intronic
1079280807 11:19085383-19085405 CGCCCCAGGCTGGAGTGCAGTGG + Intergenic
1079773646 11:24496827-24496849 CTCCCCAGGATGGCGCGGGGCGG - Intergenic
1081132812 11:39401481-39401503 CGCCCCAGGCTGGAGTGCAGTGG - Intergenic
1081496499 11:43616366-43616388 CGCCCCAGGCTGGAGTGCAGTGG - Intronic
1081894303 11:46571727-46571749 CGCCCCAGGCTGGAGTGCAGTGG + Intronic
1082081918 11:48018925-48018947 CTCTGCAGGCTGGTGGGGAGGGG + Intronic
1083039123 11:59669070-59669092 CGCCGCCGCCGGGCGCCGAGCGG - Intergenic
1083390599 11:62346928-62346950 CGCCCCAGGCTGGAGTGCAGTGG - Intronic
1083450441 11:62740879-62740901 TGCCGCAGGCTGGAGTGCAGTGG - Intergenic
1083669548 11:64292339-64292361 CGCCGCACCCAGGCGAGGAGGGG - Intronic
1084171689 11:67404122-67404144 GGCCCCAGGCTGGCCGGGAGTGG + Intronic
1084797506 11:71518654-71518676 GGCTTCAGGCTGGCGCGGGGAGG - Intronic
1088663790 11:112074332-112074354 CGCCGCAGCCTCGCGTGGCGGGG - Exonic
1088675750 11:112190814-112190836 CGCCCCAGGCTGGAGTGCAGTGG - Intronic
1089202612 11:116733516-116733538 AGCCCCAGGCTGGTGCGGATGGG + Intergenic
1089712476 11:120325505-120325527 CGCCGCAGCCTGGCGCAGGAAGG - Intronic
1091971152 12:4788155-4788177 GGCCGGGGGCTGGCGGGGAGGGG + Intronic
1093053766 12:14534106-14534128 CGCCCCAGGCTGGAGTGTAGCGG - Intronic
1093282262 12:17209356-17209378 CGCCCCAGGCTGGAGTGCAGTGG + Intergenic
1093770304 12:23010154-23010176 CCCCCCAGGCTGGCGTGCAGTGG - Intergenic
1099466470 12:82994195-82994217 CGCCCCAGGCTGGAGTGCAGTGG + Intronic
1100986076 12:100202815-100202837 CGCCCCAGGCTGGAGTGCAGTGG - Intronic
1101253428 12:102956448-102956470 GGCCGCGTGCTGGCGCCGAGAGG - Intronic
1101970608 12:109309726-109309748 CCGCGCGGGCTGGCGCGCAGCGG + Intergenic
1103241826 12:119419914-119419936 CGCCCCAGGCTGGAGTGCAGTGG + Intronic
1103301003 12:119926700-119926722 CGCCCCAGGCTGGAGTGCAGTGG + Intergenic
1103489483 12:121305806-121305828 CGCCCCAGGCTGGAGTGCAGTGG + Intergenic
1103797838 12:123517026-123517048 CCCCGCAGGCTGGAGTGCAGTGG - Intronic
1105370253 13:19795848-19795870 CGCCCCAGGCTGGAGTGCAGTGG - Intergenic
1105706528 13:22970946-22970968 CCCAGCAGCCTGGCGCGGTGTGG - Intergenic
1106153846 13:27133587-27133609 TGTCGCAGGCTGGAGCGCAGTGG - Intronic
1108316444 13:49241851-49241873 CGCCCCAGGCTGGAGTGCAGTGG - Intergenic
1108629157 13:52264031-52264053 CACCGCAGGCTGGAGTGCAGTGG - Intergenic
1108656899 13:52542445-52542467 CACCGCAGGCTGGAGTGCAGTGG + Intergenic
1110326379 13:74221042-74221064 CGCCCCAGGCTGGAGTGCAGTGG + Intergenic
1110968303 13:81729081-81729103 CGCCCCAGGCTGGAGTGCAGTGG - Intergenic
1112506982 13:99981362-99981384 CGCCGCAGAGCGCCGCGGAGAGG + Intergenic
1113378997 13:109786299-109786321 GGCCGCAGGCAGCCGGGGAGGGG - Exonic
1115501216 14:34051491-34051513 CGCCCCAGGCTGGAGTGCAGTGG - Intronic
1117125062 14:52614158-52614180 CACCGCAGGCTGGAGTGCAGTGG + Intronic
1118101001 14:62602112-62602134 CGCCCCAGGCTGGAGTGCAGTGG - Intergenic
1118917875 14:70123030-70123052 CGCCCCAGGCTGGAGTGCAGTGG - Intronic
1119694770 14:76704539-76704561 CGCCTCAGGCTGGAGGGCAGTGG - Intergenic
1122349124 14:101077581-101077603 CCCGGCAGGCGGGGGCGGAGTGG + Intergenic
1122493707 14:102137163-102137185 CTCCGCAGGCTGGAGTGCAGTGG - Intronic
1122833749 14:104421069-104421091 CGACGCAGCCTGGCAGGGAGGGG + Intergenic
1122931105 14:104933435-104933457 CGCGGCAGCCCGGCGCGGGGTGG - Exonic
1123495247 15:20817128-20817150 AGCCGCAGGCTGTGGCGGAGGGG + Intergenic
1123551736 15:21386221-21386243 AGCCGCAGGCTGTGGCGGAGGGG + Intergenic
1123723569 15:23081054-23081076 CGCCCCAGGCTGGAGTGCAGTGG - Intergenic
1123786766 15:23682517-23682539 CGCCCCAGGCTGGAGTGCAGTGG + Intergenic
1123914151 15:25004996-25005018 CGCCCCAGGCTGGAGTGCAGTGG + Intergenic
1124121742 15:26894092-26894114 GGCCGGAGGCTGGAGCGCAGCGG + Intronic
1124788807 15:32707330-32707352 CCCAGCAGGCTGGCGTGCAGTGG - Intergenic
1125318189 15:38454488-38454510 ATCCGCCGGGTGGCGCGGAGCGG + Intronic
1126163470 15:45634767-45634789 CCCCGCAGGCTGGGGCGCACAGG - Exonic
1127288263 15:57549048-57549070 AGCAGCAGGCTGGCAGGGAGTGG + Exonic
1128501307 15:68229375-68229397 CGGCGCTGGCCGGGGCGGAGCGG - Intronic
1130961010 15:88658674-88658696 CGCAGCAAGCTGGGGCTGAGTGG - Intergenic
1131228213 15:90642525-90642547 CACCGAAGGCGGGCCCGGAGTGG + Exonic
1202960081 15_KI270727v1_random:113463-113485 AGCCGCAGGCTGTGGCGGAGGGG + Intergenic
1132663485 16:1071607-1071629 GGCCGCAGGCTGGGGAGGAGGGG + Intergenic
1133034881 16:3028992-3029014 CCCCTCAGGCTGGTGCGGGGTGG + Intronic
1133259428 16:4538564-4538586 CGCCGCGGGCGGGGGCGGGGAGG + Intronic
1135615628 16:23908569-23908591 CGCCCCAGGCTGGAGTGCAGTGG + Intronic
1136544652 16:30948497-30948519 CCCCGGAGGCCTGCGCGGAGGGG - Exonic
1137476933 16:48817367-48817389 CTCTGCAGGCTGGCTGGGAGTGG - Intergenic
1139952812 16:70680246-70680268 CGCAGGAGGCTGGCGCGGCTGGG - Intronic
1140472310 16:75222754-75222776 CCCCGCAGCCTGGGGGGGAGTGG - Exonic
1141398623 16:83726796-83726818 CGCCCCAGGCTGGAGCGCAGTGG - Intronic
1141456347 16:84144993-84145015 AGCAGCCGGCTGGCGCTGAGGGG + Intronic
1141601962 16:85132422-85132444 CGCCCCAGGCTGGAGTGCAGTGG - Intergenic
1142120283 16:88383495-88383517 GGCCGCAGCCTTGCCCGGAGCGG + Intergenic
1142568702 17:858008-858030 CGCCCCAGGCTGGAGTGCAGTGG + Intronic
1142967317 17:3589770-3589792 CGGCTCAGGCTGGTGCGGTGCGG - Intronic
1143175043 17:4950561-4950583 CGGCGCTGGCTGGCCTGGAGAGG + Intronic
1143318677 17:6053346-6053368 CGCTGCAGGCTGGCGCTGCCTGG + Intronic
1144858981 17:18287956-18287978 TGCTGCAGGCTGGAGTGGAGTGG - Intronic
1145077411 17:19867496-19867518 CGCCGCACGCTGGCGCGCTCCGG - Exonic
1145190352 17:20836312-20836334 CGCCCCAGGCTGGAGTGCAGTGG - Intergenic
1147314408 17:39612681-39612703 CGCCGCAGTATGCCGGGGAGCGG + Intergenic
1147648883 17:42050719-42050741 CGCCGCAGGTGGGCGCGGCCAGG - Intronic
1147811726 17:43175057-43175079 CGCCCCAGGCTGGGGTGCAGTGG - Intronic
1148462562 17:47846983-47847005 CGCGGCTGGCTGGCGGGGACAGG - Exonic
1148490980 17:48023937-48023959 CGGAGCCGGCGGGCGCGGAGGGG - Intergenic
1148950330 17:51305347-51305369 GGCTGCAGGCTGGTGGGGAGAGG + Intergenic
1151496438 17:74460886-74460908 CGCCCCAGGCTGGAGTGCAGTGG + Intergenic
1151537970 17:74749304-74749326 CCGCGCAGGCTGGCATGGAGTGG + Intronic
1152095479 17:78269474-78269496 GGCCCCAGGCTGGAGAGGAGAGG + Intergenic
1152142455 17:78544759-78544781 TGCCCCAGGCTGGAGTGGAGTGG - Intronic
1152209134 17:78993839-78993861 CGCTCCTGGCTGGCGCGGCGCGG + Exonic
1152493227 17:80651966-80651988 CGCCCCAGGCTGGAGTGCAGTGG - Intronic
1152699285 17:81811139-81811161 GGCGGCAGGCAGGCGCGGTGGGG + Intronic
1153209753 18:2748431-2748453 CGCCCCAGGCTGGAGTGCAGTGG + Intronic
1154452645 18:14489602-14489624 AGCCGCAGGCTGTGGCCGAGGGG + Intergenic
1156369859 18:36463536-36463558 CGCCCCAGGCTGGAGTGCAGTGG + Intronic
1156961457 18:43036546-43036568 CGGGGCAGGCTGGCGGGGGGAGG - Intronic
1158652293 18:59299009-59299031 CTCCGGAGGCTGGCGCGGAGTGG - Intronic
1159111144 18:64057821-64057843 CGCCCCAGGCTGGAGTGCAGTGG + Intergenic
1159993654 18:74940737-74940759 CGCCGCAGACAGGAGCAGAGAGG - Intronic
1160592137 18:79950996-79951018 GGCCGCAGGAGCGCGCGGAGCGG - Exonic
1161026816 19:2040756-2040778 TGCAGCAGGCTGGAGCGAAGCGG - Intronic
1161499754 19:4607332-4607354 CGGCGCGGGCTGGAGCTGAGGGG + Intergenic
1161589819 19:5124283-5124305 CTCCCCAGGCCGGCGCGGTGGGG + Intronic
1161689909 19:5725858-5725880 CGCCCCAGGCTGGAGTGCAGTGG - Intronic
1161740739 19:6019632-6019654 CACCCCAGGCTGGAGCGCAGTGG + Intronic
1161911728 19:7198921-7198943 CGCCTCAGGCTGGAGTGCAGTGG + Intronic
1162027679 19:7903813-7903835 CGCCGCGGGCATGCGCGGTGCGG + Intergenic
1162323739 19:9986339-9986361 CGGGGCAGGCTGGCGAGGAGGGG - Exonic
1162921881 19:13908043-13908065 CGCCCCAGGCTGGAGTGCAGTGG + Intronic
1162954313 19:14090016-14090038 CGCCGGAGGGGGGCGCGGTGCGG - Exonic
1165079927 19:33301298-33301320 CGCCGGAGGCTGGCCCAGGGCGG + Exonic
1165242854 19:34481702-34481724 CGCCGCGGCCTCGCGCGGGGCGG - Exonic
1165850782 19:38849418-38849440 CGCCGCGGGCTGGCGTGTGGGGG - Intronic
1166748327 19:45152472-45152494 CGCCACCGCCTGGCGCGGCGTGG + Exonic
1168153538 19:54461324-54461346 CGCCGCAGGCGGGCACGGGCTGG - Exonic
1168222216 19:54968733-54968755 CGCCCCAGGCTGGAGTGCAGTGG + Intronic
924962696 2:47601-47623 CGCAGCAGGGTGGTGCTGAGTGG + Intergenic
926182244 2:10655165-10655187 CGCCCCAGGCTGGAGTGCAGTGG - Intronic
927810912 2:26179762-26179784 GGCTTCAGGCTGCCGCGGAGGGG + Intronic
929107167 2:38376857-38376879 CGCGGCGGGCTGGCGGGCAGGGG + Intronic
932702701 2:74002389-74002411 CGCCTCCGGGTGGAGCGGAGCGG - Intronic
934978530 2:98822611-98822633 CGCCACCGGCGGGCGCCGAGAGG - Exonic
935956108 2:108378072-108378094 CGCCACAGCCTGGTGAGGAGGGG + Exonic
937221572 2:120345549-120345571 CGCCGCGGGCCGGCGGGCAGTGG - Intergenic
940674351 2:156710479-156710501 CGCCCCAGGCTGGAGTGCAGTGG + Intergenic
940751225 2:157628867-157628889 CCCCGCAGCCGGGCGGGGAGCGG + Exonic
940774931 2:157875855-157875877 CGCTGCAGGTCGGCGCGGCGCGG + Intronic
940883303 2:158968484-158968506 CGCCGCAGCCCGGGGCGGGGAGG + Intergenic
941095993 2:161239391-161239413 CGCCGCAGGCCAGCGGGGCGCGG - Intergenic
941662519 2:168209638-168209660 CGCCCCAGGCTGGAGTGCAGTGG - Intronic
943639665 2:190344109-190344131 CCTCGCAGGCCGGCGCGCAGAGG - Intronic
945119371 2:206442911-206442933 CGCCGCAGGCTGGCGCGGAGTGG - Intergenic
947985919 2:234447327-234447349 AGCCGCAGGGAGGCACGGAGAGG + Intergenic
949047433 2:241878152-241878174 CGCCGCAGGACAGCGCGGAGTGG - Intergenic
949052494 2:241904589-241904611 CGCAGCAGGCAGGAGCTGAGTGG + Intergenic
1171944595 20:31365218-31365240 CGCCCCAGGCTGGAGTGCAGTGG - Intergenic
1175338174 20:58210049-58210071 CGACGCCGGCAGGCCCGGAGAGG + Intergenic
1176131759 20:63499295-63499317 CGCCGCGGGCGGGGGCGGGGCGG + Exonic
1176443388 21:6798682-6798704 AGCCGCAGGCTGTGGCCGAGGGG - Intergenic
1176547026 21:8206540-8206562 CACCGCCGGCGGGCGGGGAGAGG - Intergenic
1176554931 21:8250749-8250771 CACCGCCGGCGGGCGGGGAGAGG - Intergenic
1176565977 21:8389587-8389609 CACCGCCGGCGGGCGGGGAGAGG - Intergenic
1176573852 21:8433774-8433796 CACCGCCGGCGGGCGGGGAGAGG - Intergenic
1176821556 21:13663729-13663751 AGCCGCAGGCTGTGGCCGAGGGG - Intergenic
1178359433 21:31935856-31935878 CGCCCTAGGCTGGAGCGCAGTGG + Intronic
1180938633 22:19642233-19642255 CACTGCAGGATGGCGTGGAGCGG - Intergenic
1181567924 22:23751019-23751041 GGCCGCAGGCGGGCGGGGCGGGG + Exonic
1182556111 22:31129278-31129300 CGCCCCAGGCTGGAGTGCAGTGG + Intronic
1183727776 22:39598986-39599008 CGCCCCAGGCTGGAGTGCAGTGG + Intronic
1184568892 22:45309944-45309966 CGCTGCCGGCTAACGCGGAGGGG + Intronic
1185039498 22:48497176-48497198 CACCGCAGGCGGGGGCGGAACGG - Intronic
1185345081 22:50307461-50307483 CGCGGCAGGCCCGGGCGGAGCGG + Intronic
1203251901 22_KI270733v1_random:122825-122847 CACCGCCGGCGGGCGGGGAGAGG - Intergenic
1203259952 22_KI270733v1_random:167908-167930 CACCGCCGGCGGGCGGGGAGAGG - Intergenic
952108221 3:30093034-30093056 CGCCTCAGCCTGGAGTGGAGGGG + Intergenic
953090493 3:39719704-39719726 CGCCCCAGGCTGGAGTGCAGTGG - Intergenic
954392684 3:50275786-50275808 CGCTGCAGGCGCGCGTGGAGTGG + Exonic
959222613 3:103540951-103540973 CGCCCAAGGCTGGAGCGCAGTGG + Intergenic
962099809 3:132329956-132329978 CCCCGCAGGCTGGAGTGCAGTGG + Intronic
962809005 3:138946188-138946210 CGCCGCAGGCGGGTGCGGCGTGG - Exonic
966810806 3:183842907-183842929 CGCCCCAGGCTGGAGTGCAGTGG + Intronic
966849347 3:184155293-184155315 CGCCCCCGGCCGCCGCGGAGAGG - Intronic
968089678 3:195892424-195892446 CGCCGCAGTCTGGCCAGGAGAGG + Intronic
968231284 3:197006179-197006201 CGCCCCAGGCTGGAGTGCAGTGG - Intronic
970824461 4:20254407-20254429 TGTCGCAGGCTGGCGCGGAGGGG + Intronic
971785529 4:31097412-31097434 CAACGCAGGCTGGAGTGGAGTGG - Intronic
971986262 4:33829023-33829045 CGCCCCAGGCTGGAGTGCAGTGG + Intergenic
972605598 4:40610568-40610590 CGCCCCAGGCTGGAGTGCAGTGG - Intronic
972648714 4:40994772-40994794 CGCCCCAGGCTGGAGTGTAGTGG - Intronic
973279123 4:48341400-48341422 GGCCGCCGGCGGGCGCTGAGAGG - Exonic
975216295 4:71760081-71760103 CGCCCCAGGCTGGAGGGCAGTGG + Intronic
976178906 4:82380967-82380989 AGCCGCAGGCTGGAGCAGAGTGG - Intergenic
976404956 4:84652908-84652930 TGCCCCAGGCTGGCGTGCAGTGG + Intergenic
977105670 4:92880940-92880962 CGCCCCAGGCTGGAGTGCAGTGG + Intronic
978126960 4:105146604-105146626 CGGCGCAGGCCGGGGCGGAGCGG + Exonic
978529038 4:109695699-109695721 CGCCCCAGGCTGGAGTGCAGTGG - Intronic
978964553 4:114725503-114725525 AGCCACAGGCTGGCGGGAAGAGG + Intergenic
980048067 4:128011185-128011207 CGCCCCAGGCTGGAGTGCAGTGG + Intronic
980797536 4:137703866-137703888 CGACCCAGGCTGGAGCGCAGTGG + Intergenic
982016407 4:151158337-151158359 CGCCCCAGGCTGGAGTGCAGTGG + Intronic
982745674 4:159102920-159102942 GGCCGCTGGCGGGCGGGGAGCGG + Intergenic
983246865 4:165297861-165297883 CCCCGCAGGCTGGAGTGCAGTGG + Intronic
989379361 5:40798228-40798250 CGCCGGGGGCGGGCGGGGAGGGG + Exonic
991300909 5:65128422-65128444 CTCCACAGGCTGGCCCAGAGCGG - Intergenic
992109216 5:73476748-73476770 CGCCCCAGGCTGGAGTGCAGTGG - Intergenic
993183313 5:84583559-84583581 CGCCCCAGGCTGGAGTGCAGTGG - Intergenic
994185165 5:96807957-96807979 AGCGGCAGGCTGGCGCTGAGCGG + Exonic
997330102 5:133053697-133053719 CGCCCCAGGCTGGAGTGCAGTGG + Intronic
998069691 5:139187475-139187497 TGCCCCAGGCTGGAGTGGAGTGG - Intronic
999395459 5:151224047-151224069 CCCAGCCGGCGGGCGCGGAGCGG - Exonic
1001605754 5:172958794-172958816 GGCCACAGGTGGGCGCGGAGCGG + Intronic
1002040523 5:176510711-176510733 CGCCCCAGGCTGGAGTGCAGTGG + Intergenic
1002375684 5:178787572-178787594 TGCCGCAGGCTGGAGTGCAGTGG + Intergenic
1003645602 6:7910866-7910888 CGGCGCGGGCGGGCGGGGAGAGG - Intronic
1005357174 6:24995840-24995862 CGCCCCAGGCTGGAGTGCAGTGG + Intronic
1005387510 6:25299936-25299958 CGCCCCAGGCTGGAGTGCAGTGG - Intronic
1006300962 6:33193315-33193337 CGCCGCCCGCTGGCGCGGAGAGG + Intergenic
1006620053 6:35357574-35357596 TGCCCCAGGCTGGAGCGCAGTGG + Intronic
1010212071 6:73369891-73369913 CGCCGCCGGAAGGGGCGGAGCGG - Intronic
1010997658 6:82551720-82551742 CGCTGCAGCCTGGTGGGGAGAGG - Intergenic
1012619938 6:101331110-101331132 CGCCCCAGGCTGGAGTGCAGTGG + Intergenic
1013099697 6:106975641-106975663 CGCCGCAGGCAGGAGCGCGGGGG - Intergenic
1013619314 6:111873006-111873028 CGCCGGAGGAGGGCGGGGAGAGG - Exonic
1013793324 6:113859060-113859082 GGGCGCAGGCAGGCGAGGAGGGG - Intronic
1016982292 6:149864279-149864301 CGCCGCAGGCCGGGGCGGAGAGG - Intergenic
1017495441 6:154979247-154979269 CGCCCCAGGCTGGAGTGTAGTGG + Intronic
1017662452 6:156687527-156687549 GGCCGGAGCCGGGCGCGGAGCGG + Intergenic
1017810676 6:157981660-157981682 CCCCGCAGGCGGGCGTGGAGCGG - Intergenic
1020049509 7:5072506-5072528 CGCCCCATGCTGGAGGGGAGGGG + Intronic
1020092470 7:5349264-5349286 CGCAGCAGGCTGGGGAGCAGAGG + Intronic
1022114654 7:27251579-27251601 CGGCGCAGGCTGGCGCGCCGGGG - Intergenic
1022528489 7:31052949-31052971 CGCCGCAGACTGCCGGGGTGGGG + Intronic
1022965230 7:35466055-35466077 CCCCCCAGGCAGGCGCCGAGTGG + Intergenic
1025708469 7:63887818-63887840 CGCCCCAGGCTGGAGTGCAGTGG + Intergenic
1026927626 7:74204891-74204913 CACCGCAGGCTGGAGTGCAGTGG + Intronic
1028762359 7:94509986-94510008 CGCTGCAGCCAGGCGAGGAGCGG - Exonic
1029496795 7:100899725-100899747 CGCCCCAGGCTGGAGTGCAGTGG + Intergenic
1029852381 7:103476438-103476460 CGCCCCAGGCTGGAGTGCAGTGG - Intronic
1030415791 7:109241114-109241136 CGCCCCAGGCTGGAGTGCAGTGG + Intergenic
1030592102 7:111493958-111493980 CGCCCCAGGCTGGAGTGCAGTGG - Intronic
1032075130 7:128832514-128832536 CCCCGCAGACTGGAGGGGAGGGG - Intronic
1032151776 7:129435040-129435062 CGCCGCAGGCAGCCTGGGAGGGG - Intronic
1032160046 7:129502876-129502898 AGCCCCAGGCTGTCCCGGAGAGG + Intronic
1032268057 7:130382018-130382040 CGCAGCAGGCTGGGACGGTGGGG + Intronic
1032298772 7:130668325-130668347 CGCCGGAGGCCCGCGCGCAGGGG + Intronic
1032821060 7:135524895-135524917 CGCCCCAGGCTGGAGTGCAGTGG - Intergenic
1034172264 7:149071671-149071693 CGCTGCAGCATGGCGCAGAGGGG - Exonic
1035983372 8:4398431-4398453 CACCCCAGGCTGGAGCGCAGTGG + Intronic
1036060085 8:5306956-5306978 CGCCCCAGGCTGGAGTGCAGTGG - Intergenic
1036964097 8:13276787-13276809 CGCCGCAGGCAAGCACGCAGGGG + Intronic
1037030748 8:14101931-14101953 CGCCCCAGGCTGGAGTGCAGTGG + Intronic
1038720089 8:30027593-30027615 CGCCGAAGGCAGACGCGGACCGG + Intergenic
1039212818 8:35235802-35235824 CACCGCAGGCGGCGGCGGAGGGG + Exonic
1039221256 8:35333517-35333539 CGCCCCAGGCTGGAGTGCAGTGG + Intronic
1039589516 8:38734834-38734856 TGACGCAGGCTGGCGGGGAGTGG + Intronic
1039887710 8:41664741-41664763 CGCCGGAGGCCGGGGCTGAGGGG - Intronic
1040337303 8:46422610-46422632 GGCCGCAGGCTGGCGTGGGCGGG + Intergenic
1040339784 8:46434719-46434741 GGCCGCAGGGTGGCGTGGACGGG - Intergenic
1040341825 8:46444956-46444978 GGCCGCAGGCTGGCGTGGGTGGG - Intergenic
1041051565 8:53939644-53939666 CGCCCCAGGCCAGCCCGGAGCGG + Exonic
1042965799 8:74350595-74350617 CGGCGGAGGGTGGCGCGGATCGG + Intronic
1044934206 8:97277668-97277690 AGGTGCAGGCTGGCGCGGGGTGG - Exonic
1045021224 8:98045887-98045909 CGCCGGAGGCTGAGGCGGAGAGG + Intronic
1047874726 8:129123219-129123241 CGCCCCAGGCTGGAGTGCAGTGG - Intergenic
1048898061 8:139012513-139012535 CGCCCCAGGCTGGAGTGCAGTGG + Intergenic
1049194758 8:141308833-141308855 CGCCACGGGCAGGGGCGGAGGGG - Intergenic
1049761468 8:144333766-144333788 CGCCGGAGGCGGGGGCGGGGCGG - Exonic
1050113000 9:2235851-2235873 CGCCCCAGGCTGGAGTGCAGTGG + Intergenic
1050231174 9:3526756-3526778 CGCCGCAGCGTGGCGCGGAGAGG + Intergenic
1051344978 9:16143477-16143499 CGCCGCAGCCTGGCCTGCAGAGG - Intergenic
1052765524 9:32636044-32636066 CGCCCCAGGCTGGCGTGCAGTGG + Intergenic
1053135274 9:35646918-35646940 CGCCGCCGCCTGGCGAGGGGCGG - Intergenic
1053409140 9:37904261-37904283 GGCCGCAGGCCGCCGCGGCGGGG + Intronic
1055044449 9:71910585-71910607 CGCCGCAGCCCGGCTCGGGGAGG - Intronic
1058110707 9:101028715-101028737 AGCAAAAGGCTGGCGCGGAGGGG - Exonic
1059453282 9:114384013-114384035 CAACCCAGGCTGGCGCCGAGTGG - Intronic
1060354497 9:122892449-122892471 CGCCCCAGGCTGGAGTGCAGTGG + Intronic
1061128381 9:128690257-128690279 CTCCGCACGCTGGCGCGACGGGG - Intronic
1061299185 9:129695011-129695033 AGCTGCAGGCTGGCTCAGAGGGG + Intronic
1061343145 9:129999556-129999578 CGCCCCAGGCTGGAGTGCAGTGG - Intronic
1062342555 9:136100251-136100273 CCCCTCAGGCTGGCACAGAGCGG - Intergenic
1062365799 9:136208351-136208373 CCCTGCAGGATGGGGCGGAGTGG + Exonic
1062567387 9:137169291-137169313 CGGCGCAGCCAGGCGCAGAGCGG + Exonic
1062696171 9:137877544-137877566 CGGCCCGGGCTGGCGCTGAGCGG + Intergenic
1203525813 Un_GL000213v1:85845-85867 AGCCGCAGGCTGTGGCCGAGGGG + Intergenic
1203468303 Un_GL000220v1:105976-105998 CACCGCCGGCGGGCGGGGAGAGG - Intergenic
1203476124 Un_GL000220v1:149948-149970 CACCGCCGGCGGGCGGGGAGAGG - Intergenic
1185497025 X:563124-563146 CACCGCAGGCTGGGGTGCAGTGG + Intergenic
1186048481 X:5563041-5563063 TGCCGCAGGCTGGAGTGCAGTGG + Intergenic
1186464412 X:9773822-9773844 CGCCCCAGGCTGGAGTGAAGTGG - Intronic
1189493103 X:41484921-41484943 CGCCCCAGGCTGGAGTGCAGTGG - Intergenic
1190158495 X:48012873-48012895 CGCCCCAGGCTGGAGTGCAGTGG - Intronic
1190174191 X:48135142-48135164 CGCCCCAGGCTGGAGTGCAGTGG - Intergenic
1190299030 X:49045362-49045384 CGCCCCAGGCTGGAGTGCAGTGG - Intergenic
1190786734 X:53658007-53658029 CGCCCCAGGCTGGAGTGCAGTGG - Intronic
1192426786 X:71084171-71084193 CGCCGCAGGCTGGAGTGCAGTGG - Intergenic
1192507210 X:71695064-71695086 CGCCCCAGGCTGGAGTGCAGCGG - Intergenic
1192519487 X:71786485-71786507 CGCCCCAGGCTGGAGTGCAGCGG + Intergenic
1192526756 X:71852538-71852560 CGCCCCAGGCTGGAGTGCAGTGG - Intergenic
1193117382 X:77788651-77788673 GGCTGCAGGCTGGAGCGCAGTGG + Intergenic
1194383607 X:93225036-93225058 CACCGCAGGCGGAGGCGGAGGGG + Intergenic
1195413712 X:104597302-104597324 TGCCCCAGGCTGGCGTGCAGTGG - Intronic
1196825584 X:119737906-119737928 CGCCCCAGGCTGGAGTGGAGTGG + Intergenic
1200117920 X:153777217-153777239 CGCTGGAGGATGGCGAGGAGGGG + Exonic
1200156012 X:153975682-153975704 CGCCCCAGGCTGGAGTGCAGTGG + Intronic
1201895962 Y:18993090-18993112 CGCCGCAGGCAGGAGCGCGGGGG - Intergenic