ID: 945119373

View in Genome Browser
Species Human (GRCh38)
Location 2:206442921-206442943
Sequence AGAGCGTTTGCGCCGCAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 43
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 38}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945119373_945119375 5 Left 945119373 2:206442921-206442943 CCAGCCTGCGGCGCAAACGCTCT 0: 1
1: 0
2: 0
3: 4
4: 38
Right 945119375 2:206442949-206442971 GCCGCAGTCCCACCCGCTGCTGG 0: 1
1: 0
2: 1
3: 11
4: 166
945119373_945119381 19 Left 945119373 2:206442921-206442943 CCAGCCTGCGGCGCAAACGCTCT 0: 1
1: 0
2: 0
3: 4
4: 38
Right 945119381 2:206442963-206442985 CGCTGCTGGCAATCTGAATGAGG 0: 1
1: 0
2: 0
3: 3
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945119373 Original CRISPR AGAGCGTTTGCGCCGCAGGC TGG (reversed) Intergenic
901958953 1:12809650-12809672 AGAGCCATTGCACCCCAGGCTGG - Intergenic
915248460 1:154572157-154572179 AGAGCGTGAGTGCCGCAGGCTGG + Exonic
915728793 1:158038008-158038030 AGAGCCATTGAGCCGCTGGCAGG - Intronic
917755367 1:178093665-178093687 GGAGGGACTGCGCCGCAGGCAGG - Intergenic
1083622752 11:64057066-64057088 AGAGCTGGTGCGACGCAGGCTGG - Intronic
1113638538 13:111939489-111939511 AGAGCGGCTTCCCCGCAGGCGGG - Intergenic
1113787273 13:113009068-113009090 AGACAGTTTGCGCCTCGGGCAGG - Intronic
1126697904 15:51341412-51341434 AGAGGGTTTGCTCAGCTGGCGGG + Intergenic
1132758787 16:1499009-1499031 AGAGCGCGTGCACCGCAGCCCGG - Intronic
1141699076 16:85634196-85634218 TGAGCGTGCACGCCGCAGGCGGG - Intronic
1142968909 17:3598142-3598164 AGGGCATTTGGGCCGCAGCCTGG - Intergenic
1144021071 17:11240767-11240789 AGCGCGCTCCCGCCGCAGGCTGG - Intergenic
1146159396 17:30551799-30551821 AGAGTGTATACGCTGCAGGCAGG + Intergenic
1152628049 17:81397191-81397213 AGAGCCGTGGCGGCGCAGGCAGG + Intronic
1155221488 18:23689771-23689793 CGAGCGGTCGCCCCGCAGGCTGG - Exonic
1160518925 18:79493564-79493586 GGAGCGTGTCCGCCGCAGTCTGG + Intronic
1161771725 19:6234383-6234405 AGTGCCTTTGCGCCATAGGCCGG - Intronic
928975714 2:37084374-37084396 AGAGCGCTTGCGCGGAGGGCTGG + Intergenic
934516962 2:94994274-94994296 AGAGCGTTTTCCCCTCAGCCTGG - Intergenic
942240970 2:173964241-173964263 GGAGCGTTGGCGCCTCGGGCGGG + Intronic
945119373 2:206442921-206442943 AGAGCGTTTGCGCCGCAGGCTGG - Intergenic
946426011 2:219597485-219597507 AGAGCGTATCCGCCGTAGGATGG - Intergenic
1169171851 20:3471457-3471479 AGTGCGTCTGCCCCGCCGGCTGG + Exonic
1171590855 20:26599982-26600004 AGAGCTTTTTCGCCTTAGGCCGG + Intergenic
1176864392 21:14036557-14036579 AGAACATTTGCGCCTCATGCAGG + Intergenic
1178279286 21:31266895-31266917 AGTGTGCTTGCGCCCCAGGCTGG + Exonic
1178491631 21:33056254-33056276 ACAGCCTTTGTGCAGCAGGCTGG + Intergenic
1179973398 21:44849000-44849022 AGGGGGTTTCCGCCGCAGACGGG + Intergenic
1180597508 22:16988327-16988349 AGAGCGTCTGCTCCTCAGCCAGG - Intronic
1181491515 22:23263192-23263214 AGAGCGCTGGCCCCGCAGCCGGG - Intronic
965483017 3:169243667-169243689 AGAGCGTTTGAGTCCCAGACAGG + Intronic
969540957 4:7788424-7788446 AGCGCGTGTGCGCCCCATGCTGG + Intronic
977244789 4:94618662-94618684 AGAGCATTTGAGCAGCAGGATGG + Intronic
982257616 4:153466182-153466204 AGCGCGTGTGCGCCGCAGATAGG - Intergenic
985645241 5:1081855-1081877 ACAGCTTGTGCGCCGCAAGCAGG + Intronic
1001984305 5:176060991-176061013 AGAGCGTCAGCGCCGAAGCCAGG + Intronic
1002233171 5:177783074-177783096 AGAGCGTCAGCGCCGAAGCCAGG - Intronic
1010428136 6:75749052-75749074 AGAGGCTCTGCGCCGCGGGCGGG + Intergenic
1016799871 6:148157659-148157681 ATAGAGTTTGCGCCCCAGGCAGG + Intergenic
1018230401 6:161669895-161669917 AGAGCCTGTGCGCTGCAGGCTGG - Intronic
1049571164 8:143370910-143370932 AGAGCGTTGGAGCAGCAGGTGGG + Intronic
1049602691 8:143515261-143515283 AGTGCGTATGCGCCACAGGCTGG - Intronic
1199610129 X:149605806-149605828 AGGGCGTTTGGGCTGGAGGCGGG - Intronic