ID: 945119582

View in Genome Browser
Species Human (GRCh38)
Location 2:206443796-206443818
Sequence GCTAGCTGCGGGGCGGCCGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 172}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945119582_945119595 13 Left 945119582 2:206443796-206443818 CCCGCGGCCGCCCCGCAGCTAGC 0: 1
1: 0
2: 0
3: 11
4: 172
Right 945119595 2:206443832-206443854 CGGCCACACGGAGCGGCGCCCGG 0: 1
1: 0
2: 1
3: 1
4: 106
945119582_945119593 6 Left 945119582 2:206443796-206443818 CCCGCGGCCGCCCCGCAGCTAGC 0: 1
1: 0
2: 0
3: 11
4: 172
Right 945119593 2:206443825-206443847 CTCTCGCCGGCCACACGGAGCGG 0: 1
1: 0
2: 0
3: 5
4: 61
945119582_945119589 -7 Left 945119582 2:206443796-206443818 CCCGCGGCCGCCCCGCAGCTAGC 0: 1
1: 0
2: 0
3: 11
4: 172
Right 945119589 2:206443812-206443834 AGCTAGCCCGGCGCTCTCGCCGG 0: 1
1: 0
2: 0
3: 3
4: 39
945119582_945119592 1 Left 945119582 2:206443796-206443818 CCCGCGGCCGCCCCGCAGCTAGC 0: 1
1: 0
2: 0
3: 11
4: 172
Right 945119592 2:206443820-206443842 CGGCGCTCTCGCCGGCCACACGG 0: 1
1: 0
2: 0
3: 4
4: 44
945119582_945119596 14 Left 945119582 2:206443796-206443818 CCCGCGGCCGCCCCGCAGCTAGC 0: 1
1: 0
2: 0
3: 11
4: 172
Right 945119596 2:206443833-206443855 GGCCACACGGAGCGGCGCCCGGG 0: 1
1: 0
2: 0
3: 6
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945119582 Original CRISPR GCTAGCTGCGGGGCGGCCGC GGG (reversed) Exonic
900255059 1:1693524-1693546 GCTGGCGTCGGGGCTGCCGCGGG + Intronic
900263802 1:1746790-1746812 GCTGGCGTCGGGGCTGCCGCGGG + Intergenic
900269146 1:1778346-1778368 GCTGGCGGCGGCGCGGCGGCGGG - Intronic
900485570 1:2921117-2921139 GCGAGCAGCGGGGCGGCAGTGGG - Intergenic
901320926 1:8339397-8339419 GCTAGCTTCAGGTCAGCCGCCGG + Intronic
902067465 1:13700206-13700228 GATGGCGGCGGCGCGGCCGCGGG + Intronic
902819763 1:18936701-18936723 GCTGGCTCCAGGGCGGCTGCGGG - Intronic
903354285 1:22736774-22736796 GCGCACTGTGGGGCGGCCGCAGG + Intronic
903777055 1:25800130-25800152 GGGAGGGGCGGGGCGGCCGCAGG - Intergenic
903925191 1:26826835-26826857 GCGGGCAGCGGGGCGGCCCCGGG - Exonic
904847497 1:33431019-33431041 GCGGGCTGAGGGGCGGCCCCCGG - Intronic
905166146 1:36084379-36084401 GGGAGCTGGGGGGCGGCCCCCGG - Intronic
905580774 1:39081633-39081655 GGGAGCTGGGGCGCGGCCGCCGG - Intronic
907329868 1:53663808-53663830 GCCAGCGGCGGGGCAGCCCCAGG + Intronic
910569612 1:88684711-88684733 GCTAGGGGCGCGGCGGCCGCAGG - Intronic
910981180 1:92961348-92961370 GCTGGTGGCTGGGCGGCCGCCGG + Intronic
913271903 1:117102317-117102339 GCTGGCTGCAGGGTGGCTGCAGG - Exonic
915463201 1:156081760-156081782 GCCGGCTGCGGGGGGGCGGCCGG + Exonic
919463190 1:197902701-197902723 GCTGGCGGCGGGGCGGCGGAAGG - Exonic
1067288910 10:44927456-44927478 GCTTGCTGAGGGGTGGCGGCAGG - Intronic
1067686071 10:48466603-48466625 GCAAGCGGCAAGGCGGCCGCGGG + Intronic
1069052682 10:63811627-63811649 GCTTTCAGCGGGGCGGCTGCCGG + Intergenic
1069486646 10:68827896-68827918 GGAAGCCGCGCGGCGGCCGCAGG - Exonic
1069486733 10:68828232-68828254 GGAAGCCGCGCGGCGGCCGCAGG - Intronic
1071618084 10:87094639-87094661 CCCGGCTGCGGGGCGGCGGCGGG + Exonic
1072102207 10:92239824-92239846 GCCGGCTGCGGCGCGGGCGCAGG + Exonic
1075072134 10:119326451-119326473 GCTCACTGCGGGGACGCCGCAGG + Intronic
1075587709 10:123669428-123669450 GCTAGCTCAGGGGCTGCCCCAGG + Intronic
1076035532 10:127196221-127196243 GCGAGCTGCGGCGCGGGGGCCGG - Intronic
1077065053 11:637344-637366 GCTGGGCGCGGGCCGGCCGCGGG + Exonic
1081686944 11:45049445-45049467 GCTGGGTGGGGGGCGGCAGCTGG + Intergenic
1082833858 11:57638492-57638514 GCGGGTGGCGGGGCGGCCGCTGG + Intergenic
1083309641 11:61777679-61777701 GCCTGCTCCGGGACGGCCGCAGG + Intronic
1083758393 11:64803185-64803207 GCGAGCTGCGGAGCCGGCGCGGG + Exonic
1087014545 11:93542993-93543015 GGTTGCTGCGGGGCGGGGGCTGG - Intronic
1090835318 11:130449487-130449509 TCTCGCTGCGGGGTGGCCTCGGG + Exonic
1091705761 12:2691812-2691834 GCTGCCTGCGGGCCGGCGGCTGG - Intronic
1091778752 12:3200819-3200841 GCGGGCTGCGGGGGGGCCGGCGG - Intronic
1092290978 12:7159278-7159300 GCTCCCTGCTGGGCGGCCCCAGG + Intergenic
1096529276 12:52233163-52233185 GGTAGGGGCGGGGCTGCCGCGGG - Exonic
1097190418 12:57216869-57216891 GCGGGCGGCGGGGCGGCTGCGGG - Exonic
1104448803 12:128853441-128853463 GCGAGCTGGGGCGCGGCCTCGGG + Intronic
1108518188 13:51222280-51222302 GCGAGGGGCGGGGCGGGCGCGGG + Intergenic
1115217339 14:31026261-31026283 GCTGGCTGCGGGGCGGAGGCCGG + Exonic
1115398580 14:32934891-32934913 GCGGCCGGCGGGGCGGCCGCGGG + Intergenic
1115502230 14:34060205-34060227 ACTACCTTCGGGGCGGCCGCGGG - Intronic
1116886895 14:50231168-50231190 GCTAGGGGCGGGGCGGCCGGCGG - Intronic
1119520097 14:75278868-75278890 GTTCGCTGCGCCGCGGCCGCCGG - Exonic
1125329172 15:38565142-38565164 GGAAGCTGCGGGTCGGCTGCGGG - Intronic
1125652928 15:41332362-41332384 GGCAGCTGCGGGCCGGCGGCTGG + Exonic
1125751725 15:42033758-42033780 ACAGGCTGCGGGGCGGCAGCAGG - Intronic
1125874673 15:43133672-43133694 GCTGGATGCGGGGCCGGCGCCGG - Exonic
1129761431 15:78131303-78131325 GCCAGCCGCGGGGCTGCCGAGGG - Exonic
1131977475 15:97960874-97960896 GCTGGGTGCGCGGCGGCCGTGGG + Exonic
1132186576 15:99806561-99806583 GGGAGCTGCGCGGCGGCCTCGGG - Intergenic
1132429110 15:101746150-101746172 GGGAGCTGCGCGGCGGCCTCGGG + Intergenic
1132805621 16:1773781-1773803 GCAGGCTGCGGGCCGGGCGCTGG - Exonic
1133325061 16:4937180-4937202 GCTGGGGGCGGGGCGCCCGCCGG + Intronic
1137530323 16:49275308-49275330 GCGAGCTGGGGGGCAGGCGCGGG + Intergenic
1138179768 16:54933307-54933329 GCTGGATGCGGGCCGGGCGCCGG - Exonic
1141699030 16:85634025-85634047 GCTGGTGGCGGGGCTGCCGCTGG - Exonic
1142005979 16:87689810-87689832 GCGGGCGGCGGGGTGGCCGCGGG - Exonic
1142292935 16:89201117-89201139 TCCTGCTCCGGGGCGGCCGCCGG - Exonic
1142695065 17:1628945-1628967 GCTCGCGGCGGGGCGGGCGGGGG - Intergenic
1142742211 17:1937758-1937780 GGTAGCTGCGGAGCTGCCCCTGG - Exonic
1143371641 17:6444246-6444268 GCTGGCGGCGGGGCGGGGGCCGG + Intergenic
1145041279 17:19579891-19579913 GCTGGCGGCGGCGCGGGCGCGGG - Intergenic
1147907552 17:43832917-43832939 GCGCGCGGCGGGGCGGGCGCGGG + Intronic
1148060042 17:44830044-44830066 GCCGGGTGAGGGGCGGCCGCAGG - Intronic
1151477446 17:74352165-74352187 GCCACCCGCGGGGGGGCCGCTGG + Intronic
1151828869 17:76538203-76538225 GCTAGGTCCACGGCGGCCGCCGG - Intronic
1152357121 17:79812785-79812807 GGGAGCGGCGGGGTGGCCGCCGG + Intergenic
1152795480 17:82304249-82304271 GCTGACTGATGGGCGGCCGCCGG - Intergenic
1152891531 17:82884337-82884359 GCCAGCTGCGGGCAGGCCACTGG + Intronic
1152965635 18:111845-111867 GCTGGCAGCCGGGAGGCCGCAGG + Intergenic
1154202331 18:12308177-12308199 GCGAGCGGCGGGGCGGGGGCGGG + Exonic
1154279714 18:12991556-12991578 GCAGGCTGTGGGGCGGCCTCAGG + Intronic
1160554356 18:79716447-79716469 GCTAGCTGCAGGGCAGAGGCGGG + Intronic
1160809013 19:1005018-1005040 GCGCCCTGCGGGACGGCCGCTGG + Exonic
1161321613 19:3644105-3644127 GGTAGCTGCGGGCCCCCCGCAGG + Exonic
1161333745 19:3700184-3700206 GGTCGCTGCGGGGGCGCCGCCGG - Intronic
1161767467 19:6215462-6215484 GCTCACTGCGGGGGAGCCGCTGG - Intronic
1162046773 19:8005405-8005427 CCTGGCCGCGGGGCGCCCGCGGG - Intronic
1166106793 19:40601595-40601617 GCTCCCGGCGGGGCGGCCCCGGG + Intronic
1168706293 19:58472122-58472144 GCTGGCTGCGAGACGGCGGCTGG - Exonic
929501380 2:42493941-42493963 GACGGCGGCGGGGCGGCCGCCGG - Exonic
932166721 2:69514490-69514512 GCTGGCTGTGGGGCTGCAGCTGG + Exonic
932555904 2:72825160-72825182 GATAACTGGGGGGCGGCAGCAGG + Intronic
935963442 2:108449243-108449265 GCTGGTTGCGGGCCGGCGGCGGG + Exonic
937963961 2:127486813-127486835 GCTAGCTGGGAGGCGGCAGGAGG - Intronic
940830031 2:158456914-158456936 GCTGGCAGCGGGGCGGGCGGCGG + Intergenic
942064421 2:172257104-172257126 GCTGGCTGTGGGGAGGCCCCTGG + Intergenic
942946457 2:181679581-181679603 GCTAGCTGCAGGGCGAGGGCTGG + Intronic
945119582 2:206443796-206443818 GCTAGCTGCGGGGCGGCCGCGGG - Exonic
946191599 2:218010540-218010562 GCGCGCTGCGGGGCGGATGCCGG + Intergenic
948140835 2:235670688-235670710 GCGGGCTGCGTGGCGGTCGCGGG - Intronic
948468580 2:238163732-238163754 GCCAGGTGCGGTGCGGCAGCGGG + Exonic
948479264 2:238239991-238240013 GGCTGCTGCTGGGCGGCCGCGGG - Exonic
948933851 2:241149853-241149875 GCTGGCTCCGGGGCGCCAGCTGG - Intronic
1168806633 20:675619-675641 GCTCGGTGCGGGGAGGCGGCCGG + Exonic
1173494288 20:43507710-43507732 GCTAGGCGCTGGGCGGCCACCGG + Exonic
1175864032 20:62165093-62165115 GCTAGCTCCTGGGAGGACGCAGG - Intronic
1176156983 20:63626915-63626937 CCTCGCCGCGGGGGGGCCGCGGG + Intronic
1179534026 21:42039835-42039857 GCTGGCTGCAGGGCGGCTGCTGG + Intergenic
1179571053 21:42279167-42279189 GCAAGCTGAGGGGCGGCTGTGGG + Intronic
1180791379 22:18577332-18577354 TCTAGCGAGGGGGCGGCCGCGGG + Intergenic
1181035511 22:20168126-20168148 GGTAGCGGCGTGGGGGCCGCAGG - Intergenic
1181248290 22:21516884-21516906 TCTAGCGAGGGGGCGGCCGCGGG + Intergenic
1184265542 22:43343969-43343991 GCTTGTCACGGGGCGGCCGCAGG + Intergenic
1185055370 22:48576158-48576180 GCTGGCTGCGGGGCGCCGGGGGG - Intronic
1185338281 22:50280439-50280461 GCCACGGGCGGGGCGGCCGCAGG - Intronic
950294699 3:11818784-11818806 GCTACTTGGGGGGGGGCCGCAGG + Intronic
951994940 3:28716992-28717014 GCTACCTACGGGGCCACCGCTGG + Intergenic
953485070 3:43286896-43286918 CCTGGCGGCGGGGCGGCGGCGGG + Intronic
954110726 3:48431376-48431398 GCTATATGCAGGGGGGCCGCAGG - Intergenic
957078651 3:75619691-75619713 GCGGGATGCGGGGCTGCCGCGGG + Intergenic
960096756 3:113696674-113696696 GCTTGCTGAGCTGCGGCCGCGGG - Intergenic
961000968 3:123373767-123373789 GCTACCTGCGGGGGGGTCGGGGG - Intronic
961603358 3:128076887-128076909 GGCAGCTGCGGGGAGGGCGCGGG - Intronic
961637714 3:128343448-128343470 CTTAGCTCCGGGGGGGCCGCTGG + Intronic
962222355 3:133574186-133574208 GCGGGCGGCGGGGCGGGCGCGGG + Exonic
966411820 3:179653062-179653084 GCGGGCTGCGGGGCGGGAGCGGG - Exonic
966696278 3:182793513-182793535 GGTGGCTGCGGCGCGGCGGCAGG + Exonic
966936327 3:184711987-184712009 GCTGGCGGCGTTGCGGCCGCAGG - Exonic
968305900 3:197651051-197651073 GCCTGCTGCGGGGCAGCCCCAGG - Intergenic
968632510 4:1659329-1659351 GCTTGCTGCGGGGAGGCCCGGGG - Intronic
968671902 4:1856416-1856438 GCTCGCAGCGTGGCGGCCGCAGG + Intergenic
969288238 4:6221889-6221911 CGTAACTGCGGGGCGGGCGCAGG + Intergenic
969314839 4:6375681-6375703 GCTGGCTGCTGGGCGGCCACGGG - Intronic
973224004 4:47761882-47761904 GCTAGCTGAGGGGCTGAAGCAGG + Intronic
975616374 4:76251675-76251697 CCTAGCAACGGGGCGGCAGCAGG + Intronic
977536403 4:98260790-98260812 GCTGGCTGAGGAGGGGCCGCCGG - Intergenic
977809705 4:101346071-101346093 GCTGGCTGGAGGGTGGCCGCGGG - Intronic
982380572 4:154743872-154743894 GCTAGCGGCGGGGAGGACGCGGG - Intronic
984376508 4:178937698-178937720 GTTAGCTGCGAGGAGGCAGCAGG - Intergenic
985068419 4:186144913-186144935 GCCAGCCGCGCGGCGGGCGCGGG + Exonic
985451646 4:190066435-190066457 GCTGGCAGCTGGGCGGCTGCAGG - Intergenic
985453619 4:190073023-190073045 GCTGGCAGCTGGGCGGCTGCAGG - Intergenic
985454609 4:190076316-190076338 GCTGGCAGCTGGGCGGCTGCAGG - Intergenic
985455597 4:190079609-190079631 GCTGGCAGCTGGGCGGCTGCAGG - Intergenic
985456581 4:190082903-190082925 GCTGGCAGCTGGGCGGCTGCAGG - Intergenic
985457569 4:190086203-190086225 GCTGGCAGCTGGGCGGCTGCAGG - Intergenic
985458556 4:190089496-190089518 GCTGGCAGCTGGGCGGCTGCAGG - Intergenic
985459545 4:190092796-190092818 GCTGGCAGCTGGGCGGCTGCAGG - Intergenic
985727407 5:1523550-1523572 GCGAACTGAGGGGCGGCCGCGGG + Intronic
986514285 5:8544176-8544198 GTTATCTGAGGGGAGGCCGCAGG - Intergenic
988727452 5:33938641-33938663 ACTTGCTGCGGGGCTGCCCCAGG + Intergenic
996329311 5:122311922-122311944 GCTGGCCTGGGGGCGGCCGCAGG + Intronic
997292501 5:132747772-132747794 GCTTGCTCTGGGGCGGCGGCGGG - Exonic
998122511 5:139590321-139590343 GCTACCTGGGAGGCGGCTGCAGG + Intronic
999462697 5:151771067-151771089 GGGCGCTGCGAGGCGGCCGCGGG - Intronic
1002439626 5:179257549-179257571 GCCAGCAGCGGGGAGGGCGCAGG - Intronic
1003482566 6:6546714-6546736 TCTGGCTGCGCGGTGGCCGCGGG - Intergenic
1006369211 6:33633807-33633829 GCTGGGGGCGGGGCGGGCGCGGG + Intronic
1006834024 6:36986070-36986092 GCTCGCGGCGGAGCGGCGGCGGG - Exonic
1012939616 6:105402986-105403008 GGCAGCTGCGGGGCGGCCGGCGG + Exonic
1016714097 6:147204076-147204098 GCGAGCAGCGGCGCGGCCGCGGG + Intergenic
1017877534 6:158536880-158536902 GGCAGCGGCGGGGCGGCCGGAGG + Intronic
1019523399 7:1470394-1470416 GGTGGCTCCGGGCCGGCCGCTGG - Exonic
1019653451 7:2173301-2173323 GGTACCTGCGGGGCGGCAGAGGG - Intronic
1019828233 7:3301306-3301328 GCTAGCTCCGAGGGGTCCGCCGG - Intergenic
1022721208 7:32943086-32943108 GCGAGTCGCGGGGCGGCGGCGGG - Intergenic
1022739740 7:33109497-33109519 GTGAGTTGCGGGGCGGCGGCGGG - Intergenic
1023221142 7:37920986-37921008 CCTGGCTGCTGGGCGGCCTCTGG + Exonic
1027059282 7:75073098-75073120 GCTAGCAGCGGTGGGGCCTCGGG + Intronic
1029169142 7:98618294-98618316 GGTTGCTGCGAGGCTGCCGCGGG + Intronic
1031898600 7:127384380-127384402 ATTAGCTGGGGGGCGGCGGCGGG - Intronic
1033357906 7:140615644-140615666 GCTAGCTGAGGGGCTGAGGCAGG - Intronic
1034182158 7:149147473-149147495 GCCAGCTGAGGGGCCGCTGCGGG + Exonic
1037473932 8:19237803-19237825 GCGAGCTGCCGGGCGGCCAAGGG + Intergenic
1039864592 8:41490313-41490335 GCGAGCTGTGGGGCTGCGGCCGG - Intergenic
1039864600 8:41490337-41490359 GCGAGCTGTGGGGCTGCGGCCGG - Intergenic
1040915502 8:52564112-52564134 GCTAGCTGCGAGGCATCCCCAGG + Intronic
1052560737 9:30079653-30079675 GCTAGCTGCTGGGATGCTGCAGG - Intergenic
1053418498 9:37961917-37961939 GCTAGCTGCAGGTCGGCCATGGG - Intronic
1057716700 9:97501651-97501673 ACGAGCTCCCGGGCGGCCGCGGG - Exonic
1057869676 9:98708575-98708597 GCGGGCTGCTGGGCGGCGGCCGG + Exonic
1058705888 9:107637683-107637705 GCTGCCTGCCGGGCGGCCTCGGG + Intergenic
1060544747 9:124453341-124453363 GGGAGCAGCGGGGCGGGCGCTGG + Exonic
1061499198 9:130992569-130992591 GCTTGCTGCTGTGCGGCTGCAGG - Intergenic
1061909424 9:133714928-133714950 GCTAGCGGAGGGGCAGCTGCAGG + Intronic
1062656184 9:137605521-137605543 GCGGGCTACGGGGCGGCCGGGGG + Intergenic
1199772499 X:150983746-150983768 GCGAGCAGAGGGGCGGCTGCGGG + Intronic
1200117120 X:153774294-153774316 GCAGGCTGCGGGGCGTGCGCAGG - Exonic