ID: 945119676

View in Genome Browser
Species Human (GRCh38)
Location 2:206444115-206444137
Sequence TTTCCTCTGCAGGGCCCCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 179}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945119676_945119687 19 Left 945119676 2:206444115-206444137 CCCGCGGGGCCCTGCAGAGGAAA 0: 1
1: 0
2: 3
3: 18
4: 179
Right 945119687 2:206444157-206444179 GTGTGCTCCGGGCTTGTCCCCGG 0: 1
1: 0
2: 0
3: 6
4: 120
945119676_945119682 -8 Left 945119676 2:206444115-206444137 CCCGCGGGGCCCTGCAGAGGAAA 0: 1
1: 0
2: 3
3: 18
4: 179
Right 945119682 2:206444130-206444152 AGAGGAAAGCGAAGGGCGCGCGG 0: 1
1: 0
2: 0
3: 9
4: 227
945119676_945119684 7 Left 945119676 2:206444115-206444137 CCCGCGGGGCCCTGCAGAGGAAA 0: 1
1: 0
2: 3
3: 18
4: 179
Right 945119684 2:206444145-206444167 GCGCGCGGGTCCGTGTGCTCCGG 0: 1
1: 0
2: 0
3: 4
4: 63
945119676_945119683 -7 Left 945119676 2:206444115-206444137 CCCGCGGGGCCCTGCAGAGGAAA 0: 1
1: 0
2: 3
3: 18
4: 179
Right 945119683 2:206444131-206444153 GAGGAAAGCGAAGGGCGCGCGGG 0: 1
1: 0
2: 0
3: 31
4: 195
945119676_945119685 8 Left 945119676 2:206444115-206444137 CCCGCGGGGCCCTGCAGAGGAAA 0: 1
1: 0
2: 3
3: 18
4: 179
Right 945119685 2:206444146-206444168 CGCGCGGGTCCGTGTGCTCCGGG 0: 1
1: 0
2: 0
3: 6
4: 75
945119676_945119688 24 Left 945119676 2:206444115-206444137 CCCGCGGGGCCCTGCAGAGGAAA 0: 1
1: 0
2: 3
3: 18
4: 179
Right 945119688 2:206444162-206444184 CTCCGGGCTTGTCCCCGGCTCGG 0: 1
1: 0
2: 0
3: 2
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945119676 Original CRISPR TTTCCTCTGCAGGGCCCCGC GGG (reversed) Intronic
901323757 1:8355304-8355326 TGTCCCCTCCAGGGCCCAGCAGG + Intronic
903771885 1:25769513-25769535 CTTCCTCTGGAGGGGCACGCAGG - Intronic
904997304 1:34641004-34641026 TTTGCTCTGCAGTGCCCTGAGGG - Intergenic
905037843 1:34929387-34929409 CTCCCTCTGCAGCGCCCCCCAGG - Intronic
905803523 1:40860928-40860950 TTTCCTCTCCTGGGCACTGCTGG + Intergenic
910234427 1:85020617-85020639 TTTTCTTTGCAAGGCCCTGCAGG - Intronic
915355002 1:155250621-155250643 TTTCCTCGAAGGGGCCCCGCAGG + Exonic
915474596 1:156146300-156146322 TTTCCTCTGCAAAGCCCCCCTGG - Intergenic
916426732 1:164687936-164687958 TCTCCACTGCAGGGCACAGCTGG - Intronic
1064261923 10:13792868-13792890 TTTCCTCTGCAGAGGCCCTGAGG - Intronic
1070779205 10:79127707-79127729 TTTCCTGTTCAGGGCCATGCAGG + Intronic
1071544996 10:86522110-86522132 CTTCCCCTCCAGGGACCCGCCGG + Intergenic
1073060971 10:100733431-100733453 CTTCCTCTTCATGGCCCCTCTGG + Intergenic
1073101567 10:101009249-101009271 TTTCCTCAGTGGGGCCCTGCAGG - Intronic
1073438291 10:103535743-103535765 CTACCTCTGCTGGGCCCTGCAGG + Intronic
1074536279 10:114330404-114330426 TTTCCTCTGTAGGGCATGGCTGG - Intronic
1075398073 10:122142194-122142216 TTTCCTCTGTGGAGCCCCGAGGG + Intronic
1075411093 10:122228442-122228464 TTTGCTCTGCAAGACCCCACAGG - Intronic
1075926136 10:126253175-126253197 TTTCCTGTGCTGGACCCTGCAGG - Intronic
1076033183 10:127176309-127176331 TTTCATCTCCAGGGCCAGGCAGG + Exonic
1076614273 10:131745845-131745867 GCTCCTCTGCAGGGCCACGGTGG + Intergenic
1076680017 10:132167063-132167085 TTTCGTTGGCAGGGCCCAGCAGG + Intronic
1076809821 10:132880626-132880648 TGTCCTCTGCAGGGGCCCTGAGG - Intronic
1076903024 10:133349055-133349077 TTGTCTCTTCAGGGCCCTGCGGG - Intronic
1077273828 11:1694095-1694117 TGACCTCTGCAGAGCCCAGCAGG + Intergenic
1077454712 11:2671633-2671655 TTTCCCCAGCAGGGCACCACAGG - Intronic
1079274878 11:19025971-19025993 TTTCCTGTGCAGGGATCTGCTGG + Intergenic
1080861748 11:36155929-36155951 TTTCCTCCACAGAGCCCTGCAGG - Intronic
1081308138 11:41538507-41538529 GTTCCTCTGCAGGGTCTCTCTGG - Intergenic
1083099299 11:60286134-60286156 TTTGTTCTGCCCGGCCCCGCAGG + Intronic
1083926587 11:65810826-65810848 TTTCCTGAGCAGGGCCCGGGTGG + Intergenic
1088816462 11:113424310-113424332 TGTCCAGTGCAGGGCCCTGCTGG + Intronic
1089647994 11:119892681-119892703 TTGCGTCTGCAGAGGCCCGCGGG - Intergenic
1090332306 11:125941726-125941748 TTTCCTCTGCAGCCCTCGGCTGG + Intergenic
1091012882 11:132022491-132022513 TGTCCTTTGCAGGGCCACGTGGG - Intronic
1091433068 12:453114-453136 TTTCCTCTCCAGGGCCGAGCGGG + Intergenic
1091433090 12:453185-453207 TTTCCTCTCCGGGGCCGAGCGGG + Intergenic
1091433112 12:453256-453278 TTTCCTCTCCGGGGCCGAGCGGG + Intergenic
1091433134 12:453327-453349 TTTCCTCTCCGGGGCCGAGCGGG + Intergenic
1091433156 12:453398-453420 TTTCCTCTCCGGGGCCGAGCGGG + Intergenic
1091433178 12:453469-453491 TTTCCTCTCCGGGGCCGAGCGGG + Intergenic
1094473370 12:30823295-30823317 GGGCCTCTGCAGGGCTCCGCGGG + Intergenic
1095983089 12:47983726-47983748 TTTCCACTGCAGGGACCTGCTGG - Exonic
1096476130 12:51910308-51910330 TTTGCTGTACAGGGCCCTGCTGG - Intronic
1096539236 12:52295534-52295556 TGCCCTCTGCAGGGCCCTGCAGG + Intronic
1100434688 12:94560894-94560916 TTTCATCAGCAGAGCCCCGCTGG + Intergenic
1110577571 13:77077193-77077215 GTTCCTCTGCTGGGCCACACTGG + Exonic
1112285915 13:98104436-98104458 TGGCCCGTGCAGGGCCCCGCGGG + Intergenic
1118716153 14:68561459-68561481 TCTGCTCTGCAGAGCACCGCTGG + Intronic
1119709678 14:76812699-76812721 TCGCCTCTGCGGGGCTCCGCGGG - Intronic
1122413077 14:101535837-101535859 TTGCCTGTACAGGGCCCCCCAGG + Intergenic
1123707330 15:22959734-22959756 GTTCCTCAGCCGGGCGCCGCAGG - Intronic
1128931970 15:71713350-71713372 TATCCTCTGCAGGGCCCCAGAGG + Intronic
1129150538 15:73684985-73685007 TCCACTCTGCAGGGCCCAGCAGG + Intronic
1132747320 16:1442454-1442476 GTTCTTCTGCAGGGCGCCGCAGG + Exonic
1134307560 16:13046830-13046852 CTTCCTCTGCATGGCCTGGCTGG + Intronic
1137296310 16:47097241-47097263 CTTCGTCTGAAGGGCCCCGTGGG - Intronic
1137614326 16:49837866-49837888 CTTCCTCTGCAGTGCCCTCCCGG + Intronic
1138111130 16:54324875-54324897 CTCACTGTGCAGGGCCCCGCTGG + Intergenic
1139016023 16:62690019-62690041 TTTGTTCTGCCTGGCCCCGCAGG - Intergenic
1139691790 16:68646048-68646070 ATTCCTCTGCTGGGGCCAGCGGG - Intronic
1141448531 16:84080519-84080541 TCTCCTCTGCAGGACACTGCTGG + Intronic
1141458481 16:84161284-84161306 TTTCCTCAGCATGGCCCCTGGGG - Intronic
1141464088 16:84195428-84195450 TCACCTCAGCAGGGCCCTGCGGG - Exonic
1141469332 16:84228149-84228171 TTGCATCTGCAGGGCCCCCAGGG - Intronic
1141658831 16:85430715-85430737 ATTCGTCTGAAGGGCACCGCTGG + Intergenic
1142022120 16:87790351-87790373 TCTCCTCTGCAGCACCCCGCTGG + Intergenic
1146781627 17:35679350-35679372 TTTCATCTCCAGGGCCCCCTTGG + Intronic
1147028484 17:37609636-37609658 GGCCCTCTGCAGGGCCCAGCTGG + Intergenic
1148027416 17:44598395-44598417 TTTCCTCTGCTGTGCCCCTGAGG + Intergenic
1148480586 17:47957306-47957328 ATCCCTCTGCAGGGCCCCAATGG + Intronic
1148796385 17:50199317-50199339 CTCCCCCTGCAGGGACCCGCAGG - Exonic
1151466576 17:74289582-74289604 TCTCCCCTGCAGGGACCCCCAGG + Exonic
1151967108 17:77437188-77437210 TTTCCCTCGCAGGGCCCCACTGG - Intronic
1152068875 17:78125557-78125579 GTCCCTCTGCAGGGACCCACGGG - Intronic
1152632560 17:81417101-81417123 CTTGCTCTGCAGGGACCCGAGGG + Intronic
1152805923 17:82356335-82356357 ATTCCTCTGCAGGGCTCAGCTGG + Intergenic
1157413931 18:47486375-47486397 TTTCCTCTGCAGGGACCCTGCGG + Intergenic
1157493508 18:48139578-48139600 TGTCCACTGCAGGACCCAGCCGG - Intronic
1157625291 18:49045748-49045770 TTTCCTGTGCGGGGCCCTCCAGG - Intronic
1158395699 18:57077209-57077231 TGTCCTCTGCAGGGCTCCCATGG + Intergenic
1161029275 19:2050489-2050511 TGTCCCCTGCAAGCCCCCGCCGG - Intronic
1161078591 19:2299201-2299223 TTTCCTCTGCAGGGTGCTGCCGG + Intronic
1161296047 19:3520674-3520696 TTTCTTCTGCAAGAGCCCGCAGG - Intronic
1163031197 19:14545357-14545379 TTTCCTCAGCAGGGTCCTCCCGG + Intronic
1163274788 19:16276791-16276813 TCTTATCTGCAGAGCCCCGCTGG + Intergenic
1163789271 19:19297055-19297077 TATCCTCTTCAGGCCCCCACCGG + Exonic
1165015079 19:32874889-32874911 ATTCACCTGCAGGGCCCCGCTGG - Intergenic
1165356644 19:35308412-35308434 TTTCATCTACAAGGCCCCTCAGG - Intronic
1166295114 19:41885112-41885134 TTCCCTCTGCTGGACCCCCCAGG + Intronic
1166626876 19:44365871-44365893 TATCCTCTCCAGGACCCAGCTGG + Intronic
1166809879 19:45508526-45508548 CTCCCTCTCCAGGGCCGCGCAGG - Intronic
1167288796 19:48613499-48613521 GGACATCTGCAGGGCCCCGCCGG - Exonic
925589243 2:5493552-5493574 TTTCCTCTCCGGGGCCCTGGAGG + Intergenic
925618033 2:5762434-5762456 TCAGCTCTGCAGAGCCCCGCAGG - Intergenic
925934641 2:8743742-8743764 TTTCCTCTTGAGGGTCCCCCAGG - Intronic
929583535 2:43099700-43099722 TTTCCTCTGCTGGACCTTGCAGG + Intergenic
929594232 2:43166093-43166115 TTCCCTCTCCAGGGACCAGCAGG - Intergenic
930614614 2:53580263-53580285 TTTCCTCTCCAGGACCCCATCGG - Intronic
932467950 2:71935390-71935412 CTTCCTCTGCAGAGCTCCTCTGG - Intergenic
934860950 2:97763282-97763304 TTTGCTCGGCAGGGCCATGCTGG - Intronic
936081832 2:109437564-109437586 TTCCATCTGCCGGGCCCTGCAGG + Intronic
938546627 2:132338658-132338680 TATCCTCTCCAGGACCCAGCTGG - Intergenic
939713779 2:145557438-145557460 TTCCATCTGCAGGGACCCTCAGG - Intergenic
941095619 2:161237678-161237700 TGTCCTCGGGAGGGCCCCCCCGG + Intergenic
941787128 2:169509787-169509809 GTTCCTCTGCAAGTTCCCGCTGG - Exonic
945119676 2:206444115-206444137 TTTCCTCTGCAGGGCCCCGCGGG - Intronic
947839449 2:233198255-233198277 TCTCCCCTGCAGGGCCCCAGCGG - Exonic
948560594 2:238848815-238848837 TCTCCTCGGCGAGGCCCCGCGGG + Intronic
948824325 2:240566992-240567014 TTGGCACTGCAGGGCCCCACCGG + Intronic
1171875491 20:30571392-30571414 TATCCTCTCCAGGACCCAGCTGG - Intergenic
1172300440 20:33845961-33845983 TTGCCTCTGCAGGACCGGGCAGG + Intronic
1173593889 20:44246859-44246881 TTTCCCCTGAAGGGCCTCGAAGG - Intergenic
1173865366 20:46309143-46309165 TTTCCTCTGGAGAGTCCCGCTGG + Intergenic
1173902998 20:46604683-46604705 TTTCATCTTCAGGCCCCTGCAGG - Intronic
1174008334 20:47428280-47428302 TTCCCTCTGCAGGACACAGCAGG + Intergenic
1174221345 20:48958091-48958113 TTTAGTCTGCAGGGCCAGGCGGG + Intronic
1174431739 20:50475113-50475135 TGTCCTCTGCAGGGCATGGCAGG + Intergenic
1175414387 20:58792301-58792323 TTTCCTCTGCAGGGCTGGGAAGG + Intergenic
1175715788 20:61253308-61253330 CTGCCTCTGCAGAGCCCCGCGGG + Intronic
1175962729 20:62645338-62645360 CTTCCTCTGCAGAGGCCCACAGG - Intronic
1175999811 20:62826755-62826777 TCTCCTCTGCAGGGTCCCATTGG + Exonic
1176091920 20:63322046-63322068 GTGCCTCTGCAGGGCCTCCCTGG + Exonic
1176426412 21:6551211-6551233 TTTCCACTCCAGGGCCCCGCGGG - Intergenic
1179512877 21:41885493-41885515 TTTGCTCTGCAGGATTCCGCGGG + Exonic
1179525964 21:41976028-41976050 TTGCCTCAGGAGGGCCCTGCAGG - Intergenic
1179701903 21:43159528-43159550 TTTCCACTCCAGGGCCCCGCGGG - Exonic
1180878349 22:19185946-19185968 TTCCCTCTGCAGGGGCCCTGTGG + Intronic
1180951814 22:19723842-19723864 CTTCCCTTGCAGGGCCGCGCGGG + Exonic
1181446827 22:22983302-22983324 TTTCCTGTGGGGGGCCCAGCAGG - Intergenic
1183350498 22:37332095-37332117 TTCCCTGTGCAGCGCCCCGTGGG - Intergenic
1183406693 22:37633694-37633716 TTTCCGGTGCAGGGCCCGGGGGG - Intergenic
1183677386 22:39307154-39307176 TTTCCTCTGCCGGGCTAAGCAGG + Intergenic
1184226536 22:43132040-43132062 GTTTCTCAGCAGGGCCCAGCTGG - Intergenic
1184813921 22:46856066-46856088 TTTCCTCTGCATGTCCCCTGAGG + Intronic
1185030949 22:48442581-48442603 TTTCCCCTGCAGGGCCTTGCCGG - Intergenic
1185105847 22:48869358-48869380 CTCCCTCCCCAGGGCCCCGCAGG - Intergenic
950502622 3:13373863-13373885 TTTCCTCCGCAGGCCCACGGTGG - Exonic
950570322 3:13795929-13795951 GCTCCTCTTCAGGGCACCGCTGG - Intergenic
952094172 3:29928534-29928556 TTTGCTTTGCAGGGCCCCCATGG - Intronic
952257006 3:31704361-31704383 CTTCCTCTGCAGTGACCCGGTGG + Intronic
955778657 3:62461050-62461072 ATTCCTCTGCAGGGGCCCCAGGG + Intronic
957640702 3:82849879-82849901 TTTCCACTGCAGGGCCCTGCAGG - Intergenic
961443201 3:126965084-126965106 TTCCCTGTGCAGGGCCCCTGCGG - Intergenic
967273238 3:187748162-187748184 TTTGCTCTGCAGCGCCCCCATGG - Intergenic
978283292 4:107042989-107043011 TTTCCTTTTCAGGGCCCCAGTGG - Intronic
987303289 5:16616544-16616566 CTTCCTCCGCAGTGTCCCGCGGG + Intronic
988243107 5:28639390-28639412 TATCCTCTGCAGGACCCCTTTGG - Intergenic
990271525 5:54146687-54146709 TTTCCTCTTCAGGGGCCATCAGG - Intronic
991587611 5:68216052-68216074 CTCCTTCTGCAGAGCCCCGCCGG + Intronic
996268990 5:121579535-121579557 TTTCCTCAGCAGGGGCACGCAGG + Intergenic
997608733 5:135195359-135195381 TGCCCTCTTCAGGGCCCGGCTGG + Intronic
998175299 5:139898143-139898165 TTTCCTCCACAGGGCCTCCCTGG - Intronic
1002297388 5:178239169-178239191 CTTCCTTTCCAGGGCCCCGACGG - Exonic
1002332139 5:178450458-178450480 TGTCCTCTCCTGGCCCCCGCTGG - Intronic
1002538422 5:179891054-179891076 TTTGCCCTGCAGGGCCCAGAAGG + Intronic
1002679347 5:180949024-180949046 TTGGCTCTGCAGGGACCCACGGG - Intronic
1002685225 5:181004521-181004543 TTGGCTCTGCAGGGACCCACGGG - Intronic
1003051143 6:2782266-2782288 TCTCCTGTGCAGGGCTCCCCTGG - Intronic
1003252889 6:4447327-4447349 TTTCCACTGCAAGGCACAGCTGG - Intergenic
1003290355 6:4775235-4775257 ATGCCTCTGCAGTGCCCCGTGGG + Intronic
1005307264 6:24525736-24525758 TTTCCTCTGCAGGGTTCCCCTGG - Intronic
1006298425 6:33180322-33180344 TTCCCACTCCAGGGCCCCCCTGG - Exonic
1009950503 6:70389998-70390020 TTTCCTCTGAAGGGTACCGAGGG + Intergenic
1016658168 6:146544140-146544162 TTCCCACTCCAGAGCCCCGCCGG + Intronic
1018862323 6:167720128-167720150 CTGCCTCTGCAGGAGCCCGCGGG + Intergenic
1019338783 7:498099-498121 TGGGCTCTGCAGGGGCCCGCAGG - Intronic
1019579147 7:1751488-1751510 GTCCCTCTCCAGGGCCCCGTGGG - Intergenic
1022544052 7:31168877-31168899 TTTCCTCTTCAGGTCCCCTGGGG + Intergenic
1024046634 7:45589852-45589874 TTTCCTTTCCAGGGCCACGGGGG + Intronic
1024396538 7:48875545-48875567 TTTCTTCCTCAGGGCCCAGCAGG + Intergenic
1024774903 7:52772779-52772801 TTTCATCTCCAGGGCCCAGCAGG - Intergenic
1026734765 7:72942576-72942598 TTTCCTCTTCGGGGCGCCCCAGG + Exonic
1026785099 7:73297488-73297510 TTTCCTCTTCGGGGCGCCCCAGG + Intergenic
1027108980 7:75422442-75422464 TTTCCTCTTCGGGGCGCCCCAGG - Exonic
1028755363 7:94427615-94427637 TCACCTTTGCAGGGCCCCCCTGG + Exonic
1028773594 7:94655758-94655780 TTTCCTCTCCGCGCCCCCGCGGG - Intronic
1029413854 7:100431018-100431040 TCTGCTCTGCAGGGTCCCTCAGG + Exonic
1032323464 7:130905054-130905076 CTTCCTCTGCAGGGTCTCACGGG + Intergenic
1035238898 7:157517455-157517477 TGCCCTCTGCGGGGCCCGGCTGG + Intergenic
1035604332 8:919761-919783 TTTCCTCTGCAGGACACAGAAGG + Intergenic
1039804033 8:40983545-40983567 TTTCCCCTGAAGGGCTCCACTGG + Intergenic
1040385837 8:46914426-46914448 TAGCCTCTGCAGTGCCCCGGGGG - Intergenic
1040707305 8:50144663-50144685 TTTGCACTGCAGGGACCAGCAGG + Intronic
1041329962 8:56714008-56714030 TGTCCTCTGCAGCGTCCTGCAGG + Intergenic
1048314238 8:133350438-133350460 TTTCCTCTGCAGGGGCTGCCTGG + Intergenic
1048327839 8:133452624-133452646 TTTCCTCTCCAGGTCCCCTAGGG + Intergenic
1048377312 8:133834001-133834023 TTTCTTCTGCAGGGCCTCTTGGG + Intergenic
1049415515 8:142493127-142493149 TTTACTCTGCAGGCCCCCCAGGG - Intronic
1049714647 8:144084145-144084167 TCTCCCCTGCAGGGCCGAGCTGG + Exonic
1050173851 9:2850209-2850231 TTTGCTCTGCAGTGCCATGCTGG - Intergenic
1052342183 9:27374888-27374910 TTTCCTCTCAAGGGTCCAGCTGG - Intronic
1057230884 9:93320684-93320706 TGTTCTCTGCAGGGCCCTGGAGG + Intronic
1058649965 9:107166573-107166595 CTCCCACTGCAGGTCCCCGCTGG + Intergenic
1060892376 9:127196990-127197012 TTTGCCCTGCAGGGCCCTGTGGG - Intronic
1061261442 9:129482825-129482847 TTTCGCCCGCCGGGCCCCGCGGG - Intergenic
1061516151 9:131091621-131091643 TTTCCTCTGCAAGGACCCCGGGG - Exonic
1061817848 9:133207088-133207110 TTTCATGTGCCGGGCACCGCTGG - Intronic
1061818202 9:133208438-133208460 TGCCCACTGCAGGGCCCCTCAGG - Intronic
1062242254 9:135546920-135546942 TGCCCACTGCAGGGCCCCTCAGG + Intronic
1062555952 9:137113550-137113572 TTTCCTCCTCAGGGGCCCACAGG + Intronic