ID: 945125727

View in Genome Browser
Species Human (GRCh38)
Location 2:206507457-206507479
Sequence CAGTGGAAGGTGAAGGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4333
Summary {0: 1, 1: 0, 2: 20, 3: 268, 4: 4044}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945125727_945125733 -3 Left 945125727 2:206507457-206507479 CCTCCCACCTTCACCTTCCACTG 0: 1
1: 0
2: 20
3: 268
4: 4044
Right 945125733 2:206507477-206507499 CTGTGATTGTAAGTTTTTTGAGG 0: 1
1: 14
2: 223
3: 1545
4: 8161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945125727 Original CRISPR CAGTGGAAGGTGAAGGTGGG AGG (reversed) Intronic
Too many off-targets to display for this crispr