ID: 945127076

View in Genome Browser
Species Human (GRCh38)
Location 2:206524494-206524516
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 8564
Summary {0: 5, 1: 179, 2: 2034, 3: 3746, 4: 2600}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945127076_945127077 -7 Left 945127076 2:206524494-206524516 CCATTTTCACTCTGCTAATAAAG 0: 5
1: 179
2: 2034
3: 3746
4: 2600
Right 945127077 2:206524510-206524532 AATAAAGACATTCCCAAGACTGG 0: 6
1: 904
2: 3062
3: 5509
4: 7769
945127076_945127082 23 Left 945127076 2:206524494-206524516 CCATTTTCACTCTGCTAATAAAG 0: 5
1: 179
2: 2034
3: 3746
4: 2600
Right 945127082 2:206524540-206524562 ATAAAGAAAAAGAGGTTTAATGG 0: 1338
1: 1566
2: 1040
3: 923
4: 2126
945127076_945127081 15 Left 945127076 2:206524494-206524516 CCATTTTCACTCTGCTAATAAAG 0: 5
1: 179
2: 2034
3: 3746
4: 2600
Right 945127081 2:206524532-206524554 GGTAATTTATAAAGAAAAAGAGG 0: 1415
1: 1580
2: 1055
3: 773
4: 1268
945127076_945127078 -6 Left 945127076 2:206524494-206524516 CCATTTTCACTCTGCTAATAAAG 0: 5
1: 179
2: 2034
3: 3746
4: 2600
Right 945127078 2:206524511-206524533 ATAAAGACATTCCCAAGACTGGG 0: 17
1: 2250
2: 4297
3: 7807
4: 9168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945127076 Original CRISPR CTTTATTAGCAGAGTGAAAA TGG (reversed) Intronic
Too many off-targets to display for this crispr